ID: 1034787992

View in Genome Browser
Species Human (GRCh38)
Location 7:153942795-153942817
Sequence CAGGGAAGAGGCAGAATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 2, 2: 4, 3: 44, 4: 454}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034787992_1034788000 25 Left 1034787992 7:153942795-153942817 CCTACCATTCTGCCTCTTCCCTG 0: 1
1: 2
2: 4
3: 44
4: 454
Right 1034788000 7:153942843-153942865 CGCCTGCTTATTTAAACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034787992 Original CRISPR CAGGGAAGAGGCAGAATGGT AGG (reversed) Intronic
902051705 1:13568223-13568245 GGGGAAAGAGGCAGAAAGGTGGG + Intergenic
903177063 1:21587556-21587578 CAGTGAAGGGGCAGAGTGCTGGG + Intergenic
904142433 1:28364239-28364261 CAGGGAAGAGGACTAATGGATGG - Intergenic
904263699 1:29305671-29305693 AAGGGAAGAGGCAGACAGCTAGG + Intronic
904932388 1:34099640-34099662 CAGGGAACAGGTAGAATAGTCGG + Intronic
905487120 1:38309237-38309259 AAGGCAAGAGGCTGAATGTTTGG + Intergenic
906693818 1:47810859-47810881 CAGGGAAGGAGGAGAAGGGTGGG + Intronic
906720705 1:48002129-48002151 CAGGGAATAGGAAGAAGGGAAGG + Intergenic
906799695 1:48725615-48725637 CAGGGAAGAGGTAAAAGGGCAGG + Intronic
906856257 1:49308424-49308446 CTGGGAAGAGGCAAAATGCAAGG + Intronic
907797687 1:57733810-57733832 GAGGGAAGAGTCAGCATGGGGGG + Intronic
908279079 1:62510985-62511007 TAAGCAAGAGGAAGAATGGTAGG - Intronic
908510630 1:64847678-64847700 GAGGGAAGAAGCAGAAGGCTGGG + Intronic
909169149 1:72272234-72272256 AAGGGAAGAGGAAGAAAGGGAGG - Intronic
909471828 1:76037758-76037780 CAGGGATGAGGAAAAATGGGTGG + Intergenic
909498273 1:76304338-76304360 GAGGGAAGAGGGAGAGTGGAGGG - Intronic
909662027 1:78094655-78094677 TAAGGAAGACGAAGAATGGTTGG + Intronic
909911520 1:81263553-81263575 CTGGGAAGAGGCTGAATATTGGG - Intergenic
910350849 1:86296060-86296082 CAGGAGAAATGCAGAATGGTGGG + Intergenic
910653569 1:89596947-89596969 CTGGAAACAGACAGAATGGTGGG + Exonic
910685483 1:89911895-89911917 CAGAGGAGAGGAAGAAGGGTGGG - Intronic
912727350 1:112069833-112069855 TAGGGCAGAGGGAGAGTGGTGGG - Intergenic
912858126 1:113189936-113189958 AAAGGAAAAGGCAGAATGGTAGG - Intergenic
913156133 1:116100459-116100481 CAGGGAGGAGGCAGGAAGGATGG - Intergenic
913697492 1:121341661-121341683 TAGGCAAGAGGAAGAGTGGTGGG + Intronic
914140067 1:144938391-144938413 TAGGCAAGAGGAAGAGTGGTGGG - Intronic
914453384 1:147813023-147813045 AAGGGATGAGTCAGAATAGTGGG + Intergenic
915286427 1:154856229-154856251 CAGGGAGGAGGCAGCAGGGAGGG + Intronic
915548661 1:156618886-156618908 GAGGGAAGAGGTAGAATATTAGG + Intergenic
916269628 1:162926720-162926742 CTGGGAAGAGATAGAATTGTTGG + Intergenic
916304468 1:163313720-163313742 TAGGGAAGTGGTAGAATAGTAGG + Intronic
916608968 1:166371466-166371488 GGGGGAAGAGGCAGATTGGGAGG - Intergenic
917081407 1:171260153-171260175 CACGTAAGAGGAAGAATGGGAGG + Intronic
917334697 1:173915262-173915284 CAGTGAAGAGTCAGGGTGGTAGG + Intronic
917487742 1:175470001-175470023 CAGGGAAGAGTCAGGATGACAGG + Intronic
917828591 1:178851865-178851887 CAGGGATGGGGGAGAATTGTTGG + Intronic
917928417 1:179807521-179807543 CAGGGCAGCGGCAGGATGCTGGG - Intronic
918221978 1:182443755-182443777 CAGGGGAGCAGCAGAATGGGAGG - Intergenic
920244729 1:204579024-204579046 CAGGGGAGAGGAAGAAGGGTTGG + Intergenic
920484881 1:206360310-206360332 TAGGCAAGAGGAAGAGTGGTGGG + Intronic
920632277 1:207663927-207663949 CAGGGAAGAGACAGAAATATAGG - Intronic
922691242 1:227693245-227693267 AAGGGATGAGGTAGAAGGGTGGG + Intergenic
923049497 1:230380912-230380934 AAGGGAAGAGTCAGAGTGCTAGG + Intronic
923269976 1:232346775-232346797 CAGGGAAGAGCCTGCATAGTTGG + Intergenic
923518897 1:234720909-234720931 CAGGGAAGAGCCAGGAAGGGAGG + Intergenic
924328773 1:242921788-242921810 AAAGCAAGAGGCAGAATGGAAGG + Intergenic
924580658 1:245321158-245321180 CAGGGATGAGGGTGGATGGTGGG - Intronic
1062917575 10:1253627-1253649 CAGGGAGAAGGCAGCATGGCAGG + Intronic
1063327865 10:5123095-5123117 CACAGAAGAGGCAGCATGGGTGG - Intronic
1063394479 10:5674166-5674188 CAGGGAAGAGAAAGAAGGGGAGG + Intergenic
1064223806 10:13464540-13464562 CGGGGAAGAGAGAGAATGGAAGG + Intronic
1064306121 10:14168099-14168121 GAGAGACGAGGCAGAATGGGTGG + Intronic
1064669256 10:17692489-17692511 CTGGTAACTGGCAGAATGGTTGG + Intronic
1064739318 10:18416127-18416149 CAGGGAGGAGGAAGAGAGGTGGG - Intronic
1065034721 10:21625996-21626018 CAGGACAGAGGAAGTATGGTGGG - Intronic
1066005922 10:31146181-31146203 CATTGAAGAGGCAGCATGGCAGG - Intergenic
1066373838 10:34839643-34839665 CAGGAAAGAGGATGAATGGAAGG - Intergenic
1066656430 10:37702657-37702679 CAGGGATGAGCCAGAAGGGGAGG - Intergenic
1067047199 10:42991408-42991430 CAGGGCAGATGCAGCAGGGTGGG - Intergenic
1067787079 10:49258253-49258275 GAGGGAAGAAGAATAATGGTTGG - Intergenic
1068388382 10:56360718-56360740 CAAGGAAGGGGAAGAATGCTGGG + Intronic
1069757059 10:70779804-70779826 CAGGGAAGAGGCTGAGAGGCAGG + Intronic
1070572443 10:77650303-77650325 CAGGGGTGAGGGAGAATGGCAGG + Intergenic
1070675151 10:78407107-78407129 CAGAGAAGCGGCAGAAAGGAGGG - Intergenic
1070789179 10:79179647-79179669 CAGGGAAGAAGCAGACTGCAGGG - Intronic
1071309991 10:84334098-84334120 CAGGGAGGAGGCAGAGGGGTAGG + Intronic
1071368112 10:84922151-84922173 CAAGGAAGAGCCAGAGAGGTGGG + Intergenic
1071495481 10:86164873-86164895 CATGGAGGAGGCAGCATGGGTGG + Intronic
1072231531 10:93417858-93417880 GAGAGGAGAGGCAGAATGTTTGG - Intronic
1072559334 10:96556278-96556300 CAGGTAAGAGGCAGTATTGTTGG - Intronic
1072737526 10:97889144-97889166 AAGGGGGGAGGGAGAATGGTTGG + Intronic
1073705985 10:105984834-105984856 CTGGGAATAGGCAGAATCTTGGG + Intergenic
1074835273 10:117286236-117286258 CAGGGAAGGGACAGTATGGCTGG - Intronic
1075045503 10:119143208-119143230 CAAGGAACAGGCAGGATGCTGGG - Intronic
1075617494 10:123902272-123902294 GTGGGAAGAGTCAGAATGGGAGG - Intronic
1075810030 10:125218601-125218623 CAGGAAAGAGGCACAAAGGCCGG - Intergenic
1076068532 10:127467927-127467949 CAGGGAAGACACATAATGATGGG - Intergenic
1076116333 10:127904398-127904420 GAGGGAAGGGGCTAAATGGTTGG + Intergenic
1076477440 10:130762444-130762466 CAGGGCAGAGGCAGAAGGAGGGG - Intergenic
1076915413 10:133420987-133421009 GAGGGAAGAGGAAGGAAGGTGGG + Exonic
1077466036 11:2734216-2734238 CAGGCCAGAGGCAGATTGGGAGG + Intronic
1077517703 11:3011866-3011888 CTGAGCCGAGGCAGAATGGTGGG - Intronic
1078452308 11:11449392-11449414 CAGTGAAGAGGGAGAAGGGCTGG - Intronic
1078549825 11:12272338-12272360 CATGGAAGAGGCAGAAGGGGAGG - Intergenic
1079021981 11:16916793-16916815 CAGGGAAGAGCCTTTATGGTGGG - Intronic
1079709099 11:23658707-23658729 CAGGGGAGAGAGAGAATGATAGG - Intergenic
1080212719 11:29805623-29805645 GAGGAAAGAGGAAGAATGGAAGG + Intergenic
1080546082 11:33320127-33320149 CAAGCAAGTGGGAGAATGGTAGG + Intronic
1081602740 11:44506475-44506497 CAGGGAAGAGGCAGGGTGGATGG + Intergenic
1081795040 11:45813034-45813056 GAGGGAAGAGGCAGCAGGGCTGG + Intergenic
1081997863 11:47376651-47376673 CAGGGAGGAGGGAGGAAGGTGGG - Intronic
1083070362 11:59972600-59972622 TAGGGTAGAGGCAGAATTGAAGG + Intergenic
1083490584 11:63012464-63012486 CAGGCAAAAGGAAGGATGGTGGG - Intronic
1084133886 11:67160078-67160100 CAGGGAAGAGGCAGTGAGGCAGG - Intronic
1084219386 11:67667955-67667977 CAGGGAAGAGCTGGGATGGTGGG - Intronic
1084423826 11:69073525-69073547 CAGGGATGGGGCAGAGAGGTGGG + Intronic
1086400663 11:86458850-86458872 TAGGGAAGAGGCAGACAGGCAGG - Intronic
1086423409 11:86660154-86660176 CAGAGAACAGGCAGACTGGGTGG - Intronic
1086852476 11:91826082-91826104 AAAGGTTGAGGCAGAATGGTGGG - Intergenic
1087990816 11:104744026-104744048 CAGAGAAGAGGCAGATTGCAGGG + Intergenic
1088710875 11:112507429-112507451 GAAGGCAGAGGCAGAATGGCAGG - Intergenic
1088986562 11:114914384-114914406 CAGGGAAGAGAAAGACTAGTTGG - Intergenic
1089067951 11:115676310-115676332 CAGGGAAGAGGAAGGTTTGTGGG - Intergenic
1089309319 11:117547446-117547468 CAGGGCAGGAGCAGAAGGGTGGG - Intronic
1089599697 11:119605712-119605734 CAGGGAAGGGGAAGAAGGGATGG - Intergenic
1089681635 11:120121955-120121977 CAGGGAGGAGGCAGGCTGGCCGG + Intronic
1090274028 11:125407171-125407193 CAGGGAAGGGAGAGAAGGGTAGG + Intronic
1090948071 11:131449076-131449098 CAGGGAAGGGGAAGAAGGGAGGG + Intronic
1091196659 11:133737380-133737402 CAGGGAAGAGGTAGAAGGGGTGG + Intergenic
1091820177 12:3470395-3470417 GAGGGAAGAGGTCGGATGGTAGG + Intronic
1091906939 12:4196861-4196883 CAGGGAGGATGCAGATTGGAGGG - Intergenic
1093719223 12:22419062-22419084 CAGGGAAGAGGGAGAAGGGGTGG - Intronic
1093719722 12:22425702-22425724 CAGGGAAGAGGGAGAAGGGGTGG - Intronic
1094625410 12:32118997-32119019 GAGGGAAGAGACAGACTGGCTGG + Intronic
1095212415 12:39509736-39509758 CAGGGGAGATGCAGCCTGGTGGG - Intergenic
1095918932 12:47509450-47509472 GAGGGAAGAGCTAGAATAGTTGG - Intergenic
1095946563 12:47757245-47757267 CAGGGAGGGGAAAGAATGGTGGG - Intronic
1096547024 12:52347139-52347161 CAGGCCAGAGGCAGAGAGGTGGG + Intergenic
1097266810 12:57750769-57750791 AAGGGAATAGGAAGAATGGATGG + Intronic
1101001955 12:100365588-100365610 TAAGGAAGAAGCACAATGGTTGG - Intronic
1101499019 12:105283984-105284006 CAGGTAAGGGGCTGACTGGTAGG + Intronic
1101652981 12:106694457-106694479 CAGGGCAGGGGCAGAAAGCTGGG + Intronic
1101803947 12:108047229-108047251 GATGGATGAGACAGAATGGTTGG + Intergenic
1102660788 12:114526442-114526464 GAGGGAAGAGGCAGAACTGTTGG - Intergenic
1102872698 12:116426472-116426494 CAGGGAAGAGGCAGGCGGGCTGG + Intergenic
1104448112 12:128849019-128849041 GAGGGAGGAGGGGGAATGGTGGG - Intergenic
1104642527 12:130476544-130476566 CAGGGAAGAGGAAGAAGGCCGGG - Intronic
1105290990 13:19053294-19053316 CAGGTCAGAGGAAGAGTGGTCGG - Intergenic
1105390330 13:19971131-19971153 CAGGTAAGGGGAAGAATTGTAGG + Intronic
1107636281 13:42395616-42395638 CATGGAGGAGCCAGAAAGGTGGG - Intergenic
1108254296 13:48595545-48595567 CAGGGAAGAGCCAGACTGAGTGG + Intergenic
1110713775 13:78678337-78678359 CAGGGAGGAAGCAGAAAGGAAGG - Intergenic
1111239147 13:85451888-85451910 GAGGGGAGAGGGAGAAAGGTAGG - Intergenic
1112496767 13:99911433-99911455 TAGGGAAGAGGCAGAATCAGAGG - Intergenic
1112946078 13:104928680-104928702 TAAGGAAGATTCAGAATGGTGGG + Intergenic
1113635297 13:111915139-111915161 CCGGGAAGAGGCAGCAGGGCTGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114130516 14:19786545-19786567 CAGGGAAGAAACATACTGGTAGG + Intronic
1114658665 14:24331188-24331210 CAGGTATGAGGAAGAATGGCTGG - Exonic
1115316416 14:32029482-32029504 CTGGGAAAAGGCAGAATGACTGG + Intergenic
1115457706 14:33623766-33623788 CAGTGAGGAGGCAGGATGGCTGG - Intronic
1118506047 14:66413159-66413181 CATGGAAGAGGCAGAAGGCCTGG + Intergenic
1119323627 14:73745867-73745889 CAGGCAAGAGGCCCTATGGTCGG + Intronic
1119407385 14:74407227-74407249 TAGGGAATGGGCAGAATGGATGG + Exonic
1119462999 14:74826755-74826777 CAGGGAAGAACCAGTCTGGTGGG - Intronic
1119647608 14:76359678-76359700 CAGGGAGGAGGCAGAATCCCAGG + Intronic
1120758342 14:88264941-88264963 CAGTGATGAGGCAGAATGAATGG - Intronic
1121505749 14:94475177-94475199 CAGGGAAGGAGCAGACAGGTAGG - Intronic
1122569349 14:102684018-102684040 CAGGAAAGAGGCAGAGAGGCGGG - Intronic
1202871634 14_GL000225v1_random:170415-170437 GAGGGAGGAGGCAGGAGGGTGGG + Intergenic
1123709767 15:22979255-22979277 CAGGGAAAAGGCAGCATGCGTGG + Intronic
1124248659 15:28093950-28093972 CAGGGAAGAGGCAGGAAGTGAGG - Intronic
1124681779 15:31738218-31738240 GAGGGAGGAGGGAGAATGGCAGG + Intronic
1126315716 15:47367202-47367224 AAGGGAAGAAGCAGAAGCGTAGG - Intronic
1127751698 15:62051731-62051753 AAGGGCACAGGCAGAACGGTAGG + Intronic
1128242427 15:66110036-66110058 CAAGGGAGAGACAGGATGGTGGG + Intronic
1128870576 15:71152549-71152571 TAGGGAAGAGGCGGCTTGGTTGG + Intronic
1129508798 15:76104777-76104799 CAGGAAAGAGGGAGATTGTTGGG + Intronic
1129713017 15:77830734-77830756 CAGAGCTGAGGCAGAATGCTTGG + Intergenic
1129769409 15:78193812-78193834 CAGGGAGGAGGCAGGATGGTGGG + Intronic
1129988407 15:79939593-79939615 CAGAGAGGAGGCAGAATGGCAGG + Intergenic
1130993136 15:88888690-88888712 CAGGGAGGGGGCAGAGTCGTGGG + Intronic
1131529523 15:93179842-93179864 CAGGGAAGAGGGAGAAAGGATGG + Intergenic
1132021249 15:98364355-98364377 CAATGAGGAGGGAGAATGGTAGG + Intergenic
1133232375 16:4372740-4372762 TGGGGGAGAGGCAGAATGGTTGG - Intronic
1135838463 16:25850837-25850859 GAGGGAACAGGGAGTATGGTGGG + Intronic
1136265743 16:29117068-29117090 CTGGGAGGAGAGAGAATGGTGGG + Intergenic
1138113602 16:54343026-54343048 AAGGGGAGAGGGGGAATGGTGGG - Intergenic
1138691321 16:58771473-58771495 CGGTAATGAGGCAGAATGGTAGG - Intergenic
1140317477 16:73913100-73913122 CAGGTAGGAGGCAGAAAGGTAGG - Intergenic
1140577136 16:76183911-76183933 AGGGGAAGAAGCAGAATGTTTGG + Intergenic
1140861852 16:79025093-79025115 CAGTGAAGAGTCAGGAAGGTGGG + Intronic
1140877744 16:79168701-79168723 CAGGGAAGAGGAGGAAAGCTGGG + Intronic
1141000456 16:80302712-80302734 GAGGTGAGAGGCAGAATTGTGGG - Intergenic
1141136111 16:81466791-81466813 CAGGGAGGAGGCAGAATCTTTGG - Intronic
1141334111 16:83138836-83138858 CAGGGGAGAGGCAGAAGGACTGG + Intronic
1141640058 16:85335729-85335751 AAGGGAAGAGGTAGAAGGGAGGG + Intergenic
1142054561 16:87985002-87985024 CTGGGAGGAGAGAGAATGGTGGG + Intronic
1142309642 16:89305055-89305077 CAGGCAAGAGGCAGCAGGGGCGG - Intronic
1143205262 17:5136491-5136513 CAGGGCAAAGGCCGCATGGTAGG + Intronic
1143739557 17:8942343-8942365 CAGAGAAGAGGCTGCAGGGTGGG - Intronic
1144396978 17:14853986-14854008 CAGTGAGGAGGCAAAATGGATGG + Intergenic
1144713043 17:17414971-17414993 CATTTCAGAGGCAGAATGGTGGG + Intergenic
1144777315 17:17791405-17791427 CAGGGAAGAGGCAGAAAGGTGGG - Intronic
1144876312 17:18399184-18399206 CAGGGCAAAGGCCGCATGGTGGG + Intergenic
1145155916 17:20545236-20545258 CAGGGCAAAGGCCGCATGGTGGG - Intergenic
1145272044 17:21410019-21410041 GAGGGGAGAGGGAGAGTGGTGGG - Intronic
1145310253 17:21697482-21697504 GAGGGGAGAGGGAGAGTGGTGGG - Intronic
1147502709 17:40980998-40981020 CAGAGAAGCTGAAGAATGGTTGG - Exonic
1147775327 17:42896849-42896871 AAGGGCAGAGGGAGAATGATTGG - Intergenic
1147833995 17:43317127-43317149 CTGGGAATAGGGAGGATGGTAGG - Intergenic
1147930869 17:43980049-43980071 CAGGGAAGGGATAGAAAGGTAGG - Intronic
1148487460 17:47999967-47999989 CAGGGCAGAGGCACAGTTGTGGG - Intergenic
1148576902 17:48718812-48718834 CAGGTAAAAGGCAAATTGGTGGG + Intergenic
1149304536 17:55335272-55335294 CAGGGAAGAGGCGGATGGGCTGG - Intergenic
1149428515 17:56578122-56578144 CTGTGAATGGGCAGAATGGTGGG + Intergenic
1149560628 17:57605578-57605600 CGGGGAAGAGGCAGAAGAGAAGG - Intronic
1150224045 17:63513355-63513377 CAGGGAAAAGGCAGAGGGCTTGG - Intronic
1151378269 17:73706740-73706762 CAGGGAGGAAGCAGAAAGGAGGG + Intergenic
1151718523 17:75843464-75843486 CAGGTAAGAGTCAGAGTGCTGGG - Exonic
1152405809 17:80097169-80097191 CAGGGAAGAGTCAGGCTGGGAGG - Intronic
1152451028 17:80380281-80380303 CAGGGAACAGTCAGAATGTGAGG - Intronic
1152728272 17:81958256-81958278 CAGGGAGGAGGCAGGACGGCAGG - Intronic
1153307824 18:3648886-3648908 CAGGGAGGAGGGTGAAGGGTAGG + Intronic
1153964927 18:10170855-10170877 CTAGGAAGTGGTAGAATGGTAGG + Intergenic
1154051343 18:10962277-10962299 GAGGGGAGATGCAGAATGGATGG - Intronic
1154452104 18:14486842-14486864 CAAGGAAGAAGCAGAAGGATAGG - Intergenic
1154983273 18:21522128-21522150 CAGGGAAGAGGGAATGTGGTTGG + Intronic
1155185525 18:23383613-23383635 AAGGGATGAGGCAGAGTGGGAGG + Intronic
1155355537 18:24949525-24949547 TAGAAAAGAGGCAGAATGATTGG + Intergenic
1156356053 18:36340995-36341017 CAAGGAAGAGGAAGAAAGGAAGG - Intronic
1156743123 18:40357137-40357159 CAGGGGAGAGGCAGGATGAAGGG - Intergenic
1157583497 18:48786969-48786991 CAGGGCACAGGCTGAGTGGTGGG - Intronic
1158323873 18:56293548-56293570 TTTGGAAAAGGCAGAATGGTAGG - Intergenic
1158432416 18:57401237-57401259 CAGGGAATAGCCAGAGTGGAGGG + Intergenic
1159050541 18:63417480-63417502 GAAGGAGGAGCCAGAATGGTGGG - Intronic
1159192198 18:65061134-65061156 CAGGGAAGAGGCAGTAGTGACGG - Intergenic
1159744195 18:72210995-72211017 CAGTGAAGATGCAGAACAGTTGG + Intergenic
1160923555 19:1532056-1532078 CAGTGAAGAGGCAGATTAGGAGG + Intronic
1161405786 19:4090483-4090505 CAGGGGTGAGGCAGGAGGGTGGG + Exonic
1162015779 19:7845881-7845903 CAGGGACGTGGCAGAGTGCTGGG - Intronic
1162175119 19:8824611-8824633 ATGGGAGGAGGCAGAAGGGTGGG - Intronic
1162874158 19:13608522-13608544 CAGGGATGAGGCAGCCTGGGAGG - Intronic
1163055591 19:14715350-14715372 AAGGGAAGAGGCATGAGGGTTGG - Intronic
1163444986 19:17340885-17340907 CAGGGGACCGGCAGAATGTTGGG - Intronic
1163691363 19:18740273-18740295 AAGGGAAGAGGCAGATGGGCAGG + Intronic
1163723554 19:18909990-18910012 CTGTGCAGAGGCAGCATGGTGGG - Intronic
1163849877 19:19656770-19656792 CAGGGCAGAGGCAGGAGGGTTGG + Intronic
1164517046 19:28945382-28945404 CAGGGAGGAGGCAGGACGCTAGG + Intergenic
1164626926 19:29735749-29735771 TAGGGAAGAGGCACAGTGCTGGG - Intergenic
1165255765 19:34576594-34576616 CAGGGAAGGGGCAGTGGGGTGGG + Intergenic
1165989652 19:39802770-39802792 CAGGAGAGAGGGAGAATGGCAGG - Intergenic
1165990859 19:39812626-39812648 CAGGGGAGAGGCAGACAGATGGG + Intergenic
1166515135 19:43440835-43440857 GAGGCAAGTGGCAGAATGGCAGG + Intergenic
1166593704 19:44025883-44025905 CAGGGATCAGGCAGAAGGGCCGG - Intronic
1166934132 19:46320878-46320900 CAGGGAAGAGGCAGAAGCGTGGG - Intronic
1167146140 19:47681563-47681585 CAGTGAACAGACAGAAGGGTAGG + Intronic
925717423 2:6797134-6797156 CTTGGAAGAGGCAAACTGGTTGG + Intergenic
925881965 2:8360299-8360321 CAGGGAAAGGGCTCAATGGTGGG - Intergenic
926195842 2:10763159-10763181 CAGGGAAGAGGGAGTGTGGACGG - Intronic
926622756 2:15061925-15061947 CAGGGAAGAGGAAGAAAGCCAGG + Intergenic
927878164 2:26672643-26672665 CTGGGGAGAGGCAGAAGGGAGGG - Intergenic
928299927 2:30116099-30116121 CAGGTAAAAACCAGAATGGTTGG - Intergenic
930464014 2:51721598-51721620 AAGGGAAGAGGCAGAAAGAGAGG + Intergenic
930690825 2:54362451-54362473 GAGGGAAGAGAAAGAATGGAAGG - Intronic
931527477 2:63172848-63172870 CAGGGAAAAGGCAGAAAGAGAGG + Intronic
932231790 2:70089254-70089276 GAGGGAGGAGGGAGAAGGGTGGG + Intergenic
932279811 2:70480865-70480887 CATGGAAGAGGCAGGAATGTTGG - Intronic
932394519 2:71432143-71432165 GAGAGAAGAGGTAGAATGATGGG - Intronic
932491822 2:72127484-72127506 CAGGGAGGTGGCAGAATGTGCGG + Intergenic
932875461 2:75446693-75446715 AAGGGAGGAGGCAGAAGGATAGG - Intergenic
933058768 2:77708638-77708660 GAGAGTAGAGGCAAAATGGTAGG + Intergenic
934112446 2:88756332-88756354 CAGGGAGGAGGCAGGGTGGTGGG - Intergenic
934761511 2:96859440-96859462 CAGGGGAGAAGCGGAGTGGTGGG - Intergenic
935620412 2:105125320-105125342 CAGGGAAGAGGGTGAAAAGTTGG - Intergenic
936163661 2:110102793-110102815 CAGGGAGGAGGCAGGGTGGTGGG - Intronic
936679824 2:114757252-114757274 AAGGGAAGAGGGAGAAAGGAAGG + Intronic
936927943 2:117757179-117757201 GAGGGAGGAAGCAGGATGGTTGG - Intergenic
937419366 2:121741347-121741369 CAGGGACCAGGCAGAGTGGTGGG - Intronic
937435225 2:121874506-121874528 CAGAGAAAAGGTAGCATGGTGGG + Intergenic
937637138 2:124168982-124169004 CAAGGAAGAGGTAGAATCTTTGG - Intronic
938087709 2:128412233-128412255 TAGGGAACAGGGAGACTGGTGGG + Intergenic
938260433 2:129891995-129892017 CAGGGCAGGGGCAGAGTGGGCGG - Intergenic
939271108 2:139940672-139940694 CAGGGAAAGGGCAGAAAGGTAGG + Intergenic
939705437 2:145446913-145446935 AAGGGAAGAGCAAGAATGGGGGG + Intergenic
939844528 2:147227523-147227545 CAGGCCAGAGGCAGCATGGTAGG + Intergenic
939946731 2:148420179-148420201 CAGGAAAGAGACAAAATGCTGGG - Intronic
941064970 2:160891729-160891751 CAGGGAGGAGGGTGAATGGTAGG - Intergenic
941785713 2:169496225-169496247 GAGAGTAGAGGCAGAATGGCAGG - Intronic
942927653 2:181453240-181453262 CAGGCAAGAGGAAGAAAGGAAGG + Intergenic
942927698 2:181454074-181454096 CAGGCAAGAGGAAGAAAGGAAGG - Intergenic
943507662 2:188782103-188782125 CAGGGATGTGGCAAAATAGTTGG - Intronic
945148505 2:206763798-206763820 CAGAGAAGAGGTAGAAAGGAGGG - Intronic
946403887 2:219482971-219482993 CAGGGAACAGGCAGGAAGCTAGG - Intronic
946843236 2:223837759-223837781 CAGAGGAGAGGCAGAAAGGAGGG - Intronic
948176647 2:235948757-235948779 CAGGGCAGAGTGAGAATGCTAGG + Intronic
948179654 2:235969701-235969723 CAGGGAAGGGGCAGAGTGTGGGG + Intronic
948561590 2:238857239-238857261 CAGGGAAGTGCCAGGGTGGTGGG - Intronic
1169124825 20:3120018-3120040 CAGGGAAGAGGCAGGAAGCCAGG + Intronic
1169276466 20:4236543-4236565 GAGGGCAGAAGCAGAAAGGTGGG + Intronic
1170216008 20:13892170-13892192 CAGGCATGAGGCACAATGGATGG - Intronic
1171191726 20:23163734-23163756 AAGGATGGAGGCAGAATGGTGGG + Intergenic
1172270814 20:33654811-33654833 CTGGGGCGAGGCACAATGGTGGG + Intergenic
1172317983 20:33971223-33971245 CAGGGAAGGGGCAGGAAGGATGG - Intergenic
1172331811 20:34080640-34080662 CAGGGCAGAGGCAGAAGACTGGG - Intronic
1172439345 20:34954785-34954807 CAGAGAAGAAGCAGATTTGTGGG - Intronic
1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG + Intronic
1173341095 20:42153799-42153821 CAGTGAAGAGGCAGACTGCCAGG + Intronic
1173442226 20:43087885-43087907 CTGGGAAGGGGAAGAATGGATGG + Intronic
1174627609 20:51928224-51928246 GAGGGAAGAGGGAGAAAGGAGGG + Intergenic
1175514885 20:59562962-59562984 CTGGGAGGAGGGAGAATGATGGG + Intergenic
1175572030 20:60030705-60030727 AGGGGAAGAGGCAGAGTGGTTGG + Intronic
1176161285 20:63650212-63650234 CAGTGAAGGGGAAGGATGGTGGG - Intronic
1176423343 21:6533194-6533216 CAGGCAAGAGACAGTATGGTGGG - Intergenic
1176443919 21:6801458-6801480 CAAGGAAGAAGCAGAAGGATAGG + Intergenic
1176822086 21:13666497-13666519 CAAGGAAGAAGCAGAAGGATAGG + Intergenic
1178777555 21:35566558-35566580 CAGTGAAGAGGAAGAATAGAGGG - Intronic
1178922775 21:36749575-36749597 CAGCGAAGGGGCTGGATGGTAGG + Exonic
1179525518 21:41973687-41973709 CAGGGCTGAGGCAGAAAGGTAGG - Intergenic
1179698837 21:43141510-43141532 CAGGCAAGAGACAGTATGGTGGG - Intergenic
1179947233 21:44686580-44686602 CAGGGAAGGGGCAGAAGGGCGGG - Intronic
1180065304 21:45409299-45409321 CAGGGCAGGGGCAGAATCCTGGG + Intronic
1180286455 22:10749019-10749041 GAGGGAGGAGGCAGGAGGGTGGG - Intergenic
1180575991 22:16774995-16775017 CAGGGACAAGGCAGAAAGGCAGG - Intergenic
1180613666 22:17113779-17113801 CAAAGAAGAGGCAGCAGGGTTGG + Exonic
1181538843 22:23562321-23562343 CAGGGAGGAAGAAGGATGGTCGG + Intergenic
1181762448 22:25067602-25067624 CAGGGCAGAGGGAGGAAGGTGGG - Intronic
1182766270 22:32760286-32760308 CAGGGCAGGAGCAGAATGGAGGG - Intronic
1183623156 22:38986558-38986580 CAGGGAGGAGGCAGTGTGGAGGG - Intronic
1184390535 22:44200901-44200923 CAGGGGAGAGGCACAAGGGTGGG - Intronic
1184492768 22:44819894-44819916 CAGGCATGAGGCAGAATGAGGGG - Intronic
1184567417 22:45300383-45300405 CAGGGCAGAGGCAGTAAGTTTGG + Intergenic
1184842162 22:47058432-47058454 CCGGGAAGAGGAAGGACGGTGGG - Intronic
1185054320 22:48570089-48570111 CAGGGCAGATGCAGCATGGGAGG - Intronic
1185173774 22:49307669-49307691 CAGGGAAGGGGCAGGAGGGGAGG + Intergenic
1185185125 22:49394423-49394445 CAGGGAAGTGACAGAATGGTGGG + Intergenic
950058882 3:10052495-10052517 CAGGTAAGAGGCAATATGTTGGG + Exonic
950126724 3:10514282-10514304 CAGGGAAGAGGTGGGATGGAGGG + Intronic
950154695 3:10712751-10712773 CAGGGGAGAGGCAGGAGGGAAGG + Intergenic
950300525 3:11873751-11873773 CAGGTAAGAGGCAATATGTTGGG + Intergenic
951226370 3:20125931-20125953 CAGGGATGAGGCGGCAAGGTTGG + Exonic
951485414 3:23203690-23203712 GAGAGAAGAGGCAGAAGGGGGGG - Intronic
953032885 3:39189508-39189530 CAGGGTAGAGGCTGGATGCTGGG + Exonic
953344163 3:42161149-42161171 CAGGGAAAAGGGAGGATGTTAGG + Intronic
953545784 3:43862815-43862837 CAGTGCAGATGCAAAATGGTTGG + Intergenic
954410253 3:50367504-50367526 CACCCAAGAGGCAGACTGGTAGG + Intronic
957945137 3:87053613-87053635 CATGGAAGGGACAGAATGGAAGG + Intergenic
958169266 3:89917801-89917823 GAGTGAAGAGGCACATTGGTAGG + Intergenic
960335868 3:116416912-116416934 AAGTGAAGAGGCAGAAAGGAAGG + Intronic
960737503 3:120796823-120796845 CAGGAAAGAAGCAGAATGCTTGG - Intergenic
962141138 3:132792003-132792025 CAGGAAAGAGGGAGCATGGAGGG + Intergenic
962810930 3:138959143-138959165 GAGGGAAGAGGAAGAAAGGAGGG + Intergenic
963043777 3:141087762-141087784 CAGGGCAGAGGAGGAATGGGAGG + Intronic
963548715 3:146694663-146694685 CAAGAAAGAAGCACAATGGTGGG - Intergenic
964292504 3:155196855-155196877 CAGGGAAGAGATAGAATCCTAGG - Intergenic
964413889 3:156427673-156427695 CAATGAAGAGACAGAATTGTGGG + Intronic
965162908 3:165157870-165157892 CTGGGAAGAGTGTGAATGGTGGG - Intergenic
965584557 3:170305717-170305739 CAGCGGACAGTCAGAATGGTTGG + Exonic
967303654 3:188040511-188040533 GAGGGAAGAGGCAGGATGTAAGG + Intergenic
968568178 4:1325988-1326010 CAGGGCAGAGGCAGCAGGGCAGG + Intronic
968916134 4:3497786-3497808 CAGGGCCAAGGCAGACTGGTGGG - Intronic
969129488 4:4981145-4981167 CAGGGATGAGGGAGAATGCCAGG - Intergenic
969224247 4:5784300-5784322 CAGGAGACAGGCAGAAGGGTGGG + Intronic
969282368 4:6179380-6179402 CAGCCAAGAGGCAGACTGGATGG + Intronic
971387039 4:26150346-26150368 CAGGGCAGAGTCACAGTGGTAGG + Intergenic
973125558 4:46579775-46579797 CAGGGAACAGTTAGACTGGTAGG + Intergenic
973172811 4:47166307-47166329 CAGGGAAGAGGTGGAAAGGGAGG - Intronic
974847225 4:67365527-67365549 CAGAGAAAAGGCAGATGGGTGGG + Intergenic
975829765 4:78357115-78357137 CAGGGCAGGGGGAGAATGTTTGG - Intronic
976146794 4:82049949-82049971 CTGGGAGGAGGGAGAATTGTAGG - Intergenic
977980947 4:103320983-103321005 TAGAGAAGCAGCAGAATGGTAGG + Intergenic
978165373 4:105601003-105601025 CAGGGTAGAGGAAGAAAGATGGG - Intronic
978824015 4:112999465-112999487 CAGGTGAGAGGCAGAATGGCAGG - Intronic
979513140 4:121576533-121576555 CAGGGAAGTGGCAAAATTGTAGG + Intergenic
979878038 4:125917842-125917864 CAGGGAAGAGTAAGGAGGGTGGG + Intergenic
982241046 4:153299814-153299836 CAGGTATGAGCCAGAGTGGTGGG - Intronic
984741950 4:183173528-183173550 GAGTGAAGAGCCAGAATGGTTGG - Intronic
984756242 4:183328138-183328160 CATGGAGGAGGCAGAAGGGCAGG + Intergenic
985487379 5:159049-159071 CAGGGCACAGGCAGAAGGCTGGG - Intronic
985907645 5:2853339-2853361 CAAAGCAGATGCAGAATGGTGGG - Intergenic
986221244 5:5770781-5770803 CAGGGAACAGGAAGACTGGGTGG + Intergenic
986552596 5:8974724-8974746 CAGGCAGGAGGCAGTCTGGTGGG + Intergenic
986792917 5:11181037-11181059 CTGGGCAGAGGCTGACTGGTGGG + Intronic
987925039 5:24330090-24330112 CAGGGGAGAGGAAGGAGGGTAGG - Intergenic
988113712 5:26855683-26855705 AAGGGTGGAGGCAGAGTGGTGGG + Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988789058 5:34590558-34590580 GAGGACAGAGGAAGAATGGTAGG + Intergenic
989686244 5:44090462-44090484 CAAGGAAGAAGAAGAATAGTGGG - Intergenic
989768096 5:45110011-45110033 CAGGGATGGGGCAGAAAGGGGGG + Intergenic
990370853 5:55116764-55116786 AAGGGAAAAGGAATAATGGTGGG + Intronic
990898716 5:60727545-60727567 CTGGGAAGACTCAGAATGCTGGG - Intergenic
992261321 5:74973367-74973389 CTGGGCAATGGCAGAATGGTGGG + Intergenic
992748626 5:79842324-79842346 CAGGGAAGAGGAAGGATGCACGG - Intergenic
993173316 5:84449643-84449665 CAGGGAGGAGCCAGAATGAATGG + Intergenic
993968704 5:94389858-94389880 AAGGTAAGAGGCATAATGTTAGG - Intronic
994621902 5:102173422-102173444 CAGTGAAGAAGCAGAAATGTAGG + Intergenic
995018606 5:107341902-107341924 CAGGGGAGAGACAGAATGGGGGG - Intergenic
996338253 5:122408281-122408303 CAGGAAGCAGGCAGAATGGACGG - Intronic
996847601 5:127917594-127917616 CAGAGAAGAGGGAGAAAGATGGG + Intergenic
997036183 5:130194721-130194743 CTGGGAAGAGGCACAAAGGTGGG - Intergenic
997729778 5:136160409-136160431 CTGGGAAGAGGTAGAAGGGGAGG - Intronic
998475684 5:142419461-142419483 CAGGGAAGTGGGGGACTGGTGGG - Intergenic
998737333 5:145157460-145157482 AAGGGACCAGGCAGAATGGCAGG + Intergenic
998919959 5:147057176-147057198 CAGAGAAGTGGCATACTGGTGGG - Intronic
999454400 5:151702796-151702818 CAGGGAAGGGGCAGGAGGGAGGG + Intergenic
1001256885 5:170190395-170190417 CAGGGAAGGGGCAGCATGTCGGG - Intergenic
1001626008 5:173133084-173133106 AAGAGAAGAGGGAGAAAGGTGGG - Intronic
1002443486 5:179276079-179276101 CAGGGATGAGTCAGAAGCGTGGG - Intronic
1003117163 6:3290707-3290729 CAGGGAAGATTCAGAATGGTGGG + Intronic
1003255879 6:4474522-4474544 GAGGGAAGCGGCTGAATTGTGGG - Intergenic
1004157547 6:13183619-13183641 CAGGGAGGAGGAAGGAGGGTGGG + Intronic
1004477746 6:15989539-15989561 CAGGGAAGCCCCAGACTGGTTGG + Intergenic
1006579639 6:35069307-35069329 CAGGGACAAGGGACAATGGTGGG - Intronic
1006844775 6:37054673-37054695 CAGGGGAGTGGCAGGATGTTAGG - Intergenic
1007073737 6:39053961-39053983 CAGGGAAAAGGTACAAAGGTGGG - Intronic
1007378990 6:41474574-41474596 CAGGCAACAGGCAGAAGGGAAGG - Intergenic
1007384337 6:41510491-41510513 CAGGGAAGAGCCAGCCTGGCTGG - Intergenic
1007937857 6:45749920-45749942 AAGTGCAGAGGCAGAATGGCAGG + Intergenic
1009339908 6:62541483-62541505 CAGGCAAGATGCAGTCTGGTCGG - Intergenic
1010355676 6:74929988-74930010 CAGGGAGGGGGAAGAATGGGAGG + Intergenic
1010880339 6:81160489-81160511 CAGGGAAGGGGCAAAATGCAAGG - Intergenic
1011410264 6:87059800-87059822 CAGGGAGGAGGCAGGCTGGGGGG + Intergenic
1011734913 6:90300542-90300564 CAGGGATGTGGCAGAATTGCTGG + Intergenic
1012078174 6:94721651-94721673 CTGGGGTGAGGCAGCATGGTTGG - Intergenic
1012496712 6:99841621-99841643 CAGGGAAGGGGAAGATTGGCAGG + Intergenic
1012585477 6:100916324-100916346 CAGCAAGGAGGCAGGATGGTTGG - Intergenic
1013016089 6:106161615-106161637 CAGGGAAGCCTCAGAATGGTAGG - Intergenic
1014034748 6:116753349-116753371 CAGGCAAGAGGGACAGTGGTGGG + Intronic
1014236751 6:118965714-118965736 CAGGGAAGAGCCAGGATTGTAGG - Intronic
1015218261 6:130775259-130775281 CAAAGAGGAGACAGAATGGTTGG - Intergenic
1015356425 6:132282333-132282355 CAGGGAAGAGGAAGAGTGCCCGG + Intergenic
1015937202 6:138415883-138415905 TAGGGAAGAGGCAGGAAGGGAGG - Exonic
1016427294 6:143948256-143948278 CACGGGAGAGGCAGCATCGTGGG + Exonic
1016600274 6:145850472-145850494 GAGGGAAGAGGAAGAGTGGGTGG + Intergenic
1016938927 6:149468805-149468827 CAGGCAAGAAAGAGAATGGTGGG - Intronic
1016985354 6:149890761-149890783 CAAGGAGGAGGGAGAAAGGTAGG - Intronic
1018575300 6:165253773-165253795 CAGGGGGTAGGCAGCATGGTTGG + Intergenic
1018629721 6:165811440-165811462 CAGGGGAAAGGGAGAAGGGTGGG - Intronic
1019483554 7:1277219-1277241 GAGGGAAGAGGAAGAAAGGAGGG - Intergenic
1019655166 7:2189605-2189627 GAGGCAGGAAGCAGAATGGTGGG + Intronic
1019864154 7:3689304-3689326 CAGGGAGGAGGGAGAATAGCAGG - Intronic
1020256245 7:6504334-6504356 CAGGGAGGAGACCGAATGGAGGG + Intronic
1021539100 7:21737190-21737212 CATGGAAGAGAGAGAATTGTGGG + Intronic
1024227124 7:47334238-47334260 CAGAGAAGAGGCTGCATGCTTGG + Intronic
1024252397 7:47516472-47516494 CAAGGCAGAGGCAGGATGGGAGG - Intronic
1024615619 7:51109119-51109141 GAGGGAAGAGGCTGCCTGGTGGG - Intronic
1026863618 7:73809759-73809781 CAGGGCAATGGCGGAATGGTGGG - Intronic
1027150329 7:75728920-75728942 CAGTGAAGGGGGAGTATGGTGGG + Intronic
1028959820 7:96736071-96736093 CAAGAAAGAGGCAGCATGTTTGG - Intergenic
1029111013 7:98213016-98213038 CAGGGAAGTGGCTGAATGTTCGG - Intergenic
1029280664 7:99433422-99433444 CAGGGAAGAGGCAACAGGGCAGG + Intronic
1031304651 7:120111052-120111074 CACTGAAGACTCAGAATGGTGGG - Intergenic
1032117333 7:129127810-129127832 CAGGGGTGAGGCAGGAGGGTGGG - Intergenic
1032278734 7:130483830-130483852 CAGGGAATAGGGAGAGTGGCAGG - Intergenic
1032502779 7:132412468-132412490 CAGGAAAGAGGCAGAAGGAAGGG + Intronic
1032915949 7:136490081-136490103 CTTGGAAGAGGCAGAATAGCTGG + Intergenic
1034092723 7:148378960-148378982 GAGGGAAGGAACAGAATGGTAGG + Intronic
1034263589 7:149771665-149771687 CAGGGAAGGGGCAGCAGGGGCGG - Intronic
1034787992 7:153942795-153942817 CAGGGAAGAGGCAGAATGGTAGG - Intronic
1034958394 7:155350115-155350137 GAGGGAAGAGGAAGAGTGGCTGG - Intergenic
1035556714 8:572652-572674 CACAGCAGAGGCAGAATTGTGGG + Intergenic
1035775565 8:2185073-2185095 GAGGGAAGAGGCAGGATGCTCGG + Intergenic
1036208086 8:6819823-6819845 TAGGGAAGAGGAAGGAAGGTAGG - Intronic
1036594392 8:10199256-10199278 CAGGGAATAGGGGGCATGGTAGG + Intronic
1037921619 8:22810402-22810424 GAGGGGAGAGGGAGAAGGGTGGG - Intronic
1038473053 8:27841706-27841728 CAGCCAAGAGTCAGAATTGTGGG - Intergenic
1039793768 8:40895629-40895651 GAGGGAAGAGGCAGTGTGGGGGG - Intronic
1041133051 8:54723002-54723024 CAGGGTAGAGGGACAAGGGTGGG + Intergenic
1041457544 8:58076596-58076618 TAAGGAAGTGGAAGAATGGTGGG + Intronic
1043022104 8:75015832-75015854 CGGGGAAGAGGCAGGTAGGTTGG - Intronic
1045312847 8:101018167-101018189 CAGGAAAGGGGGAGAAAGGTTGG + Intergenic
1045766738 8:105681287-105681309 GAGGTAAGAGACAGCATGGTAGG - Intronic
1046938896 8:119912197-119912219 TAGGGAAGAGGCAGAAAGGAAGG + Intronic
1047999283 8:130364221-130364243 AAGAAAAGAGGCAGAATGGTGGG + Intronic
1048955974 8:139536283-139536305 GAGGGAAGATGCAGAATGAAGGG - Intergenic
1049150740 8:141034021-141034043 CCGGGCAGAGGCAGACTGGCTGG + Intergenic
1049231792 8:141488480-141488502 CAGGGGAGAGGCAGCAGGATGGG - Intergenic
1049369974 8:142259733-142259755 CAGGGAAGTAGCAGAACGGTAGG - Intronic
1049566879 8:143344867-143344889 CAGGCAGGAGACAGAATGGATGG + Intronic
1050640866 9:7666188-7666210 CAGGGAATTGGTAAAATGGTGGG + Intergenic
1051247652 9:15127782-15127804 CAGGGAACAGGCAGTGAGGTAGG - Intergenic
1051516359 9:17934586-17934608 CAAGGAAGTGGGAGAATGGATGG - Intergenic
1051836208 9:21340842-21340864 CAGGGCAGAGGCAGAAGAGTTGG + Intergenic
1053392722 9:37747144-37747166 CAGGGGTGAGGGAGAAAGGTGGG + Intronic
1053606704 9:39667216-39667238 CAGAGTACAGGTAGAATGGTTGG + Intergenic
1053864622 9:42423843-42423865 CAGAGTACAGGTAGAATGGTTGG + Intergenic
1054246831 9:62675188-62675210 CAGAGTACAGGTAGAATGGTTGG - Intergenic
1054560953 9:66709722-66709744 CAGAGTACAGGTAGAATGGTTGG - Intergenic
1054874497 9:70081157-70081179 CAGGGAAGGGGAAGAAGGGCAGG + Intronic
1056279759 9:85029727-85029749 CAGGCAATAGGCAGAAAGGCAGG + Intergenic
1056607117 9:88095210-88095232 CAAGGAAGAGGCAGGTTCGTGGG - Intergenic
1057694908 9:97316424-97316446 CAGGGAGGTGGCAGTATGCTGGG - Intronic
1057958460 9:99431955-99431977 CAGTGAACAGGCAGAAGAGTCGG + Intergenic
1058457227 9:105148805-105148827 CAGGGTAGAGGCATAAAGGCTGG - Intergenic
1059737980 9:117121444-117121466 CAGGAAGGAAGCAGAATGCTTGG + Intronic
1059770159 9:117416133-117416155 CAGGGAAGATGAAGAAAAGTAGG - Intergenic
1059862350 9:118478815-118478837 CAGAAAAGAGGCAGTGTGGTTGG - Intergenic
1060894145 9:127206911-127206933 CTGGGAAGAGGCAGAGTAGGTGG - Intronic
1061243317 9:129386954-129386976 CAGGGAAGAAGAAGGATGGCCGG - Intergenic
1061495380 9:130971003-130971025 CAGGAAAGAGGAAGAAAGGAAGG + Intergenic
1062138757 9:134944036-134944058 CAGGGTGGAGGCAGAACGGCGGG - Intergenic
1062212708 9:135373217-135373239 CAGGGAAGGGGCGGAAGGGTGGG + Intergenic
1062405167 9:136392786-136392808 CAGAGCAGAGGCAGAAGGGCTGG + Intronic
1062714523 9:138000516-138000538 CAGGCAGGAGGCAGAAAGATAGG - Intronic
1203525281 Un_GL000213v1:83069-83091 CAAGGAAGAAGCAGAAGGATAGG - Intergenic
1203732813 Un_GL000216v2:106184-106206 GAGGGAGGAGGCAGGAGGGTGGG - Intergenic
1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG + Intergenic
1186580809 X:10816062-10816084 TAGGAAAGAAGCAGATTGGTGGG - Intronic
1186885151 X:13905627-13905649 CATGGAAGAGGCAGAATGGTTGG - Intronic
1187609917 X:20931386-20931408 CAGGGTAGAGCTAGAATGCTTGG + Intergenic
1189417587 X:40828828-40828850 CAGGGAGGAGACAGAGAGGTGGG + Intergenic
1189466335 X:41280476-41280498 AAAGGAAGAGGCACAATGTTTGG - Intergenic
1189676576 X:43467122-43467144 CAGGCAAAACACAGAATGGTTGG - Intergenic
1191250265 X:58256848-58256870 CAGCGACGAGGCAGAAGGCTAGG + Intergenic
1192168982 X:68842900-68842922 CAGCGGAGAGGCAGACTGGCAGG + Intergenic
1192429573 X:71103152-71103174 CAGGGAAGGGGAAGAAGGGCAGG - Exonic
1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG + Intronic
1192649094 X:72931651-72931673 GTGTGAAGAGGCAGAATTGTGGG - Intronic
1192713494 X:73616088-73616110 CAGGCAGGAGGCAGTATAGTAGG + Intronic
1195098938 X:101534868-101534890 CAGCGGACAGTCAGAATGGTTGG - Intergenic
1195821940 X:108955424-108955446 CAGGGAAGTGACTGAATTGTGGG + Intergenic
1196742498 X:119037482-119037504 CACTGGAGAGGCAGAAGGGTGGG - Intergenic
1200853353 Y:7909764-7909786 CAGGAAAGAGGCAGAATCCATGG + Intergenic
1201163091 Y:11181705-11181727 CAGGGAACAGGCAGGGTGGGCGG + Intergenic
1201226153 Y:11820833-11820855 AAAGCAAGAGGCAGAATGGAAGG + Intergenic