ID: 1034785727

View in Genome Browser
Species Human (GRCh38)
Location 7:153924406-153924428
Sequence CCTCCTCAAAACCCTCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034785727_1034785729 -3 Left 1034785727 7:153924406-153924428 CCTCATTGAGGGTTTTGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1034785729 7:153924426-153924448 AGGTTTAAATGAATTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034785727 Original CRISPR CCTCCTCAAAACCCTCAATG AGG (reversed) Intronic
900157605 1:1209479-1209501 CCTCAGCAAAACCTTCCATGAGG + Intergenic
901006981 1:6176721-6176743 CCTCATAATAACCCTCTATGAGG + Intronic
901228475 1:7628836-7628858 CCTCCTCACCAGCCTCAAAGAGG - Intronic
903069757 1:20721371-20721393 CCTCCCCAAAACCCTCTTTCTGG + Intronic
903808748 1:26022857-26022879 CCTCCTCAAGCCCCTCATGGTGG + Exonic
905665047 1:39758575-39758597 CAGCCTCATAACCCTGAATGTGG - Exonic
906757647 1:48334262-48334284 CCTCCTCAACTCATTCAATGAGG + Intronic
906985665 1:50680758-50680780 TCTAGTCAAAACACTCAATGTGG + Intronic
907208406 1:52795645-52795667 CTTCCTCAAAAGTTTCAATGAGG + Intronic
907757426 1:57324614-57324636 ACTATCCAAAACCCTCAATGTGG + Intronic
907816051 1:57919168-57919190 CCTCCTCACAACCCAAATTGTGG - Intronic
909687053 1:78361694-78361716 CCTCCTAAGAGCACTCAATGGGG + Intronic
909720922 1:78768120-78768142 CCTCCTCAAAACCACCACTGGGG + Intergenic
912418759 1:109529573-109529595 CCCTCCAAAAACCCTCAATGTGG + Intergenic
912861435 1:113217269-113217291 ACTACTAAAAACCCTCAAGGAGG + Intergenic
913276591 1:117144321-117144343 CCTCCTCCACTCCCTCATTGAGG + Exonic
916097223 1:161362154-161362176 CCTTCTCAAAACCCACAGTATGG - Intronic
917921108 1:179750651-179750673 CAACCTCAAAATCCTTAATGTGG - Intronic
918391224 1:184064817-184064839 CCTCCTCAAATCCCCAAATTAGG - Intronic
921063116 1:211602855-211602877 CCTACTCAAAAACCATAATGTGG - Intergenic
1071052997 10:81473804-81473826 CCTTCTCATCGCCCTCAATGTGG - Intergenic
1071955333 10:90751475-90751497 CCTGCTCTCAAGCCTCAATGTGG + Intronic
1074292330 10:112147550-112147572 GCTCCTTAAAATCCTCACTGTGG + Intergenic
1074901018 10:117816635-117816657 CCTCCTCCTAACCCTCAGTCTGG + Intergenic
1077491081 11:2861378-2861400 CCTCCTCATAACCCTCAGGCTGG + Intergenic
1078797143 11:14603453-14603475 CCTCCTCAAAATGGGCAATGAGG + Intronic
1080407526 11:31992832-31992854 CCTCCTCCTATCCCTGAATGGGG - Intronic
1081130911 11:39378623-39378645 CATCTTCAAAACCCTAAATAAGG - Intergenic
1081149135 11:39604919-39604941 CATGCTAAAAACTCTCAATGAGG + Intergenic
1082100883 11:48172016-48172038 CCTCCTCTAAACCAACACTGTGG - Intergenic
1084188613 11:67488772-67488794 CCACTTCAAAACCCTCAGGGAGG - Intronic
1086847219 11:91765723-91765745 ACTCCTCAAATCCTTCCATGTGG - Intergenic
1088427178 11:109716556-109716578 CCTCCTTTAAACCTTCAATCAGG - Intergenic
1089352596 11:117829846-117829868 CCTGCTCAAAATCCTCAGAGAGG + Intronic
1090259207 11:125306527-125306549 CCACCATAAAACCCTTAATGTGG + Intronic
1090758907 11:129818155-129818177 TCTCCCCAAAACCTTCACTGAGG + Intronic
1091317377 11:134624061-134624083 CCTCCATAAAACCCAGAATGAGG + Intergenic
1091726269 12:2848644-2848666 CCTCCTCCAAACCCTGCATGGGG + Intronic
1092041479 12:5389042-5389064 CCACCTCAAAAGCCACAAAGAGG + Intergenic
1092698329 12:11199341-11199363 CCTGCCCAAAACCCTCCAAGTGG + Intergenic
1092853069 12:12648168-12648190 CCTCCTCAGTACCCTACATGAGG + Intergenic
1094044398 12:26151439-26151461 CCCCCTTAAAATCCTCAATTGGG + Intronic
1095386257 12:41654016-41654038 CCTCCTTAAAAGCCTCACTCAGG + Intergenic
1096979266 12:55719073-55719095 CCTCCTCCAACCCCCCAGTGTGG + Exonic
1099924998 12:89006514-89006536 ATTCCTCAAAATACTCAATGAGG - Intergenic
1100791981 12:98140592-98140614 CCTCCTAAAAAACCTTAAAGAGG + Intergenic
1102151883 12:110694360-110694382 CTTCCTCAAAATGCTCCATGTGG - Intronic
1102993862 12:117333512-117333534 CCTCCTGGATCCCCTCAATGGGG + Intronic
1103545965 12:121701627-121701649 CATCCTCAATACCCACAATAGGG - Intergenic
1103953756 12:124565907-124565929 CCTCCTCAGCACCCCCAAAGAGG + Intronic
1104479723 12:129096942-129096964 TGTCCTCAAAACCGTCCATGTGG + Intronic
1107263204 13:38519750-38519772 CCACTTCAAAACCGTTAATGAGG + Intergenic
1109831657 13:67799054-67799076 CCACCATAAAAACCTCAATGCGG + Intergenic
1110439065 13:75507562-75507584 CCTTCTCATCACCCACAATGTGG + Intergenic
1110477134 13:75929313-75929335 CCTCTTCACCACCCACAATGTGG + Intergenic
1110905181 13:80878608-80878630 CCCATTCCAAACCCTCAATGAGG - Intergenic
1111141596 13:84126992-84127014 CCTTCTCATCACCCACAATGTGG + Intergenic
1117098486 14:52321497-52321519 TCTCCTCCAAACCCATAATGTGG + Intronic
1117987155 14:61397870-61397892 CCTACTCAAAACCTGCAGTGAGG + Intronic
1118927830 14:70209690-70209712 ACTCCTCAAAATCATCCATGAGG + Intergenic
1118993055 14:70813019-70813041 CCTCCTCAAAAACTTCATAGTGG - Intergenic
1119131409 14:72176274-72176296 CCTCCTCCCACCCCTCATTGGGG + Intronic
1120049078 14:79844240-79844262 ACCCCTCAAAACTCTCCATGAGG + Intronic
1120941887 14:89956925-89956947 CCTTCTTAAAGCCCTCAGTGGGG + Intronic
1121696802 14:95920233-95920255 CCTCCTGAAAACCATTATTGTGG - Intergenic
1126800572 15:52293845-52293867 CCCACTCAAAACCCACACTGGGG + Intronic
1126844683 15:52747772-52747794 ACTTTTCAAAGCCCTCAATGGGG - Intergenic
1134005958 16:10818900-10818922 CCTTCTCCCAACCCTGAATGCGG - Intergenic
1134518371 16:14905353-14905375 ACTCCTCAAAATGCTCCATGTGG + Intronic
1134555560 16:15160868-15160890 ACTCCTCAAAATGCTCCATGTGG - Intergenic
1134706042 16:16304006-16304028 ACTCCTCAAAATGCTCCATGTGG + Intergenic
1134961498 16:18408104-18408126 ACTCCTCAAAATGCTCCATGTGG - Intergenic
1134965798 16:18490707-18490729 ACTCCTCAAAATGCTCCATGTGG - Intronic
1135609747 16:23855943-23855965 CCCCCTCAAAACCATCTATAGGG - Intronic
1135618120 16:23929481-23929503 ACTCTTCACAACCCTCTATGAGG - Intronic
1136520725 16:30794119-30794141 CTTCCTGAAAAATCTCAATGTGG + Intergenic
1137492890 16:48947939-48947961 CCTCCTAAGAACCCTGAATAAGG + Intergenic
1141724499 16:85778247-85778269 CCTCCTAAAACCCTTCAAGGTGG - Intronic
1141900513 16:86987593-86987615 CCTCCTCAAACCTCAGAATGGGG + Intergenic
1143933152 17:10452306-10452328 CCTCCTCCAGCTCCTCAATGCGG + Exonic
1143937446 17:10501475-10501497 CCTCCTCCAGCTCCTCAATGCGG + Exonic
1143939858 17:10529055-10529077 CCTCCTCCAGCTCCTCAATGCGG + Exonic
1144390037 17:14784809-14784831 CCTTCTCATCACCCACAATGTGG - Intergenic
1146319450 17:31835188-31835210 ACTCCTCAAAACTGTCAAGGTGG + Intergenic
1148554963 17:48572985-48573007 CCGCCTCCAAACCCTAAGTGAGG + Intronic
1152916117 17:83036971-83036993 CCTCCTCAGCACCCTCATTTTGG - Intronic
1154096181 18:11417157-11417179 CCTCCTCCAAAGCCCCACTGTGG + Intergenic
1155544964 18:26905194-26905216 CCTCCCCACAAAACTCAATGAGG - Intergenic
1157565088 18:48674485-48674507 CCTCCTAAAACCACTCATTGTGG - Intronic
1157612958 18:48970003-48970025 CTCCTCCAAAACCCTCAATGGGG + Intergenic
1159402276 18:67954011-67954033 CCTCCTCAAGGCCCTGATTGTGG - Intergenic
1161753507 19:6114682-6114704 CCTGCTTAAAACCCTCCATGGGG - Intronic
1167430516 19:49451597-49451619 CGTCCTCGAGACCCTCAACGTGG + Exonic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925137361 2:1530759-1530781 CCTCCTCAAATCCCCCCATGGGG + Intronic
926670730 2:15574732-15574754 CCTCCTTAAAGCCCTCACAGAGG + Intergenic
927236409 2:20879666-20879688 CCTCCTCATCATCCACAATGTGG + Intergenic
929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG + Intronic
937777751 2:125800227-125800249 CCTTCTCAACATACTCAATGTGG + Intergenic
939509244 2:143086423-143086445 ACTCCTCAAAGCCATCCATGAGG - Intergenic
939966082 2:148611695-148611717 AATCCTCACAACCCTCCATGAGG - Intergenic
942711433 2:178840493-178840515 CTTCTTCCAAACCCTCAATTAGG - Intronic
942867976 2:180699155-180699177 CCTTCTTATCACCCTCAATGTGG + Intergenic
943850951 2:192722097-192722119 TTTCCTAAAAAGCCTCAATGTGG - Intergenic
946091499 2:217228828-217228850 CCTCCTCAAAGTCATCCATGAGG + Intergenic
948414673 2:237794259-237794281 CCTCCCCAAAAATCTCAAAGGGG - Intronic
948907879 2:240988462-240988484 CCCCATCAACATCCTCAATGGGG - Intronic
1169969072 20:11249072-11249094 CCTCTGCAGAGCCCTCAATGAGG - Intergenic
1170174237 20:13450715-13450737 ACTCCTCAAAGTCATCAATGAGG + Intronic
1171433316 20:25100846-25100868 CCTCCTCCACTCCCTCATTGTGG - Intergenic
1172973456 20:38889740-38889762 CCTGCTCAGAACCCTCAGGGAGG + Intronic
1173799818 20:45887881-45887903 CATCCTCAAAACTCCTAATGAGG - Intergenic
1173848278 20:46201581-46201603 CCTCCTCTAACACCACAATGTGG - Intronic
1175550296 20:59813207-59813229 CTTCCCCAAGACCCTCACTGAGG + Intronic
1175582408 20:60110915-60110937 CCTCCTCAGCACCCTCACTGAGG - Intergenic
1178022290 21:28422884-28422906 CCTGCTTAAAACCTTCAGTGTGG - Intergenic
1178720640 21:35006299-35006321 CCTCCATAAAAGCCTCAAGGAGG + Intronic
1178808375 21:35858671-35858693 CCTCCTCAAATCAGTCAGTGAGG + Intronic
1179517800 21:41921003-41921025 CCTCTTCAATTCCCTCAAAGGGG + Intronic
1181049322 22:20231217-20231239 CAGCCTCCAAACCCTCCATGGGG - Intergenic
1182271468 22:29156591-29156613 CCTCTTCAAAACTCTAAATGAGG + Intronic
1184601343 22:45545329-45545351 CATCCTCACAACCCCCTATGGGG - Intronic
949921002 3:9000380-9000402 CCTCCACAAAGCACTCAGTGGGG + Intronic
950521916 3:13502395-13502417 CCTCCTCAGGACCCCTAATGAGG + Intronic
950610387 3:14123237-14123259 CCTCCTGTAAATCCTCAAAGAGG + Intronic
955524482 3:59806473-59806495 CTACCTCAAAACCTTGAATGTGG + Intronic
958507551 3:94999465-94999487 CCTACTAAAAACCAGCAATGGGG - Intergenic
961253181 3:125523625-125523647 CCCCCTCACAGCCCTCACTGGGG + Intergenic
964237525 3:154550317-154550339 CCTCCTCATTACCTTCTATGTGG - Intergenic
967228824 3:187318539-187318561 CCTCCTTAAAATCCTTCATGGGG + Intergenic
969079650 4:4608409-4608431 CCTCCTAAAAACCCTGACTCAGG - Intergenic
969224060 4:5782907-5782929 TCTCCTCAAAACCATCATTAGGG - Intronic
971383991 4:26126368-26126390 CCACCTCAAAATACACAATGGGG - Intergenic
979648897 4:123107178-123107200 CCTTCTCATCACCCTCAATGTGG + Intronic
980582777 4:134774680-134774702 CCTTCTCATTGCCCTCAATGTGG - Intergenic
980870989 4:138610486-138610508 CCACCCCAAAACCCTCACTTCGG + Intergenic
982802528 4:159722525-159722547 CCTTCTCATCACCCGCAATGTGG + Intergenic
987978194 5:25043631-25043653 ACTCCTCAAAATCATCCATGAGG - Intergenic
991478889 5:67055280-67055302 CCTCCTCAAAACCCTTGAAAGGG - Intronic
994507946 5:100665430-100665452 CCTACACAAAATCCTCACTGGGG - Intergenic
996177853 5:120381044-120381066 ACTCCTCAAAATCATCCATGAGG + Intergenic
997474963 5:134137546-134137568 CCTCCTCAATCCCCTAAATCAGG - Intronic
999950314 5:156642345-156642367 CCTGCTTAAAACCTTCACTGTGG + Intronic
1003356499 6:5378191-5378213 GCTCCTAAAATCCCTCCATGAGG - Intronic
1005174034 6:23023753-23023775 CCTCATCAAACCTCTAAATGTGG - Intergenic
1008822869 6:55654876-55654898 CCTCCTCATAACCTTAAATGAGG + Intergenic
1010846961 6:80720707-80720729 CCTCCTCATCACCTGCAATGTGG - Intergenic
1011827830 6:91331542-91331564 CATCCTCAAAATCCCCAATTTGG + Intergenic
1012982046 6:105841099-105841121 CATCCTCAACAGCCTGAATGAGG - Intergenic
1013347263 6:109273432-109273454 ACTCCTCAAAGTCCTCCATGAGG + Intergenic
1015744422 6:136495026-136495048 CCTGCTCAAAACACAAAATGAGG + Intronic
1016343958 6:143091223-143091245 ACTCCTCAAAATCATCCATGAGG + Intronic
1018065514 6:160122745-160122767 CCACCTCAACACCATCATTGAGG - Intronic
1021824427 7:24534123-24534145 CCTCCTCAACTCATTCAATGAGG - Intergenic
1027911886 7:84261390-84261412 CCTTCTCATCACCCACAATGTGG - Intronic
1029113370 7:98224450-98224472 CCTCCTCAAGCCCCTCAGTCTGG + Intronic
1032922738 7:136567475-136567497 CATCCTCAAAAACCTCTGTGAGG + Intergenic
1033134103 7:138770346-138770368 GAGCCTCAAAATCCTCAATGGGG + Intronic
1033850017 7:145483485-145483507 CCTCCTCTTAACCCACAACGTGG - Intergenic
1034058975 7:148068281-148068303 CCTCCCCAAGAACCTCTATGAGG + Intronic
1034785727 7:153924406-153924428 CCTCCTCAAAACCCTCAATGAGG - Intronic
1037820886 8:22134011-22134033 CCTCCTTAACCCCCTCAAGGTGG + Intergenic
1039117317 8:34106212-34106234 GGTACTCAAAACCCTCCATGAGG - Intergenic
1041956446 8:63561734-63561756 CCTTCTCATCACCCACAATGTGG - Intergenic
1043180516 8:77082424-77082446 CCTTCTCATCACCCGCAATGTGG + Intergenic
1043558834 8:81466783-81466805 CCTCTCCAAAACCCACAGTGTGG - Intergenic
1044778076 8:95714362-95714384 CTTCCCCAAAACCCTCAAGTAGG - Intergenic
1045889491 8:107137727-107137749 ACTCCTCAAAATCATCCATGAGG + Intergenic
1047212101 8:122848517-122848539 ACTTCTCAGAACCCTTAATGAGG - Intronic
1048412366 8:134188564-134188586 CCTCCTTAAGACCATCCATGTGG - Intergenic
1049850826 8:144829257-144829279 CCCCCTCAAGAGCCTCAATTAGG - Intronic
1049994046 9:1017843-1017865 ACCCATCAGAACCCTCAATGGGG - Intergenic
1055682639 9:78733205-78733227 CCTACCCAAAACACTCAATCTGG - Intergenic
1057280880 9:93710724-93710746 CCTCCTCAGGACTCACAATGTGG + Intergenic
1061461598 9:130743935-130743957 CCGCTTCCAATCCCTCAATGTGG - Intronic
1186288884 X:8074836-8074858 CCTCCTCAGCCTCCTCAATGAGG + Intergenic
1188207844 X:27381335-27381357 CCTTCTTGTAACCCTCAATGTGG - Intergenic
1188621242 X:32226729-32226751 CCTCCTGAAAAAGCTGAATGAGG - Intronic
1188906998 X:35801530-35801552 CCTCCTCAAGACCCTGGAGGAGG - Intronic
1190797502 X:53759037-53759059 CCACCTCAAGATCTTCAATGTGG + Intergenic
1191645443 X:63475880-63475902 ACTCCTCAAAATCATCTATGAGG + Intergenic
1192189856 X:68984119-68984141 CCTCCTCAGTAACCTGAATGGGG + Intergenic
1194588868 X:95771904-95771926 ACTCCTCAAAATCGTCTATGGGG - Intergenic