ID: 1034796859

View in Genome Browser
Species Human (GRCh38)
Location 7:154021592-154021614
Sequence CCCTGTGTATGTGGGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034796850_1034796859 6 Left 1034796850 7:154021563-154021585 CCATATATCCCAAACGAGGGCCA 0: 1
1: 1
2: 0
3: 1
4: 42
Right 1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG 0: 1
1: 1
2: 1
3: 26
4: 302
1034796851_1034796859 -2 Left 1034796851 7:154021571-154021593 CCCAAACGAGGGCCAGTTATCCC 0: 1
1: 1
2: 0
3: 2
4: 49
Right 1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG 0: 1
1: 1
2: 1
3: 26
4: 302
1034796852_1034796859 -3 Left 1034796852 7:154021572-154021594 CCAAACGAGGGCCAGTTATCCCC 0: 1
1: 1
2: 0
3: 0
4: 35
Right 1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG 0: 1
1: 1
2: 1
3: 26
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034796859 Original CRISPR CCCTGTGTATGTGGGGCTGA AGG Intronic
900206569 1:1434270-1434292 CCCTGTGTACTGGGGGCTGGGGG + Intergenic
900351841 1:2238684-2238706 CACTGCGTGTGTGGTGCTGAAGG + Intronic
900827057 1:4935286-4935308 CCCTGGTGATGTGGGGATGATGG + Intergenic
901419996 1:9144463-9144485 CCCTGAGTATCTGGGGCTATAGG - Intergenic
901629920 1:10643019-10643041 CCCTGAGGAAGTGGGGCTGTGGG + Intronic
901671444 1:10858429-10858451 CCCTGTGGATTCAGGGCTGATGG - Intergenic
902644071 1:17785995-17786017 CCCTGTGGCTGTGTGACTGAGGG + Intronic
902753973 1:18537183-18537205 CCCTGTTTACGTGGGACTGAGGG - Intergenic
903014500 1:20353307-20353329 CCCTCTGTATGTAGGACAGATGG + Intronic
903172140 1:21560919-21560941 CCCTGAGGATCTGGGGGTGAAGG + Intronic
903178623 1:21594655-21594677 CCCTGTGGAGGTGGGGCAGGAGG + Intergenic
904008268 1:27374959-27374981 CCCTTTCTCTCTGGGGCTGAAGG - Intergenic
904906565 1:33901531-33901553 CCCAGTGTGGGTGGGGCTGAGGG + Intronic
904959524 1:34321202-34321224 CCCTGTGGATTGGGAGCTGAAGG - Intergenic
905471644 1:38196616-38196638 CCCTTTGTACTTAGGGCTGAAGG + Intergenic
905557352 1:38897712-38897734 CCTTTTGTGTGTGGGGGTGAGGG - Intronic
905668664 1:39777573-39777595 CCTTGTTGATGTTGGGCTGAGGG - Intronic
905726071 1:40253078-40253100 CCCTGAGTATCTGGGACTGCAGG - Intergenic
906902490 1:49850673-49850695 GTATGTGTATGTGTGGCTGAAGG - Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907468122 1:54653028-54653050 CCATGTCTGGGTGGGGCTGAGGG - Exonic
907485001 1:54771487-54771509 CCCTGTGGAAATGGGGCTGCGGG - Intergenic
907727653 1:57034895-57034917 CACTTTGTAACTGGGGCTGAGGG - Intronic
908184569 1:61640350-61640372 CACTGGGTATTTGGGGCTAAAGG + Intergenic
911193301 1:94969212-94969234 CCCTGTGTAGGTGGGACTATAGG + Intergenic
912225701 1:107732078-107732100 TCCTGTGCATGTGATGCTGATGG - Intronic
912689530 1:111794063-111794085 CCCTGAGCAGGTGGGGCTCAGGG + Intronic
912952723 1:114131561-114131583 CCTTGTGTATGAGGGGCTTGGGG + Intronic
913609229 1:120493995-120494017 ACATGTTTCTGTGGGGCTGAGGG + Intergenic
913986222 1:143568671-143568693 ACGTGTTTCTGTGGGGCTGAGGG - Intergenic
914204599 1:145516455-145516477 ACGTGTTTCTGTGGGGCTGAGGG - Intergenic
914483723 1:148089642-148089664 ACCTGTTTCTGTGGGGCTGAGGG - Intergenic
914581963 1:149027844-149027866 ACATGTTTCTGTGGGGCTGAGGG - Intronic
915841019 1:159213106-159213128 CCCTGTGTAGTTGGGACTGCGGG - Intergenic
917654373 1:177111883-177111905 CCCTGTGGATGTGGGCCTGTTGG - Intronic
918533209 1:185546172-185546194 CCTTGTGACTGTTGGGCTGAGGG + Intergenic
918536974 1:185585240-185585262 CCCAGTGATAGTGGGGCTGAGGG + Intergenic
919990042 1:202703279-202703301 CCATGTGTATGGGCGGCGGAGGG - Intronic
921189006 1:212693507-212693529 CTCTCTCTCTGTGGGGCTGAAGG - Intronic
921951229 1:220932189-220932211 CCCTGTGTCCATGGGGCTGGGGG + Intergenic
922807560 1:228398493-228398515 CCCTGAGTAGGTGGGACTGTAGG - Intronic
1062857406 10:786103-786125 CCCTGTCTGTGTGCGGCTGGAGG - Intergenic
1063961575 10:11310264-11310286 CCCTGTGTATTTGGAGCTGTGGG + Intronic
1064689882 10:17905188-17905210 CACTGTGGTTGTGGGGCTGTTGG + Intronic
1064934832 10:20668089-20668111 CCCAGCGTATGTGGGGTTGAGGG + Intergenic
1066476762 10:35754657-35754679 CCCTGTGTCTGATGGGCTGCAGG + Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068945185 10:62722808-62722830 GCCTGTGCATGGGGAGCTGACGG - Intergenic
1070032972 10:72694657-72694679 TCCTGTGTATGTGCAGCAGATGG + Intronic
1070388972 10:75952119-75952141 CCCCATGTACTTGGGGCTGAGGG - Intronic
1070676434 10:78414919-78414941 CCCTGTGTGCTGGGGGCTGAGGG + Intergenic
1070963927 10:80518034-80518056 CCCTCTGGACGTAGGGCTGATGG - Exonic
1071410908 10:85394117-85394139 CCCTATGCATGTGTGGTTGAGGG - Intergenic
1071600527 10:86956648-86956670 TCCTCTGTAAGTGGGGCTGTTGG + Intronic
1073011535 10:100363690-100363712 CCCAATGTATGTGTGGCTGTGGG + Exonic
1074104534 10:110378712-110378734 CCCTCAGTATGTGGGGATTATGG - Intergenic
1074305351 10:112271949-112271971 CTCTATGTATGGGGAGCTGATGG - Intergenic
1075721102 10:124587949-124587971 CCCGGTGGAGCTGGGGCTGAAGG + Intronic
1075744927 10:124720340-124720362 TCCTGAGTATCTGGGGCTGCAGG - Intronic
1077176412 11:1193181-1193203 CACTGGGTGTGTGGGGCCGAAGG + Intronic
1077210827 11:1370281-1370303 CCGGGTGTCTGTGGGCCTGAAGG - Intergenic
1077294148 11:1816348-1816370 TCCTGAGTAGGTGGGGCTGCAGG - Intergenic
1077477181 11:2795961-2795983 CCCTGTGTGAGTGGGGCAGGGGG - Intronic
1077542515 11:3153985-3154007 TGCTGTGTGTGCGGGGCTGACGG - Intronic
1078004547 11:7522768-7522790 CTAGCTGTATGTGGGGCTGATGG + Intronic
1078633158 11:13023726-13023748 CACTGTGATTGTGGGGCTGTTGG + Intergenic
1079269180 11:18966861-18966883 CCCTGTGTATTTGGTCATGATGG - Intergenic
1083719890 11:64598936-64598958 CCCTGTGGAGGTGGGGTTGGGGG - Intronic
1083967447 11:66051420-66051442 CCCAGTGCAGGTGCGGCTGAGGG + Intronic
1084001242 11:66296338-66296360 CCCTGCGTGTGTGTGGCTGATGG - Exonic
1084133378 11:67155430-67155452 TCCTGCGTATCTGGGGCTGTAGG + Intronic
1084506119 11:69569638-69569660 GCCTGTGTGTGTGGCGCTCAGGG - Intergenic
1085555285 11:77413843-77413865 CCCTGTGTAAATTGGGATGAAGG - Intronic
1085972712 11:81612350-81612372 CCCTGTGTAATTGGCCCTGATGG - Intergenic
1089936563 11:122370330-122370352 CCATGTGTGTTGGGGGCTGAGGG + Intergenic
1092116363 12:6011488-6011510 CACTGTGCATGTGGTGATGAGGG + Intronic
1092616772 12:10222793-10222815 TCCTGTGCATGTGAGCCTGAAGG - Exonic
1094389977 12:29938650-29938672 CCCTGTTTGCGTGGGACTGAAGG + Intergenic
1094841717 12:34345112-34345134 TCCTGTGCATGTGTGGCAGAGGG + Intergenic
1095262382 12:40111279-40111301 TCTTGTGTATTTGGGGGTGAGGG + Intergenic
1097043496 12:56170547-56170569 TCCTGTGTATCTGGGGCTACAGG + Intronic
1097231765 12:57516692-57516714 CCCTGCGTATGTGGGATTGAGGG + Exonic
1097817551 12:64091291-64091313 TCCTGTGTTTCTGGGGCTTAGGG - Exonic
1098336526 12:69410796-69410818 CCCTGTGCATGTGGTCTTGATGG - Intergenic
1100629691 12:96375365-96375387 GTGTGTGTATGTGTGGCTGAGGG - Intronic
1101875067 12:108592180-108592202 CCCCATCGATGTGGGGCTGAGGG + Exonic
1102592669 12:113968857-113968879 CCCAGTGTGTGTGGTGGTGAGGG - Intergenic
1103446660 12:120999434-120999456 CCCGGGGGATGTGGGGGTGAGGG - Intronic
1103668270 12:122589594-122589616 TCCTGAGTATCTGGGGCTGCTGG + Intronic
1105010960 12:132756406-132756428 CCCTGAGTAGCTGGGGCTGTAGG - Intronic
1105324273 13:19355849-19355871 ACGTGGGTATGTGGGGATGAGGG - Intergenic
1106127747 13:26914163-26914185 CCCTGTGTATGTGGTGGCGTGGG + Intergenic
1107552864 13:41493554-41493576 TCCTGTCTTTGTGGGGCTTATGG - Intergenic
1107672354 13:42759205-42759227 CCCTGTGGATTTGGGACTCAAGG - Intergenic
1107823720 13:44308728-44308750 CCCTGTCTATGTGATGATGATGG - Intergenic
1110162483 13:72395456-72395478 TCCTGAGTATTTGGGGCTGCAGG - Intergenic
1113453496 13:110430559-110430581 CCCTGGGCATGTGGGACAGATGG + Exonic
1113872154 13:113565908-113565930 ACCTGAGTATGAGGGTCTGAGGG - Intergenic
1115750022 14:36480005-36480027 CCAAGTGTATTTGGGGGTGAAGG - Intronic
1118720679 14:68591615-68591637 CCCTGTGTGTGTGTGGCCGGTGG + Intronic
1119134242 14:72202480-72202502 CCCTGTGTATAGGGGGCTTCAGG + Intronic
1119939550 14:78625795-78625817 CCATGTGTGTGTGAGGCTCAAGG + Intronic
1120438545 14:84507257-84507279 TCCTGTGTAGCTGGGGCTGCAGG - Intergenic
1120532073 14:85643789-85643811 CCCTGTTTAAGTGGGGTTGGTGG + Exonic
1121419650 14:93804057-93804079 CCATGTGTAAGTCGGGCTGCAGG + Intergenic
1121467306 14:94124317-94124339 CCCTGTGTGTTTGGGGCTTAGGG + Intergenic
1121812100 14:96900466-96900488 CCCTGCCTATGGGGGGGTGAGGG + Intronic
1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG + Intergenic
1125875315 15:43138792-43138814 TCCTGTGTAGCTGGGGCTGCAGG + Intronic
1126023782 15:44427092-44427114 CGCTGGGTAGGTGGAGCTGAGGG - Intergenic
1126792581 15:52234642-52234664 CCCTGTCTCTGTAGGGCTGATGG - Intronic
1129202368 15:74011179-74011201 CCCCTTGAATTTGGGGCTGAGGG - Intronic
1130072961 15:80664622-80664644 CCCTGAGTAGGTGGGGCTACAGG - Intergenic
1130292776 15:82618925-82618947 CTTTGTGTATGTGGGGCAGGGGG + Intronic
1130914996 15:88298084-88298106 ACCTGTGTTTGTGGGGATGCAGG - Intergenic
1131163525 15:90125811-90125833 CGCTGTTCATGTGGGGCAGATGG + Intergenic
1132557927 16:580613-580635 CCCTCTGCATGTGAGGCTGTGGG + Intronic
1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG + Intergenic
1133143670 16:3767521-3767543 CCCTGTGCCTGTGGGGCTCATGG - Intronic
1133202519 16:4212830-4212852 CCCTGAGGCTGTGGGGCTGGTGG - Intronic
1134226825 16:12397832-12397854 CACTGTGGAGGTGGGGGTGAGGG - Intronic
1137756034 16:50903015-50903037 GCCTGTGTATGTGGTGGTGGAGG + Intergenic
1138029291 16:53547099-53547121 CCCTGTGTGTCTGGGGCCCATGG - Intergenic
1138220108 16:55243019-55243041 GCCTGTACATGTGTGGCTGATGG + Intergenic
1138550812 16:57747388-57747410 CACTGTGCATGTGTGGCTCATGG - Intronic
1138782699 16:59808284-59808306 CCCTGTGGGTGTGGGTGTGAGGG - Intergenic
1139842764 16:69894837-69894859 CTCTGTGTGTGTGGGACCGAGGG - Intronic
1140402860 16:74685657-74685679 CTCTGTGTATGTGGGGGCGGGGG + Intronic
1141007103 16:80362869-80362891 GTGTGTGTATGTGGGGGTGAGGG + Intergenic
1141493584 16:84391306-84391328 CCCCGGGGCTGTGGGGCTGAAGG - Intronic
1141513920 16:84530420-84530442 CCCAGTGTGAGTGGCGCTGAGGG - Intronic
1141980310 16:87546208-87546230 TCCTGTGGTTGTAGGGCTGAGGG + Intergenic
1142168254 16:88605253-88605275 CCCTGAGTCTGTGGGACTGTGGG - Intronic
1142406455 16:89892941-89892963 GCCTGTGTCTGTGGGGGTGCCGG + Intronic
1142467411 17:144171-144193 TCCTGTCTTTGTGGGGATGATGG + Intergenic
1143034448 17:3986383-3986405 CCCTTTGTGTCTGGGGCTGCTGG - Intergenic
1143357080 17:6338319-6338341 CCATGGGTTTGTCGGGCTGAGGG - Intergenic
1144727701 17:17510214-17510236 CCTTGTGGCTGTGCGGCTGACGG - Intronic
1145185278 17:20788487-20788509 CCCAATGTATGTGTGGCTGTGGG + Intergenic
1147250288 17:39149239-39149261 CTCTGGGTTTGTGGGGCTGGTGG - Intronic
1148033164 17:44636810-44636832 CTCTGTGTGTGTGTGACTGAAGG + Intergenic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1148487824 17:48002511-48002533 ACCAGCATATGTGGGGCTGAAGG + Intergenic
1148772636 17:50076087-50076109 CCCTGTGGATGGGGAGGTGAAGG + Intronic
1151153097 17:72104751-72104773 CCCTTTCTCTGTGGGCCTGAAGG - Intergenic
1151364761 17:73610035-73610057 CCATGTCTCCGTGGGGCTGATGG - Intronic
1151499645 17:74480618-74480640 CCCTGTGCATCTGGGGCTTAGGG - Intronic
1151891492 17:76953365-76953387 GCCTGTGTATGTGGGGGAGGTGG - Intergenic
1152479467 17:80540575-80540597 GCCTGCAGATGTGGGGCTGAAGG - Intergenic
1152742448 17:82024257-82024279 CCCTGTGTAAGGGGGGCCGGCGG - Exonic
1152979584 18:263688-263710 CCCTGCTTATGTGGAGCTAATGG - Intronic
1153535837 18:6100785-6100807 CCCTGTTAATGTTGGGCTGCAGG + Intronic
1156877470 18:42032244-42032266 CCCAGTGTATTTGGAGCAGAGGG + Intronic
1157191319 18:45584412-45584434 GGCTTTGTATGTGGGGTTGAAGG + Intronic
1157203054 18:45675636-45675658 TCCTGAGTAGGTGGGGCTGTAGG + Intronic
1157406292 18:47424875-47424897 CCCTTGGTGTGTGGGGCAGAAGG + Intergenic
1158395687 18:57077160-57077182 GCCTGAGTCTGTGGGGCAGAGGG + Intergenic
1158763665 18:60421790-60421812 CCCTGAGGAAGCGGGGCTGAGGG + Intergenic
1158909551 18:62046560-62046582 CGCTGTGTATGTGGGGGTGAGGG - Intronic
1160006005 18:75069441-75069463 CCCTGTGGAGGTGCAGCTGAAGG - Intergenic
1160351342 18:78182794-78182816 CTCTGTTTATGTGGGCCTGTGGG - Intergenic
1160951909 19:1671904-1671926 CCCTGGGGAGGTGGGGTTGAAGG - Intergenic
1162371888 19:10284652-10284674 TCCTGTGTGAGTGGGGCTGCTGG + Exonic
1162481450 19:10929099-10929121 CGCTGTGTATGTGGGTCTGCTGG + Exonic
1166428090 19:42697609-42697631 CCCGGTGATAGTGGGGCTGAGGG - Intronic
1166891953 19:45999416-45999438 GCGTGTGAATGTGGGGCGGAGGG + Intronic
1167701749 19:51052195-51052217 AACTGTGTCTGTGGGGGTGAGGG - Intergenic
1168703411 19:58454714-58454736 TCCTGCCTTTGTGGGGCTGATGG + Intronic
925059256 2:878481-878503 GCATGTGTATGTAGGGGTGAGGG - Intergenic
925122124 2:1427466-1427488 CCATGAGTGTGTGGGGGTGAGGG + Intronic
925338511 2:3116034-3116056 CCTTGTCCATGTGGAGCTGATGG - Intergenic
927003617 2:18825184-18825206 CCCTGTGTGCCTGGGACTGAGGG + Intergenic
927574704 2:24191294-24191316 TCCTGTGTGTGTGGTGGTGAGGG - Exonic
927875754 2:26654178-26654200 CCCTGCTTCTGTGTGGCTGAGGG - Intergenic
928407025 2:31022575-31022597 ACATGTGTATGTGGAGCTAAGGG + Intronic
930255736 2:49088178-49088200 GCGTGTGTATGTGGTGCAGAGGG + Intronic
931869276 2:66441498-66441520 CCCTGTGTGTTTGGGGGTAAGGG - Intronic
932342607 2:70975833-70975855 CCCTGTGTATGTGGTGGGGTTGG - Intronic
932466907 2:71929947-71929969 CCCTGTGGAGGAGGGGCTAAAGG + Intergenic
934577601 2:95412837-95412859 GCTTGTGTATGTGTGTCTGACGG + Intronic
935225426 2:101048094-101048116 CCCTGTGTGTGTGGGGCACATGG - Intronic
935226107 2:101054501-101054523 CCGTGTGTCTGGGTGGCTGACGG - Intronic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
939192080 2:138928870-138928892 CCAAGTGTCTGTGTGGCTGAAGG - Intergenic
939844291 2:147224497-147224519 CTCTGTCTTTGTGGAGCTGAGGG - Intergenic
939961677 2:148570977-148570999 CCCCTTGCATGTGTGGCTGATGG - Intergenic
940627699 2:156196198-156196220 GCCTGTGTATGTGTGTATGAAGG + Intergenic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
942759160 2:179378057-179378079 CCCTGTGTAGGTGGGACTACAGG + Intergenic
947647793 2:231757080-231757102 TCCTGAGTATGTGGGGCTACAGG + Intronic
947673970 2:231961214-231961236 CCCTCAGGATGTGAGGCTGATGG - Intergenic
948940528 2:241193429-241193451 CTCTGTGTGTGTGAGGCTTAAGG + Intronic
948964603 2:241367962-241367984 CTGTGTGTATGTGGGGGTGGAGG - Intronic
1170267072 20:14478854-14478876 CCTTGTGTATCTGGTGCTGGTGG + Intronic
1170893753 20:20396403-20396425 CCTTTTGTGTGTGGGGCTGCAGG - Intronic
1176199576 20:63854357-63854379 CCCTGGGGAGGTGGGGCTTAGGG + Intergenic
1176651600 21:9553275-9553297 CCCTGAGTAGCTGGGGCTGCAGG + Intergenic
1177237193 21:18407568-18407590 TCCTGAGTATATGGGGCTAAAGG + Intronic
1179414660 21:41188555-41188577 CCCTGGGTCTGGGGGGGTGATGG - Intronic
1179971341 21:44837921-44837943 CACTGTGCATGTGGCGCTGGGGG + Intergenic
1180039030 21:45266360-45266382 CCCTGTGTGTGGGGTGGTGAGGG - Intronic
1180567781 22:16689974-16689996 CACTGTGCATGTGGTGATGAGGG + Intergenic
1180630264 22:17224499-17224521 ACCTGTGAAAGTGAGGCTGAAGG + Intergenic
1180646611 22:17344214-17344236 CCCTAAGTATGTGGGACTGCAGG + Intergenic
1180914556 22:19476575-19476597 CCCTGTGGATATGGGGGTGGGGG - Intronic
1181498686 22:23302873-23302895 CCCTGTGTCAGTGGGAGTGATGG - Intronic
1182549204 22:31091881-31091903 AGCAGTGTATGTGAGGCTGACGG - Intronic
1182551764 22:31104571-31104593 GCGTGTGTATGTGGGGGGGAGGG - Exonic
1183909141 22:41065385-41065407 TCCTGAGTATGTGGGGCTACAGG - Intergenic
1183910614 22:41076101-41076123 CCCTGTGGCTGTGTGGCTGAGGG + Intergenic
1184194253 22:42916256-42916278 CCTTGTGACTGTGGAGCTGAAGG - Intronic
1184217732 22:43078848-43078870 CCCCGTGTCTGTGGGTGTGAGGG - Intronic
1184217751 22:43078912-43078934 CCCCGTGTCTGTGGGTGTGAGGG - Intronic
1184217770 22:43078976-43078998 CCCCGTGTCTGTGGGTGTGAGGG - Intronic
1184217824 22:43079168-43079190 CCCCGTGTCTGTGGGTGTGAGGG - Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950650359 3:14403175-14403197 CCCTGTGTCTGTGTTTCTGAGGG + Intronic
951536370 3:23744279-23744301 CCCTGCCTATGTGGGGCTCCAGG - Intergenic
951632936 3:24740981-24741003 CAATGGGTAGGTGGGGCTGAGGG + Intergenic
953374976 3:42420920-42420942 CCCAGTTTATCTGGGACTGAGGG + Intergenic
954201486 3:49025899-49025921 CCCGGGGTTTGTGGTGCTGATGG - Intronic
956126770 3:66018202-66018224 TCCTGTGTGTGTTGGGGTGAGGG - Intronic
956491281 3:69774708-69774730 CCCTGTGTATGTTGGGGTGTGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957132038 3:76235281-76235303 CCCTGTGTGTGTTGGGCGGTGGG - Intronic
962382602 3:134909749-134909771 CCCTGTGGAGGTAGGGGTGAAGG - Intronic
962386459 3:134936390-134936412 CCCTGTGTATGTCCGGCTCCGGG + Intronic
963214111 3:142724892-142724914 CCCTGTGAGTGTGGAGCTGGCGG + Intronic
965602712 3:170470770-170470792 CCTTGTTTATGTGGGACAGATGG - Intronic
967232223 3:187350646-187350668 CCCTGTGTATGTGGGTGTAGGGG + Intergenic
971455547 4:26840690-26840712 CCTTCTGAATGTGGGGCTCAGGG - Intergenic
972319002 4:37955333-37955355 CTCAGTGTATGTGGGGATGAGGG + Intronic
972343688 4:38175185-38175207 CCCAGTGTTTCTGGGGCAGATGG - Intergenic
975658627 4:76666390-76666412 CCCTGAGTAGGTGGGACTGCAGG + Intronic
976465550 4:85364422-85364444 CCATGTGTATGTGTGTCAGAAGG - Intergenic
984331519 4:178326368-178326390 CCAAGTGTCTGTGGGGCTGTGGG + Intergenic
985198204 4:187455921-187455943 CAGAGTGTATGAGGGGCTGATGG + Intergenic
985309499 4:188581697-188581719 CCCTATGTGCGTGGGGCAGAGGG + Intergenic
985828150 5:2207946-2207968 CCCTGTGGATGGGCGGCTGGAGG + Intergenic
986098752 5:4585882-4585904 GCATGTGTGTGTGGGGGTGAGGG - Intergenic
988977267 5:36527572-36527594 CCCTGAGCATGGGGTGCTGACGG + Intergenic
989027820 5:37087356-37087378 CCCGGTGATGGTGGGGCTGAGGG - Intergenic
989693569 5:44172753-44172775 CCCTTTGTATATGAGTCTGATGG - Intergenic
994639517 5:102389447-102389469 CTCTGTGTGTGTGGGGGTGGGGG - Intronic
997573170 5:134949112-134949134 CCCTGAGGAAGTGGGGCTAAAGG - Intronic
997962363 5:138332122-138332144 CCCGGGGTTCGTGGGGCTGAGGG - Intronic
998005101 5:138651529-138651551 CTCTGTGTGTGTGGGGGTGGGGG - Intronic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
1000481252 5:161777831-161777853 CCCTGTGTAGTTGGGACTGTAGG + Intergenic
1000712465 5:164598042-164598064 GTCTGTGTATGTGGTGCTTAAGG - Intergenic
1001470713 5:172010567-172010589 CCCTTTGTGTGTGGGGAGGAAGG - Intergenic
1001757962 5:174185497-174185519 CCAGGTGTATGTGGGGGTGGTGG + Intronic
1003308060 6:4946666-4946688 CCTTGCGCCTGTGGGGCTGATGG + Intronic
1007507984 6:42351812-42351834 CCCTGTGTCTGTTTGGCAGATGG - Intronic
1007586747 6:42995253-42995275 CCCTGAGTAGCTGGGGCTGCAGG + Intronic
1007755763 6:44098345-44098367 CCATGTGTATGGGGGAATGAGGG - Intergenic
1010659238 6:78549679-78549701 CCATGTTTATTTGGGGGTGAAGG - Intergenic
1012259588 6:97072154-97072176 GTCAGTGTATGTGGGGCTCAAGG - Intronic
1016420204 6:143874954-143874976 CCCCGGGTATGTGGGACTGCAGG + Intronic
1016752667 6:147648411-147648433 CCCTGTATATGTGGGTATTATGG + Intronic
1017414451 6:154204995-154205017 CCCTGTGGATGTTGGGTGGACGG + Intronic
1018610336 6:165642183-165642205 CCCTATGGATGTGGGGCTGTGGG - Intronic
1018778393 6:167040318-167040340 CCCTTTGTGTGTGTGGCTGCTGG + Exonic
1018812578 6:167308464-167308486 CCCTGTGGATGTGGGGGAGCAGG + Intronic
1019011906 6:168849605-168849627 CCCTGTGTGTCAGGGGCTCAGGG - Intergenic
1019397034 7:826516-826538 CCCTGTGGACGTGGGGCTTGTGG + Intronic
1019428746 7:988940-988962 CCCTGTGGGGGTGGGGGTGAGGG - Exonic
1019516611 7:1442939-1442961 CCCTGTGTCTGTGTGTCTGGCGG - Intronic
1019733755 7:2640658-2640680 GCCTGTGTCTGTGTGGCTGATGG + Intronic
1021114634 7:16733786-16733808 TCCTGAGTATCTGGGACTGAAGG - Intergenic
1022995509 7:35751068-35751090 GCCTGGGTTTGAGGGGCTGATGG + Intergenic
1030246224 7:107386928-107386950 CCCGGTGATAGTGGGGCTGAGGG - Intronic
1031156190 7:118115062-118115084 CCCAGTGTTAGCGGGGCTGAGGG - Intergenic
1031964055 7:128014633-128014655 GCATGTGTATGTGGGCCTGTGGG - Intronic
1033232462 7:139611663-139611685 TCCTGTGTATCTGGGACTGCAGG + Intronic
1034264475 7:149774210-149774232 CCCTGAGGAGCTGGGGCTGAGGG - Intergenic
1034309986 7:150079029-150079051 CCCTGTGTATGTGGGGATGAAGG - Intergenic
1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG + Intronic
1035056866 7:156041621-156041643 CCCTGTGTCTGGGGGGCCCAGGG - Intergenic
1035603345 8:912339-912361 CCCTGTGTTTGTGGAACTGACGG + Intergenic
1035878210 8:3214535-3214557 ACCTGTGTGATTGGGGCTGATGG - Exonic
1036040462 8:5074155-5074177 CCGTGTGTATTTGTGGTTGATGG + Intergenic
1036395909 8:8371192-8371214 CCCTTTTTCTGTGGGGCTGCTGG - Intronic
1036669044 8:10767870-10767892 GCCTGTCTCTGTGTGGCTGAGGG - Intronic
1037078623 8:14754816-14754838 CCTTGAGTAGGTGGGACTGAAGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038423954 8:27452662-27452684 CCCAGAGTGTTTGGGGCTGAAGG - Intronic
1039257298 8:35733586-35733608 CTCTGTGTGTGTGGAGGTGATGG - Intronic
1039737109 8:40344820-40344842 CTCTGTGCATGTGGGGCTGGTGG + Intergenic
1039913206 8:41841092-41841114 CGCAGTGAATGTGGGGCTGCAGG - Intronic
1045227933 8:100268784-100268806 TCCTGTGTATGTGGGCCGCAAGG - Exonic
1045373950 8:101552676-101552698 CTCTGTGTATGTCTGACTGATGG + Intronic
1047184116 8:122616685-122616707 CCCTGTGTGAGTGGCACTGATGG - Intergenic
1047454579 8:124997946-124997968 CCCTGTGTATGTGGAGAGGGCGG - Intergenic
1048044752 8:130763057-130763079 GGCTGTGGATGTGGGGTTGAGGG + Intergenic
1048398692 8:134041963-134041985 TCCTGAGTAGCTGGGGCTGAAGG - Intergenic
1049285768 8:141774382-141774404 CCCTGGGGCTGTGGGACTGAAGG + Intergenic
1049300211 8:141865754-141865776 CCCTGTGTGTGTGTGCCTGTGGG - Intergenic
1049338250 8:142097951-142097973 CCCTGATTCTGTGGGGCTGGAGG - Intergenic
1052526555 9:29626644-29626666 CCATGTGTATGTGGTGGGGAAGG - Intergenic
1053158484 9:35796734-35796756 CTTTGGGTAGGTGGGGCTGAGGG + Intronic
1055086363 9:72318117-72318139 CCCTGAGTATCTGGGACTGCAGG + Intergenic
1056439076 9:86602577-86602599 CCCTCTGTGTGCGGAGCTGAAGG + Intergenic
1056797781 9:89670429-89670451 TCCTGAGTGTGTGGGGCTGTGGG + Intergenic
1056820117 9:89835321-89835343 CCCTGTGTGTGTGGTGCCCAGGG + Intergenic
1056824059 9:89864600-89864622 CTCTGTGTGTGTGGTCCTGAGGG - Intergenic
1057702064 9:97370515-97370537 ACCTGGGTGTGTGGGGGTGATGG - Intronic
1060659675 9:125397358-125397380 CCCTGTGCAGGTGTGGCTGGTGG + Intergenic
1060699309 9:125737012-125737034 TCCTGAGTATCTGGGGCTGCAGG + Intergenic
1061925277 9:133803174-133803196 CCCTGCGTATGTGGAGATGAAGG - Intronic
1061940925 9:133883356-133883378 CCAAGTGAGTGTGGGGCTGACGG + Intronic
1062058482 9:134481831-134481853 CCTTGTGGTTGTGGGGCTGAGGG + Intergenic
1062710715 9:137973776-137973798 GGCTGAGTATGTGAGGCTGAGGG + Intronic
1203629331 Un_KI270750v1:56830-56852 CCCTGAGTAGCTGGGGCTGCAGG + Intergenic
1185595544 X:1304481-1304503 CCCTGTGCCCGAGGGGCTGAGGG - Intronic
1187281045 X:17859018-17859040 CTGTGTGTATGTGGGGGTGTGGG + Intronic
1188338651 X:28971794-28971816 CCATCTGTATTTGGGGATGAGGG + Intronic
1189974177 X:46446001-46446023 TCATGTGTATGTGTTGCTGATGG - Intergenic
1190069902 X:47271152-47271174 CCCTGAGTATCTGGGACTGTAGG - Intergenic
1190690802 X:52911476-52911498 ACCTGTGTATGGGGGGTGGATGG + Intergenic
1190695181 X:52944316-52944338 ACCTGTGTATGGGGGGTGGATGG - Intronic
1190829396 X:54046457-54046479 TCCTGTGTACGTGGGACTGCAGG - Intronic
1191902207 X:66053271-66053293 CCCTGAGTATGTGGGGGTGGGGG + Intergenic
1191972389 X:66831637-66831659 CCTTGTGTATGTGGGGCGGGTGG - Intergenic
1194486433 X:94492432-94492454 CCCTGTGATATTGGGGCTGAGGG - Intergenic
1196387913 X:115178216-115178238 GTCTGTGGCTGTGGGGCTGAGGG + Intronic
1197615292 X:128683758-128683780 AGCTGTGTGGGTGGGGCTGAGGG - Intergenic
1198968303 X:142250891-142250913 CCCTGAGAATGTGGTGCAGAGGG - Intergenic
1200045545 X:153398981-153399003 CCCTACGTGTGTGGGGGTGAGGG + Intergenic
1201612710 Y:15861058-15861080 CCCTGTGTAGCTGGAACTGAAGG + Intergenic
1201985530 Y:19960718-19960740 CCCAGTGATAGTGGGGCTGAGGG - Intergenic