ID: 1034768544

View in Genome Browser
Species Human (GRCh38)
Location 7:153749309-153749331
Sequence AGCTGTTTCCCATGATTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034768535_1034768544 25 Left 1034768535 7:153749261-153749283 CCTGGGGCTGGAGATCCTACCCT No data
Right 1034768544 7:153749309-153749331 AGCTGTTTCCCATGATTGCGAGG No data
1034768533_1034768544 29 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768544 7:153749309-153749331 AGCTGTTTCCCATGATTGCGAGG No data
1034768539_1034768544 10 Left 1034768539 7:153749276-153749298 CCTACCCTGCTTTGCGGCTGGGC No data
Right 1034768544 7:153749309-153749331 AGCTGTTTCCCATGATTGCGAGG No data
1034768542_1034768544 5 Left 1034768542 7:153749281-153749303 CCTGCTTTGCGGCTGGGCTGGCA No data
Right 1034768544 7:153749309-153749331 AGCTGTTTCCCATGATTGCGAGG No data
1034768534_1034768544 26 Left 1034768534 7:153749260-153749282 CCCTGGGGCTGGAGATCCTACCC No data
Right 1034768544 7:153749309-153749331 AGCTGTTTCCCATGATTGCGAGG No data
1034768541_1034768544 6 Left 1034768541 7:153749280-153749302 CCCTGCTTTGCGGCTGGGCTGGC No data
Right 1034768544 7:153749309-153749331 AGCTGTTTCCCATGATTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034768544 Original CRISPR AGCTGTTTCCCATGATTGCG AGG Intergenic