ID: 1034797715

View in Genome Browser
Species Human (GRCh38)
Location 7:154028989-154029011
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 2, 1: 1, 2: 6, 3: 14, 4: 182}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034797715_1034797725 11 Left 1034797715 7:154028989-154029011 CCCTCTGTCCTCGAGGCCCACAG 0: 2
1: 1
2: 6
3: 14
4: 182
Right 1034797725 7:154029023-154029045 CCTCTGAGAGTCCGGCACGGTGG No data
1034797715_1034797727 13 Left 1034797715 7:154028989-154029011 CCCTCTGTCCTCGAGGCCCACAG 0: 2
1: 1
2: 6
3: 14
4: 182
Right 1034797727 7:154029025-154029047 TCTGAGAGTCCGGCACGGTGGGG 0: 2
1: 0
2: 0
3: 4
4: 66
1034797715_1034797729 23 Left 1034797715 7:154028989-154029011 CCCTCTGTCCTCGAGGCCCACAG 0: 2
1: 1
2: 6
3: 14
4: 182
Right 1034797729 7:154029035-154029057 CGGCACGGTGGGGAGTCCACAGG 0: 2
1: 0
2: 0
3: 6
4: 83
1034797715_1034797722 3 Left 1034797715 7:154028989-154029011 CCCTCTGTCCTCGAGGCCCACAG 0: 2
1: 1
2: 6
3: 14
4: 182
Right 1034797722 7:154029015-154029037 TGCAGGTGCCTCTGAGAGTCCGG No data
1034797715_1034797726 12 Left 1034797715 7:154028989-154029011 CCCTCTGTCCTCGAGGCCCACAG 0: 2
1: 1
2: 6
3: 14
4: 182
Right 1034797726 7:154029024-154029046 CTCTGAGAGTCCGGCACGGTGGG 0: 2
1: 0
2: 0
3: 7
4: 70
1034797715_1034797723 8 Left 1034797715 7:154028989-154029011 CCCTCTGTCCTCGAGGCCCACAG 0: 2
1: 1
2: 6
3: 14
4: 182
Right 1034797723 7:154029020-154029042 GTGCCTCTGAGAGTCCGGCACGG 0: 2
1: 0
2: 0
3: 11
4: 105
1034797715_1034797730 24 Left 1034797715 7:154028989-154029011 CCCTCTGTCCTCGAGGCCCACAG 0: 2
1: 1
2: 6
3: 14
4: 182
Right 1034797730 7:154029036-154029058 GGCACGGTGGGGAGTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034797715 Original CRISPR CTGTGGGCCTCGAGGACAGA GGG (reversed) Intronic
900395114 1:2450291-2450313 CCGTGGGCCTCCAGCACAGGCGG + Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
901167308 1:7229693-7229715 CTGTGAGCCAGGAGCACAGAGGG + Intronic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902443584 1:16447399-16447421 CAGTGAGCCCCGAGGAAAGAAGG - Intronic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
904009151 1:27380168-27380190 CTGTGGGCCTCAGGGACTGGGGG + Exonic
904040710 1:27583216-27583238 CTGGTGGCCTCAAGGACATAGGG - Intronic
904447598 1:30587550-30587572 CTGTGGGACTCTGGGACAGTCGG - Intergenic
904678380 1:32212373-32212395 CTGGGTGCCTAGAGGCCAGAGGG + Intronic
913423799 1:118704348-118704370 CTGTGTGATTCAAGGACAGAGGG + Intergenic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
915571931 1:156749599-156749621 CTTTGGGCCTCCAGGACAGAAGG - Intronic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919449089 1:197748613-197748635 TTGTGGGCTTTGAAGACAGAAGG + Intronic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
924304092 1:242669324-242669346 TTGTAGGTCTCCAGGACAGATGG - Intergenic
924768217 1:247053806-247053828 CTATGGGCATGGATGACAGATGG - Intronic
1063176889 10:3558956-3558978 CTGTGGGGCTCCTGCACAGAGGG + Intergenic
1063201222 10:3786074-3786096 CTGGTGGCCCGGAGGACAGAGGG - Intergenic
1063231236 10:4067543-4067565 CTGTGGCCCTCGAGGACTTTGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1072816098 10:98510785-98510807 CTGCGGCCCTCCATGACAGAAGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073074635 10:100816057-100816079 TTTTGGGCCTCACGGACAGAGGG - Intronic
1075700802 10:124468480-124468502 CTGTGGGCCTGCAGAACCGATGG + Intronic
1075787019 10:125056987-125057009 CTGTGTACCCCGGGGACAGAGGG - Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076548293 10:131260561-131260583 CTGTGGGCCTCCATTAAAGAGGG - Intronic
1076569872 10:131425669-131425691 CTGTGGGCCCTGAGGTCAGTTGG - Intergenic
1076830528 10:132992199-132992221 CTGTGAGCCTCGAGGACAGAGGG + Intergenic
1076830532 10:132992217-132992239 GAGGGAGCCTCGAGGACAGAGGG + Intergenic
1076886863 10:133267016-133267038 CTGGGGCCCTGCAGGACAGATGG - Intronic
1076984105 11:223112-223134 ATGTAGGCACCGAGGACAGAAGG - Intronic
1077017939 11:405148-405170 CTGGGGGCCTCGAGAGTAGAGGG + Intergenic
1077277610 11:1721693-1721715 CTGGGGGCCTCGAGCACTGGGGG - Intergenic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083306625 11:61765063-61765085 CTGTGGGCCCCCAGGATATATGG + Intronic
1084795323 11:71501373-71501395 CTGGGGTCCCCGAGGACAGGAGG - Exonic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085638399 11:78175659-78175681 CTGTGGGCCTTGAAGATAGATGG - Intronic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1094372374 12:29751839-29751861 CTGTGGGCTGCGTGGACAGAGGG + Exonic
1095326651 12:40903128-40903150 CTGTGGGTCTCCATGACTGATGG - Intronic
1099738639 12:86601833-86601855 CTGTGGGCGACAAGGAGAGAAGG + Intronic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1103959895 12:124602961-124602983 CTGAGGGCCACAAGGAAAGATGG + Intergenic
1103987632 12:124778293-124778315 CTGTGGGCCACGTGGAGAGAAGG + Exonic
1104477610 12:129083550-129083572 CTGTGGGTCTCAGGGACAGTTGG - Intronic
1104755497 12:131266765-131266787 CTGCAGGCCTCGTGGACAGCAGG + Intergenic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1112589641 13:100751343-100751365 CTGGGGGCTTTGAGGAGAGAAGG + Intergenic
1113589703 13:111489642-111489664 CTGTGTGCCTCCTGTACAGAAGG + Intergenic
1119443346 14:74644342-74644364 CTGTGAGCCTCGAGTAAAGCTGG + Intergenic
1119485646 14:74984915-74984937 CTGTGGGACTTGGGGACTGAGGG + Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121733435 14:96202204-96202226 CTGTGGGGCTAAAGTACAGAGGG + Intergenic
1121957615 14:98228485-98228507 CTGGGGGCCTCTAGAACACAAGG - Intergenic
1122154277 14:99741144-99741166 CTGTGAGCCTCTGTGACAGATGG + Intronic
1122852306 14:104543144-104543166 CTTTGGGCCACGAGGAGAGGAGG + Intronic
1122917148 14:104864621-104864643 CTGTGGGCGTCCAGGTAAGACGG + Intergenic
1123936437 15:25196381-25196403 CTGCAAGCCTCGGGGACAGAGGG - Intergenic
1124264279 15:28219614-28219636 CTGTGTGCCCCGAGCCCAGACGG + Intronic
1127974231 15:63985390-63985412 CTCTGGGCCTCGAGGACAGCGGG + Intronic
1128373611 15:67059461-67059483 CTGTGGGCTTTGGGGACATAGGG + Intergenic
1128639152 15:69323178-69323200 CTCTTGGCCTAGTGGACAGAGGG - Intronic
1133338697 16:5022850-5022872 CTGGGGGCCTCTGGGACAGTTGG - Intergenic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1137722108 16:50633438-50633460 GTGTGGGCCACGTGGCCAGAGGG + Exonic
1141883887 16:86878789-86878811 CTGTGTGCCTGTCGGACAGATGG - Intergenic
1142264429 16:89057290-89057312 CTGGTGACCTCGAGGACAGCTGG - Intergenic
1142483877 17:234584-234606 GTGTGGTCCCAGAGGACAGACGG + Intronic
1142555530 17:774168-774190 GTGTGGGACTCGTGGAGAGATGG - Intronic
1143846627 17:9776953-9776975 CTGTGAGCTTCGCGGACAGAAGG + Intronic
1144103228 17:11962371-11962393 CTGATGGCCTCAAGGAAAGAAGG - Intronic
1144961321 17:19045696-19045718 CTGTCGGCCTCGTGGACATGTGG - Intronic
1144973840 17:19128828-19128850 CTGTCGGCCTCGTGGACATGTGG + Intronic
1147456874 17:40543333-40543355 CTGTGACACACGAGGACAGAAGG - Intergenic
1148636989 17:49156551-49156573 CTGGAGGCCTGGAGGACACAGGG - Exonic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1151320034 17:73347537-73347559 CTGTGGGCCCCGTGGGCTGAGGG - Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1156475677 18:37403985-37404007 CTGAGTGCCTCCTGGACAGATGG - Intronic
1157446266 18:47748833-47748855 CTGTGATCCTGGAGGCCAGAGGG - Intergenic
1158511771 18:58096821-58096843 TTATGGGCCTTCAGGACAGATGG - Intronic
1160458726 18:79021235-79021257 CTGTGTGACTCCAGAACAGAAGG - Intergenic
1160657374 19:280510-280532 CTTTGGGCCTAAAGGACACAGGG + Intergenic
1160922013 19:1525429-1525451 CTGTGGGCCCTGGGGACCGATGG - Intronic
1161285179 19:3464803-3464825 GAGCGGGCCCCGAGGACAGACGG - Intronic
1163102658 19:15107582-15107604 CCCAGGGCCCCGAGGACAGACGG + Intronic
1166543795 19:43622625-43622647 CGGGGGGCCTGGAGGAGAGATGG + Exonic
1167442418 19:49516058-49516080 CTCTGGGCCTTGAGCAAAGAGGG + Intronic
1168187425 19:54709023-54709045 CTGTGGGCTCCTAGGAGAGAAGG - Intergenic
926058669 2:9791874-9791896 CTCTGGGCCTCCAGGACGGTGGG + Intergenic
927667302 2:25041818-25041840 CTGGGGTCCTCGAGGTCAGCCGG - Intergenic
930002120 2:46868638-46868660 CTCTGGGCCTCCAAGACAGAAGG - Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933409804 2:81910537-81910559 CTGTGGGCCTCCAGGCTTGATGG + Intergenic
934715251 2:96539283-96539305 AAGTGGGCCAAGAGGACAGATGG - Intronic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
942481775 2:176395666-176395688 CTGTGAGCCTCCAGGGCAGCTGG - Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
942979592 2:182063847-182063869 ATGTGGTCCTAGAGAACAGACGG - Intronic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
947771468 2:232673639-232673661 CTGTGTGCCTCTAGTACACATGG + Intronic
947864140 2:233384511-233384533 CTGCGGGCCTCGAGGACGTCAGG - Intronic
948053571 2:234995574-234995596 CTGTGGGCTTCGAGGACAGGAGG - Intronic
948582523 2:238997733-238997755 CTGTGGCTCCCGAGAACAGATGG + Intergenic
948663191 2:239519208-239519230 CTGTCGGGCTCAAGCACAGAAGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1171957738 20:31472862-31472884 CTCAGGTCCTGGAGGACAGAGGG - Intronic
1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG + Intergenic
1175971832 20:62690224-62690246 CTGTGGGCCCCTGAGACAGAGGG - Intergenic
1176011851 20:62901353-62901375 ATGAGGGCCACGTGGACAGATGG + Intronic
1177633184 21:23752714-23752736 CAGTGGGCCTCTAGGAATGATGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1180954688 22:19736395-19736417 GTGGGGGCCTCGAGGGCAGCTGG + Intergenic
1181022252 22:20109634-20109656 CTGTGGGGCTCAAGGGCAGCAGG + Intronic
1183300140 22:37054848-37054870 GTGTGGGCACCGGGGACAGAGGG + Intronic
949741485 3:7239350-7239372 CCGTGGGCTTTGAGGAAAGACGG + Intronic
950536583 3:13582421-13582443 CTGTGGGCCTCTAGGACCTCTGG + Intronic
950870112 3:16220849-16220871 CTGTGGGCCTATAGGACATGTGG + Intronic
951532702 3:23712651-23712673 CTGTGTGAGTCGAGGAGAGATGG + Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
954795227 3:53157998-53158020 GTGTGGGCCTCAGGGACAGAGGG + Intronic
955391393 3:58524773-58524795 CTGAGGGCCTCGAGGCAGGACGG - Intronic
955905347 3:63801856-63801878 CTGGGGGCTCCCAGGACAGAGGG - Intergenic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
966424290 3:179764470-179764492 TTGTGGCCCTAGAGGAAAGAGGG + Intronic
968869517 4:3234565-3234587 CTGTGGGCATGGAGGACTCAGGG + Intronic
972709166 4:41577072-41577094 CTGTGGGACTTGAGTACACATGG + Intronic
976647320 4:87399828-87399850 CTGTGGGCATTGTGGACAGCAGG + Intergenic
981124978 4:141095234-141095256 CTGGGGGCCTCAAACACAGACGG + Intronic
982392763 4:154883968-154883990 TTGTGGGCCTCCCGGCCAGATGG - Intergenic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
985363659 4:189202991-189203013 TTGTGAACCTTGAGGACAGAAGG + Intergenic
985959299 5:3287679-3287701 CTGTGGGCCTGCAGGACACTGGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
987047240 5:14119617-14119639 GAGTGGGCCGCCAGGACAGAGGG + Intergenic
991594525 5:68288893-68288915 CTGTCCCCCTCGAGGACAGGGGG - Intronic
996228762 5:121034524-121034546 CTCTGGGTCTCTAGGAAAGATGG + Intergenic
999772537 5:154786434-154786456 CTATGGTCCTCTGGGACAGAAGG + Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002312083 5:178320862-178320884 CTGTGGGCCTGGAGGTCGCATGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003942071 6:11039308-11039330 CTGTGTGCCTGGTGAACAGAGGG - Intronic
1004406538 6:15338476-15338498 CTGTAGACATTGAGGACAGATGG + Intronic
1004410327 6:15375576-15375598 CTGTGGGTCTCCAGCAGAGAGGG + Intronic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1007749905 6:44065469-44065491 CTGGGAGCCTAGAAGACAGAGGG + Intergenic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014692328 6:124577385-124577407 CTGTGTGCTTGGGGGACAGAAGG + Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018904001 6:168064702-168064724 CCTTGGGCCTTCAGGACAGAAGG + Intronic
1018910448 6:168098438-168098460 CTGTAGGCCACGTGGACTGAAGG + Intergenic
1019313748 7:375247-375269 CCGTGGGCCTCGCGGACCGCAGG - Intergenic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1023881448 7:44323837-44323859 CTGGAGGCCAAGAGGACAGACGG + Intronic
1025008506 7:55375745-55375767 CTCAGGGCCTCCAGGAGAGAAGG - Intronic
1026422611 7:70256349-70256371 CAGTGGGCCAAGAGAACAGAGGG + Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027235576 7:76295694-76295716 CTGTGGGCTTCCAGGGCACAGGG - Intergenic
1029595523 7:101535637-101535659 CTGTGTGCCTCGAGGGCTGGAGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1036693043 8:10956763-10956785 CTGTGGCCAGTGAGGACAGAAGG + Intronic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1041192235 8:55365834-55365856 CTGTAGGGCTAGAGGACTGAAGG + Intronic
1043269124 8:78307165-78307187 TATTGGGCCTAGAGGACAGATGG - Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1049288291 8:141788368-141788390 CTGTGGGCGTGGAGCACGGAGGG - Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1052493734 9:29199315-29199337 CTGTGTGCCTCTTGGACACATGG - Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1060749636 9:126160616-126160638 ATGTGGGCCTGGGGGACCGAGGG - Intergenic
1060911284 9:127353047-127353069 CTGAGGGCTCCGAGGACACAGGG - Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061485391 9:130917992-130918014 CTGTGAGCCCCGAGCACACACGG - Intronic
1061660673 9:132128184-132128206 CTGGGGGACTCGAGGCCAGTTGG - Intergenic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061919134 9:133772532-133772554 AAGGGGGCCTTGAGGACAGAAGG - Intronic
1189330512 X:40141906-40141928 AGGTGGGCATCGAGGCCAGAGGG - Intronic
1189379053 X:40488836-40488858 GTGTGGGCCTAGAGGACTGGGGG - Intergenic
1190127708 X:47721604-47721626 CTGTGGGCCTCCAGTGCACATGG - Intergenic
1190737283 X:53263960-53263982 CTGTGGTCTTCGAGGACCCAGGG - Intronic
1196193094 X:112814324-112814346 CTGGGGGCCTCAAGGAGACAGGG - Intronic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic