ID: 1034799647

View in Genome Browser
Species Human (GRCh38)
Location 7:154046870-154046892
Sequence CTGCAGTTACAAATAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034799647 Original CRISPR CTGCAGTTACAAATAAAGGA AGG (reversed) Intronic