ID: 1034785387

View in Genome Browser
Species Human (GRCh38)
Location 7:153921581-153921603
Sequence CCCTCTTTACAGTGGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034785387 Original CRISPR CCCTCTTTACAGTGGCACTG TGG (reversed) Intronic
900667388 1:3824787-3824809 CCCTTCCCACAGTGGCACTGCGG - Intronic
901761134 1:11472337-11472359 CACTCCCTACTGTGGCACTGAGG - Intergenic
902169260 1:14597893-14597915 CCCTCTTCACAGAAGAACTGAGG - Intergenic
903277256 1:22230125-22230147 CCCGCCTCACACTGGCACTGAGG - Intergenic
906124190 1:43416602-43416624 CCAGCTTCGCAGTGGCACTGTGG + Exonic
906152536 1:43595991-43596013 CCTTCTCTACAGCGGCACTGAGG - Intronic
910855301 1:91688962-91688984 CCTTCTTTACAGTCACATTGGGG - Intronic
912322519 1:108727631-108727653 CCCTCTATGCAGTGGCAATTAGG + Intronic
913338569 1:117733696-117733718 CTCTCTGTACAGTGGAACTATGG - Intergenic
918026400 1:180753261-180753283 TCATCTTTAAAGAGGCACTGTGG + Intronic
920118795 1:203639927-203639949 CCCTATTTTCAGAGGCAATGTGG + Intronic
921262284 1:213394928-213394950 CCATCAGTGCAGTGGCACTGTGG + Intergenic
922092618 1:222411182-222411204 CCCTCTGGGCAGAGGCACTGAGG + Intergenic
922504078 1:226116361-226116383 CCTTCTTGACTGTGGCACTAAGG - Intergenic
1064015982 10:11772789-11772811 GCCTCTTCACAGTTGCACTCTGG + Intergenic
1067550681 10:47233492-47233514 CCCCCTTTAGAATGACACTGGGG - Intergenic
1069631022 10:69897136-69897158 ACCTCATGACAGTGGCACTCTGG + Intronic
1073747847 10:106490392-106490414 ACCTCTTAACACTTGCACTGGGG - Intergenic
1074572453 10:114636318-114636340 CATTCTTTAGAGTGGCATTGAGG - Intronic
1075557987 10:123447228-123447250 CCCTGGCTACAGTGGCACTCAGG - Intergenic
1076166680 10:128287716-128287738 CCTGCTTTGCAGGGGCACTGGGG - Intergenic
1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG + Intronic
1076840383 10:133042394-133042416 CCCTGTTTTCCGTGGCCCTGTGG + Intergenic
1077059335 11:610885-610907 CCCTCTGGCCAGAGGCACTGTGG - Intronic
1077286079 11:1766590-1766612 CCCGCTTTACAGAGGCAGTGAGG + Intergenic
1077453829 11:2666186-2666208 CCCTCTGGAGAGTGGGACTGAGG - Intronic
1079315965 11:19408073-19408095 GCTTCATTACAGTGGCATTGGGG - Intronic
1080222110 11:29917860-29917882 GCCTATTTACAGTGGCTCTGGGG + Intergenic
1083621894 11:64053419-64053441 CCCTCCCTCCAGGGGCACTGAGG + Intronic
1083696758 11:64448618-64448640 CCCTCTCCACAGTGGCAGTCAGG - Intergenic
1088237537 11:107741747-107741769 CCATCTTTCCTGTGGGACTGGGG - Intergenic
1090350141 11:126102779-126102801 CCCACTTCACAGTTGCACTTGGG - Intergenic
1091595717 12:1877872-1877894 CCCTCTTCACTGTGACACAGAGG - Intronic
1094205254 12:27832772-27832794 ACCTCTCTACACTGCCACTGTGG + Intergenic
1095516012 12:43006332-43006354 CCCTAGGTTCAGTGGCACTGGGG - Intergenic
1095927286 12:47591613-47591635 CACTCTTTCCAGTGTCACAGGGG + Intergenic
1096608469 12:52784889-52784911 CTTTCTCTGCAGTGGCACTGTGG + Intergenic
1096970819 12:55664926-55664948 CCCTCTGTACAGGGGGATTGTGG - Intergenic
1100806211 12:98286472-98286494 ACCTCTTCAGAGAGGCACTGTGG + Intergenic
1101826972 12:108228040-108228062 CCCTCTTTACTGTGGGGCGGGGG + Intronic
1102005320 12:109585983-109586005 TCATCTTTACTGTGGCAGTGAGG - Intronic
1104386414 12:128355193-128355215 CCATTTTCACAGGGGCACTGGGG + Intronic
1106049213 13:26174950-26174972 CCCTATTTCCAGAGTCACTGGGG + Intronic
1106653686 13:31719426-31719448 GACTCTTTTCCGTGGCACTGAGG - Intergenic
1112320181 13:98399334-98399356 AGCTCTTCACAGTGACACTGAGG - Intronic
1113362493 13:109644351-109644373 GCCTCCTTTCTGTGGCACTGTGG - Intergenic
1114660994 14:24344775-24344797 CTCTTTTTACTGTGGCAGTGCGG + Intergenic
1119346398 14:73928325-73928347 CCCTATTTACAGTTCCACAGAGG - Intronic
1120704870 14:87735403-87735425 TCCTCTTTACAGAAACACTGGGG - Intergenic
1121322913 14:93003020-93003042 CCCTCCTCACAGAGGCCCTGTGG - Intronic
1121744261 14:96275669-96275691 CCCTCTTCTCAGTGGAACTTTGG - Exonic
1124212939 15:27778138-27778160 CCATGATTACAATGGCACTGGGG + Intronic
1125729198 15:41883274-41883296 CCCTCTGAGCACTGGCACTGGGG + Intronic
1127701057 15:61501584-61501606 CCCTCTTGACAGTGAGATTGTGG - Intergenic
1129325796 15:74799678-74799700 CCCTCCTCATGGTGGCACTGTGG - Intronic
1131316594 15:91344019-91344041 TCCTCTTTCCACTGGCAATGAGG - Intergenic
1132251471 15:100338793-100338815 CCCTCTTGACTGTGGTACTGTGG - Intronic
1133456631 16:5947969-5947991 CCCTTTTGACCGTGGCGCTGAGG + Intergenic
1140050034 16:71472437-71472459 GCTTCCTGACAGTGGCACTGGGG + Intronic
1140102304 16:71928229-71928251 CCCTCTGTACAGGGGGATTGTGG + Exonic
1140209052 16:72956749-72956771 CCCTCACAACAGTGCCACTGGGG + Intronic
1140326759 16:74012013-74012035 CCCTCTCTCCACTGGCTCTGTGG - Intergenic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1141137392 16:81475018-81475040 CCCTCTTCACCGTGGCCTTGTGG + Intronic
1203142771 16_KI270728v1_random:1779408-1779430 CCCTTTTTACTGTAGCACTTTGG + Intergenic
1144863869 17:18322713-18322735 CCCCCTTTACAGAGGCACCCTGG + Exonic
1146065472 17:29631593-29631615 CCCTCTCTCCAGTGGCAGTGAGG - Exonic
1146187432 17:30733013-30733035 CCTTATTTACAGTTTCACTGTGG + Intergenic
1146332488 17:31938410-31938432 CCTTATTTACAGTTTCACTGTGG + Intronic
1151660931 17:75517502-75517524 CCCTCACTACAGTGCCACAGAGG - Intronic
1153855833 18:9145629-9145651 CCCTCTTGCCACTGGCACTGAGG - Intronic
1155564376 18:27117360-27117382 CCCTCATTACAGTGGAACACTGG + Intronic
1156233765 18:35181371-35181393 CCCTCATTACAGTGCCAATTAGG + Intergenic
1159409447 18:68052701-68052723 CCCTCCTTATAGTGGCTGTGTGG - Intergenic
1159992006 18:74919877-74919899 CCCTGATTTCAGTGGCACCGTGG + Intronic
1161409952 19:4111614-4111636 GCCTTTTTAAAGTGGCACCGGGG - Intronic
1165682997 19:37793288-37793310 CCCTCTGTACAGGGGGATTGTGG + Intronic
1166593757 19:44026232-44026254 TGATCTTCACAGTGGCACTGTGG + Intronic
926424391 2:12727933-12727955 CCCTCTCTGCTGTGGCATTGGGG + Intronic
927514067 2:23661707-23661729 CCCTCTTCCCAGTGGGCCTGGGG - Intronic
927848324 2:26483527-26483549 CCTTCTTTACATTGGCCATGAGG + Exonic
928098870 2:28423280-28423302 ACCTCTCTAGAGTGGGACTGCGG - Intergenic
928283653 2:29970475-29970497 CCCTCCTTAGAGTTGCTCTGGGG + Intergenic
930023297 2:47014372-47014394 CTCTCTTTACAGTGCCACCTAGG - Intronic
933343203 2:81048767-81048789 GCCACTTTCCAGTGCCACTGTGG - Intergenic
934146801 2:89102792-89102814 CCCTGTTTATAGTGGCATTAAGG - Intergenic
934222462 2:90097800-90097822 CCCTGTTTATAGTGGCATTAAGG + Intergenic
940906960 2:159178513-159178535 ATCTCTTTAGAGTGACACTGTGG + Intronic
943875038 2:193056255-193056277 CCCTCTTTAAAATGTCCCTGTGG - Intergenic
946135451 2:217643044-217643066 CCCTCTTTCCATTGACAATGAGG - Intronic
947267824 2:228302248-228302270 CTCTCAGTTCAGTGGCACTGAGG - Intergenic
947851435 2:233291686-233291708 CCCTATTCACTGTGGCTCTGTGG - Intronic
949053304 2:241909385-241909407 CCCTTTTTCCAGTAACACTGAGG - Intergenic
1169976771 20:11338125-11338147 CCCCCTTCATAATGGCACTGGGG - Intergenic
1170077113 20:12432062-12432084 CCTTCTTTCCATTGGTACTGGGG + Intergenic
1170095835 20:12645214-12645236 TATTCTTAACAGTGGCACTGGGG - Intergenic
1172442834 20:34977990-34978012 CCATCATGGCAGTGGCACTGGGG - Exonic
1172829774 20:37823714-37823736 CCTTCTTTGCATTGGGACTGTGG + Intronic
1173726378 20:45301137-45301159 CCCTCTCTGCAGTGGCACCGTGG + Exonic
1173801806 20:45898823-45898845 CCGTCTTCTCTGTGGCACTGGGG + Exonic
1174985673 20:55448853-55448875 CCATCTCTATAGTGGCACTTTGG + Intergenic
1175949000 20:62572515-62572537 TCCTCTGGACAGTGGCACTGGGG - Intergenic
1176261801 20:64185752-64185774 TCCTCCTTGCACTGGCACTGTGG - Intronic
1177214516 21:18110928-18110950 CCCTATTTACAGAGTAACTGAGG - Intronic
1178589104 21:33894287-33894309 CCCTCTTTACCCTGGCCCTGGGG + Exonic
1178824446 21:36004228-36004250 TTCTCTTGACAATGGCACTGAGG + Intronic
1179628481 21:42662034-42662056 CCCACTTCACAGAGACACTGAGG - Intronic
1181913138 22:26256540-26256562 GCCTCTTTGGGGTGGCACTGAGG - Intronic
1182429652 22:30292167-30292189 TTTTCTTTACAGTGGCACTCAGG - Exonic
1183734670 22:39637155-39637177 CCCTCTGTACTGTCTCACTGGGG + Intronic
1184629967 22:45769440-45769462 CCCCCTATACTGTGGCATTGGGG - Intronic
1185067436 22:48639234-48639256 CCACCTTCCCAGTGGCACTGTGG + Intronic
1185207057 22:49545933-49545955 CCCTCTTTACGGTCTCCCTGAGG + Intronic
949415941 3:3814255-3814277 GCCTCTTTACAGGGGAACTATGG - Intronic
950624488 3:14234785-14234807 CCCTCTTTGCAGAGTCTCTGGGG + Intergenic
953247017 3:41202471-41202493 CCCTCTTTTTATTGGAACTGTGG + Intronic
954792162 3:53141527-53141549 GCCTCTACAGAGTGGCACTGTGG + Intergenic
954878224 3:53817258-53817280 CCCTCTCAACAGGGACACTGGGG + Exonic
955929255 3:64039397-64039419 AACCCTTCACAGTGGCACTGTGG + Intergenic
956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG + Intronic
960673990 3:120177337-120177359 CCTTCTTTACACAGGCACTCAGG - Intronic
961364585 3:126391104-126391126 CCTTCTGAACTGTGGCACTGGGG + Intergenic
961987475 3:131153176-131153198 TCTTATTTTCAGTGGCACTGGGG - Intronic
962891470 3:139676681-139676703 CCCACTTTACCCTGGCTCTGAGG - Intronic
964535766 3:157719213-157719235 TCCTCTTTTTAGTGTCACTGTGG + Intergenic
965802745 3:172511443-172511465 CCCTCTTTACATTGGCAGCTAGG - Intronic
967188414 3:186965017-186965039 CCCTCTCTACAGGGGCAGGGAGG - Intronic
967400853 3:189058987-189059009 CCCTCTTAGCACTAGCACTGAGG + Intronic
969525243 4:7700948-7700970 CCCACTTTCCAGAGACACTGAGG - Intronic
972302249 4:37795798-37795820 CGCTCTTCCCAGTTGCACTGGGG + Intergenic
975668953 4:76760965-76760987 CCTGCTTTACAGTTGCAGTGTGG + Intronic
983630828 4:169847645-169847667 CCATCTTGACAGTGGCCATGAGG - Intergenic
983849886 4:172568182-172568204 CCCTCTTCAAATTGCCACTGAGG - Intronic
988349406 5:30082826-30082848 CTCTGTTTACAGTGGCAAGGGGG - Intergenic
992423170 5:76627105-76627127 CCCTCTGTAGAGGGCCACTGTGG + Intronic
993752348 5:91686451-91686473 CCTGCTTGACAGAGGCACTGAGG + Intergenic
998013878 5:138717012-138717034 CCCTGTTTACAATAGCGCTGAGG - Intronic
998102838 5:139448640-139448662 TCCTCTTTCCTGTGGCTCTGAGG + Exonic
999271487 5:150298681-150298703 CCCACCTCACAGTGGTACTGGGG - Intronic
1001179134 5:169502312-169502334 CACTCTTTGCAGTCACACTGGGG - Intergenic
1001544849 5:172564706-172564728 CCCACTTTACAGGGCCATTGAGG - Intergenic
1002432518 5:179211739-179211761 CCCTGTGCACTGTGGCACTGTGG - Intronic
1007776877 6:44228854-44228876 CTCTCTTCACAGCGGCCCTGAGG + Intronic
1008133127 6:47740555-47740577 CCCTCTTTACACTGATGCTGGGG + Intergenic
1010390677 6:75333160-75333182 CCCTTTTTACAATGGCAGTTGGG + Intronic
1012405061 6:98886683-98886705 CCTGCTCTGCAGTGGCACTGCGG + Intronic
1013267976 6:108518908-108518930 ACCTCTTTACAGTGTCCCTGGGG + Intronic
1014686912 6:124513093-124513115 GACTCTTTACTGTGGTACTGAGG + Intronic
1016045306 6:139474655-139474677 CCCCCTTTAAAGAGGCAGTGTGG + Intergenic
1020747645 7:12097995-12098017 CTCTCTCTGCAGTGGCACAGTGG - Intergenic
1021483801 7:21146077-21146099 CCCTTCTTAGAGTGCCACTGAGG - Intergenic
1022743819 7:33149265-33149287 CCTTCTTTCCTCTGGCACTGTGG - Intronic
1029363931 7:100105508-100105530 CCCTCTGTGCAGTGGGACCGAGG + Exonic
1034008221 7:147498436-147498458 ACCTCTGTTCAGTGGAACTGTGG - Intronic
1034785387 7:153921581-153921603 CCCTCTTTACAGTGGCACTGTGG - Intronic
1034934129 7:155187673-155187695 CCCTTCTTTCAGTGGCACTGGGG - Intergenic
1035314836 7:157991294-157991316 CCCTTTTTAAAGTGTCTCTGTGG - Intronic
1036606496 8:10309904-10309926 GCCTCTTTCCAGGTGCACTGTGG + Intronic
1037704646 8:21309071-21309093 CCTACTTTACCGTGGCACAGTGG - Intergenic
1041195560 8:55398241-55398263 CCCTCTCTAAAGTTGCTCTGGGG - Intronic
1042436972 8:68777197-68777219 CCCACTTAACAGTGGATCTGTGG + Intronic
1043584486 8:81752321-81752343 CCCTCTTGACTGTGGCACCTTGG - Intronic
1044701712 8:94971264-94971286 CCATCTTTACTCTAGCACTGGGG - Intronic
1045283525 8:100770688-100770710 CAATCTTTACAATGGCCCTGTGG + Intergenic
1046044728 8:108950330-108950352 CTCTCTTTACAGTGTTACTTAGG - Intergenic
1048340015 8:133531463-133531485 CCCACTTTACAGAGGAAGTGAGG + Intronic
1049738165 8:144221114-144221136 CCCTCTTCACAGCAGCAATGTGG + Intronic
1051523903 9:18020982-18021004 CCATCCTTTGAGTGGCACTGGGG - Intergenic
1056595722 9:88006588-88006610 CCCTCTTTGCAGTGTGGCTGTGG - Intergenic
1058530666 9:105902140-105902162 CCCTGCTTGAAGTGGCACTGAGG + Intergenic
1060885898 9:127151917-127151939 TTCTCTTTTCATTGGCACTGAGG + Intronic
1187418488 X:19114186-19114208 ACAGCTTCACAGTGGCACTGGGG + Intronic
1187932551 X:24306638-24306660 CCCTCTTTACTGCCTCACTGAGG - Intergenic
1192191506 X:68994127-68994149 CCCTCTTTGCTGTTACACTGAGG + Intergenic
1194980322 X:100433735-100433757 CCCACCTTACAGTCTCACTGGGG + Intergenic
1196492647 X:116286565-116286587 TCCTCTTTCCAGAAGCACTGGGG - Intergenic
1198017627 X:132628170-132628192 CCATCTTTTCAGTGGCGCTTTGG + Exonic
1198399614 X:136256405-136256427 CCCTCCTTCCTGTGGCACAGAGG + Intronic