ID: 1034768540

View in Genome Browser
Species Human (GRCh38)
Location 7:153749279-153749301
Sequence ACCCTGCTTTGCGGCTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034768524_1034768540 20 Left 1034768524 7:153749236-153749258 CCGTGCATCCGCTCCCGCCGGCC No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data
1034768532_1034768540 3 Left 1034768532 7:153749253-153749275 CCGGCCACCCTGGGGCTGGAGAT No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data
1034768533_1034768540 -1 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data
1034768534_1034768540 -4 Left 1034768534 7:153749260-153749282 CCCTGGGGCTGGAGATCCTACCC No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data
1034768529_1034768540 7 Left 1034768529 7:153749249-153749271 CCCGCCGGCCACCCTGGGGCTGG No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data
1034768535_1034768540 -5 Left 1034768535 7:153749261-153749283 CCTGGGGCTGGAGATCCTACCCT No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data
1034768523_1034768540 21 Left 1034768523 7:153749235-153749257 CCCGTGCATCCGCTCCCGCCGGC No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data
1034768531_1034768540 6 Left 1034768531 7:153749250-153749272 CCGCCGGCCACCCTGGGGCTGGA No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data
1034768526_1034768540 12 Left 1034768526 7:153749244-153749266 CCGCTCCCGCCGGCCACCCTGGG No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034768540 Original CRISPR ACCCTGCTTTGCGGCTGGGC TGG Intergenic