ID: 1034781894

View in Genome Browser
Species Human (GRCh38)
Location 7:153888336-153888358
Sequence CAGGCACGCGGCCCTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034781894_1034781903 -3 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781903 7:153888356-153888378 CTGGAAACGCGGCTGGTCCGCGG No data
1034781894_1034781906 8 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781906 7:153888367-153888389 GCTGGTCCGCGGAAGGCTCCGGG 0: 1
1: 0
2: 1
3: 10
4: 82
1034781894_1034781909 20 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781909 7:153888379-153888401 AAGGCTCCGGGCAGCTGGCCAGG No data
1034781894_1034781905 7 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781905 7:153888366-153888388 GGCTGGTCCGCGGAAGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 117
1034781894_1034781911 22 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781911 7:153888381-153888403 GGCTCCGGGCAGCTGGCCAGGGG No data
1034781894_1034781904 1 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781904 7:153888360-153888382 AAACGCGGCTGGTCCGCGGAAGG No data
1034781894_1034781910 21 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781910 7:153888380-153888402 AGGCTCCGGGCAGCTGGCCAGGG No data
1034781894_1034781901 -10 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781901 7:153888349-153888371 CGCGTGCCTGGAAACGCGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 112
1034781894_1034781908 15 Left 1034781894 7:153888336-153888358 CCCCCAGGAGGGCCGCGTGCCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1034781908 7:153888374-153888396 CGCGGAAGGCTCCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034781894 Original CRISPR CAGGCACGCGGCCCTCCTGG GGG (reversed) Intronic