ID: 1034768536

View in Genome Browser
Species Human (GRCh38)
Location 7:153749270-153749292
Sequence GGAGATCCTACCCTGCTTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034768531_1034768536 -3 Left 1034768531 7:153749250-153749272 CCGCCGGCCACCCTGGGGCTGGA No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data
1034768529_1034768536 -2 Left 1034768529 7:153749249-153749271 CCCGCCGGCCACCCTGGGGCTGG No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data
1034768521_1034768536 29 Left 1034768521 7:153749218-153749240 CCAGCAGCAGGGCTCTGCCCGTG No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data
1034768524_1034768536 11 Left 1034768524 7:153749236-153749258 CCGTGCATCCGCTCCCGCCGGCC No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data
1034768533_1034768536 -10 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data
1034768532_1034768536 -6 Left 1034768532 7:153749253-153749275 CCGGCCACCCTGGGGCTGGAGAT No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data
1034768526_1034768536 3 Left 1034768526 7:153749244-153749266 CCGCTCCCGCCGGCCACCCTGGG No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data
1034768523_1034768536 12 Left 1034768523 7:153749235-153749257 CCCGTGCATCCGCTCCCGCCGGC No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034768536 Original CRISPR GGAGATCCTACCCTGCTTTG CGG Intergenic