ID: 1034804196

View in Genome Browser
Species Human (GRCh38)
Location 7:154074221-154074243
Sequence TAACCTTCGGGGAAATAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034804189_1034804196 12 Left 1034804189 7:154074186-154074208 CCTGGAGAACATATATACTCAAC 0: 2
1: 0
2: 0
3: 10
4: 76
Right 1034804196 7:154074221-154074243 TAACCTTCGGGGAAATAGGGTGG 0: 2
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034804196 Original CRISPR TAACCTTCGGGGAAATAGGG TGG Intronic
905745767 1:40416157-40416179 CAACCTTAGGGCAAAGAGGGCGG - Exonic
913293664 1:117298296-117298318 TTCCCTTCGGGTAAATTGGGAGG - Intergenic
915718465 1:157965993-157966015 TAACCTTTGGGGAGACAGTGAGG - Intergenic
917538744 1:175893513-175893535 TAACCTTCAAGGAGATACGGAGG + Intergenic
1066273012 10:33841708-33841730 AACCCTTTGGGGAAGTAGGGGGG - Intergenic
1080811640 11:35710271-35710293 TAACCTTAGGTGAAAAAGGTAGG - Intronic
1084264536 11:67998027-67998049 TGAGCCTTGGGGAAATAGGGTGG - Intronic
1084555483 11:69873438-69873460 TAAGCTACGTGTAAATAGGGAGG - Intergenic
1085666602 11:78419862-78419884 TAACCTTTGGGGAAAGATGGGGG - Intergenic
1091681846 12:2533039-2533061 TAAGATTCGGGCAAAGAGGGAGG + Intronic
1099972334 12:89513434-89513456 TAACCTTGAAGGAAATAGAGGGG + Intronic
1114215660 14:20655941-20655963 GAACATTGGGGGAAATAGGGAGG + Intergenic
1115442389 14:33451245-33451267 TAACATAAGGGGAAATATGGGGG - Intronic
1122396164 14:101433666-101433688 TAATCTTAGGGGAAACTGGGTGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1126167373 15:45665195-45665217 TAACCTTAGGAGTAATAGGTAGG - Intronic
1126779432 15:52126011-52126033 TGACCTGCGGGCAGATAGGGAGG - Exonic
1128702248 15:69813136-69813158 TAAGCTGCAGGGAAAGAGGGAGG - Intergenic
1130019171 15:80212865-80212887 TACCCTTCAGGAAAAAAGGGAGG + Intergenic
1131492962 15:92878815-92878837 GAAGCTTCGGGGAAGCAGGGAGG + Intergenic
1134466903 16:14486945-14486967 TCACCTCCAGGGAAACAGGGAGG - Intronic
1137222465 16:46469833-46469855 AAATCTTTTGGGAAATAGGGTGG + Intergenic
1137260165 16:46820073-46820095 TAACATGCAGAGAAATAGGGAGG - Intronic
1138252438 16:55512435-55512457 TAACCTTCAGGGAAAAAAAGGGG - Intronic
1139214284 16:65112157-65112179 TAACCTTTGGGGAGATAGTTTGG + Intronic
1140039097 16:71393643-71393665 CCACCTTCAGGGAAAGAGGGCGG + Intergenic
1146785287 17:35714906-35714928 TGACCTTCTGGGAAACAGGACGG - Intronic
1154490094 18:14915114-14915136 TAACCTTGATGGAAATAGTGGGG - Intergenic
1157130140 18:44999183-44999205 TAACCTTAGGGGTAATAGTCTGG + Intronic
1157217149 18:45793750-45793772 CAAACTTCGGGGAAATAATGAGG + Intergenic
1158847554 18:61460642-61460664 TTACCTTCAGGGAAAGATGGTGG - Intronic
1167804553 19:51771694-51771716 TAACTTTAGGGGAAACAGGAGGG - Intronic
1168184260 19:54688113-54688135 TGACCTTAGGGGAAATAGACCGG - Intronic
926586032 2:14686651-14686673 TAACCCTGGAGGAAATAAGGAGG - Intergenic
929903153 2:46023417-46023439 TAAACTTCTGGGAAAAGGGGTGG - Intronic
930712893 2:54565956-54565978 TAACCTTCTGGAAAATAATGTGG + Intronic
940751448 2:157630435-157630457 CAAAGTTCTGGGAAATAGGGAGG - Intergenic
947168435 2:227286553-227286575 TTACATACGGGGAAATAGGGAGG + Intronic
1173827527 20:46057316-46057338 TAAAATTGGGGGAAAGAGGGAGG + Intronic
1178356967 21:31917509-31917531 TAATCTTCTTGGAAATATGGGGG + Intronic
1183670867 22:39271875-39271897 TAACATTAGGGGAAACTGGGAGG - Intergenic
951243892 3:20317747-20317769 CAACCTACGGGGAAATGAGGGGG - Intergenic
952686908 3:36160532-36160554 TAACCTAGAGAGAAATAGGGAGG - Intergenic
954539315 3:51383202-51383224 TAACCTACTGGGAAAGATGGAGG + Exonic
956170468 3:66429765-66429787 TAACAATAGGGGAAACAGGGTGG + Intronic
960300223 3:115994229-115994251 TCAGCTTCAGGGAAAGAGGGAGG + Intronic
961421668 3:126810680-126810702 TAACATTAGGGGAAACTGGGTGG + Intronic
965663359 3:171065368-171065390 TGACCTTTGGGGAACTGGGGTGG + Intronic
966478661 3:180380155-180380177 TAACCTTAGGGGGACTGGGGAGG + Intergenic
969226289 4:5800634-5800656 TGACCTTCGGGGAAAGAGGATGG + Intronic
969933583 4:10658588-10658610 CACCCTTTGGGGAGATAGGGAGG - Intronic
1007791719 6:44312960-44312982 TAGCTTTTGGGGAAAGAGGGCGG - Intronic
1012140620 6:95622786-95622808 TATCCTTCTTGGAAATAGGTTGG - Intergenic
1013075038 6:106763788-106763810 TAACCTTGTGGGAAGTGGGGGGG - Intergenic
1015039514 6:128699898-128699920 TAAACTACTGGGAAATAAGGTGG - Intergenic
1016123011 6:140367102-140367124 CAACCTCTGGGGGAATAGGGAGG - Intergenic
1020143323 7:5624274-5624296 AGGCCTTCGGGGAAATAGGAAGG - Intronic
1020699683 7:11464206-11464228 TAACATTGGGGGAAGCAGGGAGG + Intronic
1020878380 7:13727373-13727395 TACCCTTCTGGGAAGAAGGGTGG + Intergenic
1023604321 7:41914866-41914888 TAACCCTCGAGGAGATAAGGAGG - Intergenic
1023627465 7:42130185-42130207 TTTCCTTTAGGGAAATAGGGTGG - Intronic
1023658804 7:42452770-42452792 TAAACTTGGGGGAAAAGGGGAGG - Intergenic
1034301849 7:150023040-150023062 TAACCTTCGGGGAAATAGGGTGG - Intergenic
1034804196 7:154074221-154074243 TAACCTTCGGGGAAATAGGGTGG + Intronic
1036683422 8:10892641-10892663 AAACCATCGGGGAAATCTGGAGG - Intergenic
1045209606 8:100083049-100083071 TAACCCTCTAGGAAACAGGGAGG + Intronic
1048914604 8:139169954-139169976 AAACCTTTGGGGAAGTAGGCTGG + Intergenic
1054807883 9:69410901-69410923 CAATCTTCGGGTAAAGAGGGTGG - Intergenic
1185876414 X:3705661-3705683 AAACCTTGGGGGAAATACAGAGG - Intronic
1188048235 X:25452659-25452681 TAGCTTTCAGGAAAATAGGGAGG + Intergenic
1189466059 X:41278396-41278418 TGACCTCCGGAGAAATAAGGAGG - Intergenic
1190632885 X:52405730-52405752 TAACCTTCAGGGAAATGAGAGGG - Intergenic
1194522807 X:94939273-94939295 TATCCTTGTTGGAAATAGGGAGG - Intergenic
1201253589 Y:12085831-12085853 AAACTTTAGGGGAAAAAGGGGGG - Intergenic