ID: 1034784254

View in Genome Browser
Species Human (GRCh38)
Location 7:153910739-153910761
Sequence CTGAATATTAGGATGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034784254_1034784257 3 Left 1034784254 7:153910739-153910761 CCATTGTTCATCCTAATATTCAG 0: 1
1: 1
2: 0
3: 18
4: 219
Right 1034784257 7:153910765-153910787 CTGAAGCTTGCAGCGACCTTTGG 0: 1
1: 0
2: 0
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034784254 Original CRISPR CTGAATATTAGGATGAACAA TGG (reversed) Intronic
901203649 1:7481444-7481466 CTGAATCTTAGTGTGAACCATGG - Intronic
902926039 1:19696213-19696235 CTCAATATTAGGATAATCATCGG - Intronic
904414627 1:30351289-30351311 CAGAATATAAGGATAAACATTGG - Intergenic
904999034 1:34653696-34653718 CTGCATAGTAAGATGAAGAAAGG + Intergenic
905116385 1:35644688-35644710 ATGAATATTGGTATGTACAAAGG - Intergenic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
909317157 1:74237578-74237600 CTGAATATTAGGATTAACAATGG + Intronic
911476326 1:98377940-98377962 CAGAACATTTGGATGAACCAAGG - Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912602809 1:110955225-110955247 CTGAATATAAGGAATAAGAAAGG - Intronic
914452619 1:147806177-147806199 CTTAATATTAGTGTGAACTAGGG - Intergenic
916644301 1:166767363-166767385 CTGAATCTGAGGAGGAACAAAGG - Intergenic
917880616 1:179332135-179332157 CTGAGTATTACAATGAAAAAAGG - Intronic
921894677 1:220387251-220387273 CTGAATCTTGGTAGGAACAATGG - Intergenic
922208012 1:223465931-223465953 TTGAAAAATAAGATGAACAATGG - Intergenic
922997441 1:229975680-229975702 CTGAACATTTGGGTGAACGATGG + Intergenic
923082595 1:230672680-230672702 CTGAACATTAGGAGAAAAAATGG - Intronic
924121147 1:240799507-240799529 CAAAATGTTAGGATGTACAAGGG - Intronic
924188788 1:241525736-241525758 CTGACTTTTAGGAAGAACAGAGG + Intergenic
1064193836 10:13229648-13229670 GAGAATATTACGAGGAACAAAGG - Exonic
1065638836 10:27759788-27759810 CTGAAGCTTAGGATGCATAACGG + Intergenic
1068057698 10:52031820-52031842 CTTTATATTTGGATGATCAAGGG + Intronic
1070964313 10:80520334-80520356 CTGAATAGTTGGATGAGGAATGG + Exonic
1071389253 10:85154412-85154434 CTGAAAATTAGGATTACTAAGGG + Intergenic
1072276389 10:93827528-93827550 CTGAATAAGTGGATGAAGAATGG + Intergenic
1072886355 10:99278615-99278637 CTGTTTATCAGGATGAAAAAAGG + Intergenic
1073699825 10:105914311-105914333 GTGAATAATGTGATGAACAAGGG - Intergenic
1074507155 10:114081365-114081387 ATGAATAATAGGCTGAATAAAGG - Intergenic
1074922516 10:118030865-118030887 ATGAGTATTAGGATGACAAAGGG + Intronic
1078007410 11:7542499-7542521 CTGCATCTGAGGAAGAACAATGG - Intronic
1079142396 11:17820627-17820649 CTGTATAGTGGGTTGAACAATGG + Intronic
1079214379 11:18494949-18494971 CTGAATATTTAGATAAAGAAAGG - Intronic
1081054225 11:38388022-38388044 CTGAGTATTAGGAACATCAAAGG + Intergenic
1081068552 11:38578887-38578909 CTGAATATTACCATAAACAATGG + Intergenic
1082117322 11:48341456-48341478 CCGAATAGGAGGGTGAACAAAGG + Intergenic
1084930095 11:72548305-72548327 ATGAATATTAGGACGAAGATGGG + Intergenic
1085282963 11:75342683-75342705 CTGAGGATGAGGATGAAGAATGG + Intronic
1086798308 11:91136902-91136924 CTGAATATTTGGAGGATCACTGG + Intergenic
1087425839 11:97984600-97984622 CTGAACCTTAGGATGCAGAAAGG + Intergenic
1087945976 11:104161044-104161066 CTTAATGTTGGGATGAAGAAAGG - Intronic
1088008974 11:104975683-104975705 AGGAATTTTATGATGAACAATGG + Intergenic
1088046090 11:105453280-105453302 CTGAATCTTGGTAAGAACAATGG - Intergenic
1088513770 11:110605263-110605285 ATGAAAAATAGAATGAACAAAGG + Intronic
1090001691 11:122966264-122966286 CTAAATATTGGGATCATCAAAGG - Intergenic
1093354431 12:18148321-18148343 ATGAATATTATGATGTAAAATGG + Intronic
1097448560 12:59707386-59707408 AGGAACATTAGAATGAACAATGG + Intronic
1100037387 12:90269521-90269543 CTGATTAAAAGGATGAACCAAGG - Intergenic
1100192413 12:92207092-92207114 CTGTATAATACCATGAACAAAGG - Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107556920 13:41524203-41524225 CTTAATATTGGGATGATAAAAGG + Intergenic
1108596134 13:51951242-51951264 CTGAATATGAGGGTAAAGAAAGG + Intronic
1108857207 13:54809118-54809140 CTGAAGATTAGGAAGTACTAAGG + Intergenic
1109059196 13:57591656-57591678 CAGAAAATTAGAATAAACAATGG + Intergenic
1111940990 13:94606593-94606615 CTGAATAATAAGAGGAAAAAGGG - Intronic
1112385233 13:98933193-98933215 CTTAATGTTAGGATGAAGAATGG - Intronic
1116281135 14:42909217-42909239 AATAATATTAGGAAGAACAAAGG + Intergenic
1116362383 14:44016377-44016399 CTGAAGATTAGAAGGAAAAATGG - Intergenic
1116646820 14:47539388-47539410 CTTAATTTTAAGATGTACAAAGG + Intronic
1116795488 14:49385330-49385352 CAGAATATGAGTAGGAACAAAGG + Intergenic
1117944346 14:61001757-61001779 ATGAATATTAGAAGGAAGAAGGG - Intronic
1119136038 14:72221263-72221285 AAGAAAATTAGGATGAGCAATGG - Intronic
1120133535 14:80836227-80836249 CAAACTATCAGGATGAACAAGGG - Exonic
1120306316 14:82774960-82774982 CTAAATACTAGGTTGACCAAAGG + Intergenic
1122095965 14:99372551-99372573 ATTAAAATTAGGATGAAAAAAGG - Intergenic
1124466004 15:29940436-29940458 CTGAGCATTAGAATGAAAAATGG - Intronic
1126320802 15:47420587-47420609 CAGAATATCAGGACAAACAATGG - Intronic
1126958531 15:53962904-53962926 CTGAATTTTATCATGTACAAAGG - Intergenic
1130515367 15:84622163-84622185 CTGGAAATGAGGATGAGCAAGGG - Exonic
1131447086 15:92508980-92509002 ATGTATATTTGGAAGAACAAAGG + Intergenic
1138279840 16:55764339-55764361 CTGGATGAGAGGATGAACAAGGG - Intergenic
1138791206 16:59906146-59906168 CTGAACCTTAGGATCATCAAGGG - Intergenic
1138838613 16:60470062-60470084 CTGAAGAGTAGAAAGAACAAAGG + Intergenic
1139131066 16:64146200-64146222 CTGAATCTGAGGATGAAAACAGG - Intergenic
1140615336 16:76656196-76656218 CTGAAAAACAGGATGAAAAAGGG - Intergenic
1142541897 17:666205-666227 CTGAATATTGGCATGCCCAAGGG - Intronic
1143083883 17:4401485-4401507 CTGTATAGTAGGCTGAATAATGG + Intergenic
1144371272 17:14594010-14594032 CTGAACGTGAGGAAGAACAATGG + Intergenic
1145872976 17:28291063-28291085 AAAATTATTAGGATGAACAATGG - Intergenic
1146497403 17:33335552-33335574 CTGAATCTTAGGAGGTAGAAGGG + Intronic
1147024512 17:37568602-37568624 CTGAAGTTTAAGATGGACAAAGG + Intronic
1148008946 17:44458913-44458935 GAAATTATTAGGATGAACAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1157168655 18:45382036-45382058 CTGAATATTGGGTTGAATGAAGG - Intronic
1158063586 18:53377871-53377893 CTGAATCTTTTGATGAACAATGG - Intronic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158334756 18:56403944-56403966 CTAAATTTTATGATGAACAGGGG - Intergenic
1166773754 19:45300039-45300061 CTGAAGTTTAAGATGATCAAGGG - Intronic
926417966 2:12669082-12669104 CAGAATATTAGGATAGACAAAGG - Intergenic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
927935651 2:27074682-27074704 CTGAATATTGGGAGGGAAAAAGG - Intergenic
930568839 2:53058821-53058843 CTGGCTATTAGGTAGAACAAAGG - Intergenic
932281379 2:70495428-70495450 CACAAGATTAGGATGAATAAGGG - Intronic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936541312 2:113354264-113354286 CTGAATTTTAGTATGAAACAAGG - Intergenic
936607757 2:113975096-113975118 CTGAATAGGAGTAGGAACAAAGG + Intergenic
937703205 2:124887647-124887669 CTGAAAATGAGGATGAAAGAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938229345 2:129645165-129645187 ATGAATGTTAGGATGAAAATGGG - Intergenic
938860031 2:135358722-135358744 CTGAATATAAGAATAAGCAATGG + Intronic
941156486 2:161985044-161985066 CAAAATATTAGGATTAACATAGG - Exonic
941729089 2:168896052-168896074 CTAAATATTAGTATGAAAAAAGG + Intronic
941881904 2:170489353-170489375 GTGAATGTGAGGAGGAACAATGG + Intronic
942923066 2:181400389-181400411 CTGAATTTTATGATTAAAAAGGG - Intergenic
943977011 2:194495454-194495476 ATGAATATAATGATGAACTATGG - Intergenic
944353106 2:198753695-198753717 CTCATTATTAGGATTAACCATGG + Intergenic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
946012106 2:216573637-216573659 CTCCATATCAGGATGACCAAGGG + Intronic
946964847 2:225026800-225026822 TTTAATGTTAGGATGTACAAGGG - Intronic
1172290353 20:33771552-33771574 ATGATTCTTAGAATGAACAAGGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
950672148 3:14533686-14533708 CTGAATATTGGGGTGAGGAAAGG - Intronic
950864731 3:16179977-16179999 CTGGATACCAGGATGATCAAAGG - Intronic
954091479 3:48287771-48287793 CTTCTTGTTAGGATGAACAATGG - Intronic
955889796 3:63637698-63637720 TTGAACATCAGGATGAAAAAAGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956010349 3:64824213-64824235 CGGAATATAAAGATGAACAGGGG + Intergenic
956143546 3:66169760-66169782 CTGAACATTAGGAGGAACTATGG + Intronic
956343522 3:68252220-68252242 CTGAATAGTAGCAGGAGCAATGG - Intronic
957495457 3:80986034-80986056 CTGTATATTACAATGAACAATGG - Intergenic
957820778 3:85371586-85371608 CTTAATATTATGATGAAGATAGG - Intronic
959471861 3:106762214-106762236 TTAAATATTAGGATGAGGAATGG + Intergenic
961117539 3:124343522-124343544 GTGGCTCTTAGGATGAACAATGG + Intronic
964047636 3:152349603-152349625 CTTATTATTAGGATGACTAATGG - Intronic
964714493 3:159707794-159707816 CTGAAAATTAGGGGGGACAAAGG - Intronic
964723670 3:159792373-159792395 CTGGATGTGAGGATGAACACTGG + Intronic
965737088 3:171832261-171832283 TTGAGTATTAGGAAAAACAAAGG + Intergenic
965816985 3:172647033-172647055 CTGAATAAAAGAATAAACAACGG + Intronic
966413602 3:179667286-179667308 CTGAATTTGAGTATGAATAATGG - Intronic
969154052 4:5194433-5194455 CTGAGGATGAGGATGAGCAAAGG - Intronic
970016692 4:11519917-11519939 CTGAATATGAGGGTGAGTAAAGG + Intergenic
970505816 4:16729294-16729316 ATAAATAATAGGATGAATAAAGG - Intronic
975332322 4:73131456-73131478 CAAAATATAAGGAAGAACAAAGG - Intronic
975494877 4:75026821-75026843 TTGTAAATTAGCATGAACAAAGG - Intronic
976431768 4:84970335-84970357 CTGATAATTATGATGAACAAGGG - Intergenic
976535940 4:86217212-86217234 ATGAATTTTAGGAAGAACTAGGG - Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
979041447 4:115802418-115802440 CTGAATATTTGTATGAAAAATGG + Intergenic
981719497 4:147787293-147787315 CTCAATATTTGAATGAATAAAGG + Intronic
982485718 4:155963244-155963266 CTGAATTTCATGAAGAACAAAGG - Intergenic
982538780 4:156641088-156641110 CTGAGTAGTGGGATGAAAAATGG - Intronic
983026410 4:162742575-162742597 CCTAATATTAGAATGAGCAAGGG - Intergenic
983554239 4:169045847-169045869 CTGTATTTTAGGCAGAACAAAGG + Intergenic
983567961 4:169174692-169174714 CTGCATATTAGGATCAACTAGGG + Intronic
984025074 4:174533553-174533575 CTGAGTTTTAGAATGAAGAATGG + Intergenic
984556744 4:181223289-181223311 CAGAATATTAGGATGTCAAAAGG - Intergenic
985134518 4:186772429-186772451 CTCAATATTAGTAAGAAGAAAGG - Intergenic
986895430 5:12360498-12360520 TTTATTATTAGGCTGAACAAGGG + Intergenic
987786751 5:22510267-22510289 ATGAATATTAGGATTAGCTATGG - Intronic
989691520 5:44150855-44150877 CTGAATATCAGGATGTATCATGG - Intergenic
990984893 5:61632217-61632239 CTGCATATTAGGATTCACTAAGG - Intergenic
991386006 5:66091037-66091059 TTATATATTAGGATGAAAAATGG - Intergenic
991504408 5:67309059-67309081 CTTGATGTTAGAATGAACAAAGG - Intergenic
992202540 5:74398615-74398637 CTGAATATGAAGAGGAACAGAGG - Intergenic
992307593 5:75459323-75459345 CTGAAGATAAGAATGTACAAAGG + Intronic
992471452 5:77059775-77059797 ATGAATGTTATTATGAACAAAGG - Intronic
992944512 5:81796507-81796529 CTTAATTTTAGGATGAAGGAGGG + Intergenic
993048970 5:82903081-82903103 CTGAATCTAAGTAAGAACAATGG - Intergenic
993252450 5:85546868-85546890 CTGAATTTTTGGAAGAATAATGG - Intergenic
994950505 5:106455226-106455248 CTGGCTATTGGAATGAACAAAGG + Intergenic
994955070 5:106519121-106519143 CTGAATACTAGGTGGCACAAAGG + Intergenic
995536254 5:113139299-113139321 CTGAAAACTAGGCTCAACAAAGG - Intronic
995913755 5:117218477-117218499 CTGAATTTTAGTAAGAAAAAGGG + Intergenic
998629334 5:143880961-143880983 CTGAGTATTAGGATTAAAGAAGG + Intergenic
1000505057 5:162106287-162106309 CACAATATTAGGATGCACAAAGG - Intronic
1001724618 5:173886762-173886784 ATGAAAAATAGTATGAACAAAGG - Intergenic
1005056963 6:21738443-21738465 CTGGAGATGAGGATGGACAAGGG + Intergenic
1006913445 6:37579072-37579094 CTGAGTATTAGGATGAGGCAGGG - Intergenic
1007979602 6:46137838-46137860 CTTAAAATTAGGAAGACCAAAGG - Intronic
1008866691 6:56220342-56220364 CTGATTAGTAGAAGGAACAAAGG + Intronic
1008980112 6:57473516-57473538 CTGCATATTAGATTCAACAAGGG - Intronic
1009048691 6:58255558-58255580 CTGGATATTAGGAACAACAACGG + Intergenic
1009168216 6:60366455-60366477 CTGCATATTAGATTCAACAAGGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009586308 6:65609426-65609448 CTAAGTATTAGGAGTAACAAGGG - Intronic
1011681452 6:89787344-89787366 TTGGATATAAGCATGAACAAAGG - Intronic
1011852054 6:91641158-91641180 CTGAATATTAGGAAAATCAAAGG + Intergenic
1012859090 6:104537864-104537886 CTCAATATTGGTATTAACAAAGG + Intergenic
1012934432 6:105351329-105351351 ATGAATATGAGGAAGAATAAAGG - Intronic
1014681718 6:124439279-124439301 CTTAGTTTTAGGATGAACATAGG - Intronic
1015538732 6:134293692-134293714 CTGAATATTAAGATGATTTATGG + Intronic
1016114889 6:140268116-140268138 GTAAATATAATGATGAACAAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017731329 6:157319253-157319275 CATAATATTAAGATGAGCAAGGG + Intronic
1020728963 7:11856461-11856483 CTGAATATTAGGAAACACACTGG - Intergenic
1021101609 7:16590950-16590972 CTGAATGTGAGGATGGACATGGG - Intergenic
1021254013 7:18367329-18367351 CTGAAAAATAGGAAGAACAGGGG - Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1022568462 7:31427455-31427477 CTGCACATTAGAATCAACAAGGG + Intergenic
1022769011 7:33449076-33449098 ATAAATATTGAGATGAACAAGGG + Intronic
1023194625 7:37621575-37621597 ATGAATATTAGAGTTAACAATGG - Intergenic
1023459369 7:40378309-40378331 CTGAATAGTAGAAAGAAAAAAGG - Intronic
1024207988 7:47180080-47180102 ATGAAAATCAGGAAGAACAAGGG + Intergenic
1024221047 7:47286990-47287012 CTGAATATTGGGAGGAAGAGTGG - Intronic
1024803861 7:53112866-53112888 CTGAATATGAGGGTGAAAATGGG - Intergenic
1027906063 7:84184277-84184299 CTGTATATTAGAATGTGCAAAGG + Intronic
1028074185 7:86490964-86490986 CTGAATATTAATATGTACATTGG - Intergenic
1028619342 7:92806752-92806774 CTGAATGTCAGAGTGAACAAAGG - Intronic
1028794751 7:94890502-94890524 CTGCATATTAGGATTACCTAGGG + Intergenic
1030504203 7:110399120-110399142 CTGAATATTAAGATCAGCAGAGG + Intergenic
1031193000 7:118578561-118578583 TTAAATATTAGGATGAACCATGG + Intergenic
1033556690 7:142494363-142494385 CTGAATCTTGGAATGGACAAAGG - Intergenic
1033613479 7:142988099-142988121 CTGAATAGTTGGATGAACGGTGG + Intergenic
1034784254 7:153910739-153910761 CTGAATATTAGGATGAACAATGG - Intronic
1036467158 8:9010164-9010186 GTGAATATTTGGAAGAGCAAAGG + Intronic
1039182883 8:34886288-34886310 TTGAATAGTAGGCTAAACAATGG - Intergenic
1041636316 8:60149708-60149730 GGCAATATTAGGATAAACAATGG + Intergenic
1042332904 8:67599913-67599935 CTTAATCTTAGGTTTAACAAAGG + Intronic
1042341035 8:67679793-67679815 CTTAATGTTAGGTTGAACTATGG - Intronic
1043977060 8:86595236-86595258 CTGGATATTAGGAAAAATAAGGG + Intronic
1044141261 8:88656342-88656364 CAGTATATTAGGATAAATAATGG + Intergenic
1045517479 8:102872715-102872737 CAGATTATTAGAATAAACAATGG + Intronic
1047066823 8:121293261-121293283 CAGAATAAAAGGATGAAGAAAGG + Intergenic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1049755099 8:144307812-144307834 CTGAATCTTAGTAAGAACAGTGG - Intronic
1051057871 9:13009066-13009088 CTCAAATTTAGGATGACCAATGG - Intergenic
1051329789 9:16012083-16012105 CTGAAGGTTAGGGTGAACATAGG + Intronic
1052021381 9:23529654-23529676 CTGCACATGAGGATGTACAATGG + Intergenic
1052899378 9:33778164-33778186 CAGAAAATTAGGTTGAAAAAAGG + Intronic
1053094184 9:35309962-35309984 CTGTACCTTAGGATGAGCAAAGG - Intronic
1053525069 9:38820837-38820859 CAGAATGTTATGATGAACATTGG - Intergenic
1054197300 9:62045259-62045281 CAGAATGTTATGATGAACATTGG - Intergenic
1054641109 9:67543423-67543445 CAGAATGTTATGATGAACATTGG + Intergenic
1056542149 9:87581317-87581339 CTTAATATCAGGATGTTCAAGGG - Intronic
1057736769 9:97669844-97669866 CTAAATATTCTGATGAGCAATGG - Intronic
1059611283 9:115899371-115899393 CTGGATGTTTGGAGGAACAAAGG + Intergenic
1186468729 X:9804721-9804743 CTGAAAATTGGGAGGAACCAGGG + Intronic
1188881294 X:35494894-35494916 CAGAATATTATGAAGACCAAAGG + Intergenic
1190035478 X:47019308-47019330 CAGAGTGGTAGGATGAACAAGGG + Intronic
1191128520 X:56983710-56983732 CTGAGTAGTGGGATGAGCAAAGG + Intronic
1191927304 X:66327386-66327408 ATGAATAATATAATGAACAAAGG + Intergenic
1194504865 X:94721990-94722012 CTTCATATTAGGATGTACATTGG - Intergenic
1194741072 X:97575034-97575056 CTGGATATGAGGATAAAAAAGGG + Intronic
1197767052 X:130066147-130066169 CTGAATCTCGGCATGAACAAAGG + Exonic
1197804727 X:130387707-130387729 CTGAATATTAGAATCACCCAAGG - Intergenic
1199001070 X:142636980-142637002 CTGTATTTTAAGATGCACAATGG - Intergenic
1200024030 X:153240070-153240092 CTGAATATTAGGTACAAGAAGGG - Intergenic