ID: 1034776848

View in Genome Browser
Species Human (GRCh38)
Location 7:153835738-153835760
Sequence TCATCCAACGATTGGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034776844_1034776848 9 Left 1034776844 7:153835706-153835728 CCAAGAATAAAATTGTGCCAGAA No data
Right 1034776848 7:153835738-153835760 TCATCCAACGATTGGTTTTGAGG No data
1034776842_1034776848 11 Left 1034776842 7:153835704-153835726 CCCCAAGAATAAAATTGTGCCAG No data
Right 1034776848 7:153835738-153835760 TCATCCAACGATTGGTTTTGAGG No data
1034776845_1034776848 -8 Left 1034776845 7:153835723-153835745 CCAGAACCTAGAACATCATCCAA No data
Right 1034776848 7:153835738-153835760 TCATCCAACGATTGGTTTTGAGG No data
1034776843_1034776848 10 Left 1034776843 7:153835705-153835727 CCCAAGAATAAAATTGTGCCAGA No data
Right 1034776848 7:153835738-153835760 TCATCCAACGATTGGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034776848 Original CRISPR TCATCCAACGATTGGTTTTG AGG Intergenic
No off target data available for this crispr