ID: 1034805900

View in Genome Browser
Species Human (GRCh38)
Location 7:154088920-154088942
Sequence GAGCCACATGTGGCTCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034805897_1034805900 -4 Left 1034805897 7:154088901-154088923 CCACATTTCAGATGAACTGGAGC 0: 2
1: 0
2: 2
3: 16
4: 157
Right 1034805900 7:154088920-154088942 GAGCCACATGTGGCTCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034805900 Original CRISPR GAGCCACATGTGGCTCCGGC TGG Intronic
902035332 1:13453864-13453886 GGGCCACATGGGGCTCAGGATGG + Intergenic
902776185 1:18676457-18676479 GGGCCTCTTGTGTCTCCGGCTGG - Intronic
904311996 1:29635031-29635053 GAGCCACATGTGGCTCACCGTGG + Intergenic
905923200 1:41732622-41732644 GAGAGACATGAGGCTCCAGCTGG - Intronic
908092251 1:60698618-60698640 GAGAGACATTTGGCTCAGGCTGG + Intergenic
909582726 1:77256176-77256198 GGGCCACATGTGGCCCAGGATGG + Intergenic
912399665 1:109379381-109379403 GGGCCACATGTGGCCCAGGGTGG - Intronic
912933963 1:113986770-113986792 GGGCCACATGTGGCCCAGGATGG - Intergenic
913140287 1:115934462-115934484 GAGCCACATGTGGCCTAGGATGG - Intergenic
913653795 1:120942553-120942575 GAGGCATATGAGGCTGCGGCGGG + Intergenic
915656961 1:157368607-157368629 GACCCACCTGTGTCTCCGGACGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
919049719 1:192499052-192499074 GCTCCACCTGTGGCCCCGGCAGG - Intergenic
919799427 1:201344503-201344525 AAAACACATGTGGCTCAGGCTGG - Intergenic
921029739 1:211326881-211326903 GAGCCCCACGTGAGTCCGGCGGG + Exonic
921230112 1:213061443-213061465 GAGCCACAGGTGGCACTGGTTGG - Intronic
922435996 1:225607307-225607329 GGGCCACATGTGGCCCAGGATGG - Intronic
1062946775 10:1467508-1467530 AAGCCACATCTGGCTCAGGATGG + Intronic
1065678295 10:28202218-28202240 TATCCACATGTGGCTGCAGCTGG + Exonic
1067163082 10:43843384-43843406 GAGTCACATGTGTCTCAAGCTGG + Intergenic
1069436652 10:68390493-68390515 TAGCCACATGTGGCTCATGGCGG - Intronic
1072612202 10:97025243-97025265 GAGCCACAAGTTGCCCAGGCTGG - Intronic
1072920113 10:99569738-99569760 GAGCCACATGTGGAGGCTGCTGG + Intergenic
1074497517 10:113992782-113992804 GAGCCACCTCTGGCTCTGGGGGG + Intergenic
1076075822 10:127533123-127533145 GGGCCACATGTGGCCCAGGATGG + Intergenic
1076478316 10:130767701-130767723 GAGCCACATTTGGCTCTGCATGG - Intergenic
1076806419 10:132861435-132861457 GAGCCTCCTGGGGCTCCTGCTGG + Intronic
1077146570 11:1049180-1049202 GAGCCACACCTGCCTCCCGCAGG + Intergenic
1080873630 11:36258267-36258289 GATCCACATGTGGCTGCGCAGGG - Intergenic
1081296469 11:41395963-41395985 GGGCCACATGTGGCCCAGGACGG + Intronic
1081504596 11:43702727-43702749 GGGCCACATGTGGCCCAGGATGG + Intronic
1081530317 11:43954076-43954098 GAGCCACATGTGGCTCCTCATGG - Intergenic
1083853941 11:65382894-65382916 GAGCCAGCAGTGCCTCCGGCTGG - Intronic
1084964075 11:72734744-72734766 CAGCCACGTGTGGCTACTGCTGG - Intronic
1085439422 11:76544767-76544789 GAGCGACATTTGGCTCTGGGGGG - Exonic
1089617581 11:119703622-119703644 GACCCACAAGTGGCTGAGGCAGG + Intronic
1090215414 11:124958281-124958303 GGGCCACATGTGGCCCAGGATGG + Intronic
1092103635 12:5905222-5905244 GAGCCACCTGGGGCTCTGGCAGG + Intronic
1096242354 12:49966194-49966216 GGGCCACATGTGGCTTCTGGGGG - Intergenic
1099205251 12:79719389-79719411 GGGCCACATGTGGCTCAGGATGG + Intergenic
1100809568 12:98325051-98325073 GACCCACATGTGGGACCTGCAGG + Intergenic
1106683457 13:32031652-32031674 GATCCACCTCCGGCTCCGGCCGG - Exonic
1108708778 13:53013740-53013762 AAGCCACATGTGGCCCTTGCAGG + Intergenic
1112394609 13:99017815-99017837 AGGCCACATGTGGCCCAGGCTGG - Intronic
1113477947 13:110598666-110598688 GGGCCACATGTGGCCCAGGAGGG + Intergenic
1116079507 14:40155013-40155035 GAGCCACATGTAGCTGGGGCTGG - Intergenic
1116786666 14:49295748-49295770 GCGCAACATGTGGCTCCTCCTGG - Intergenic
1117235882 14:53774082-53774104 GGGCCACATGTGGCCCAGGAAGG + Intergenic
1119055184 14:71412224-71412246 GAGCCACATGTGGCACAGGATGG + Intronic
1119151978 14:72369120-72369142 GGGCCACATGTGGCTCAGGATGG - Intronic
1122523391 14:102362929-102362951 GAGCCACAAGTGGCAGCGGGCGG - Intergenic
1122880100 14:104686975-104686997 CAGGAACATGTGGCTCCGCCTGG + Intergenic
1122904902 14:104797136-104797158 GAGCCACCTGGGGCTCCCTCTGG + Intergenic
1123886196 15:24730399-24730421 GGGCCACATGTGGCCCAGGACGG - Intergenic
1124006104 15:25796681-25796703 GAGCCACATGTGTCCTGGGCAGG + Intronic
1127896424 15:63303686-63303708 GAGCTCTATGTTGCTCCGGCTGG + Intronic
1128891145 15:71332825-71332847 GGGCCACATGTGGCTCAAGACGG + Intronic
1128944605 15:71812028-71812050 GAGCCACCAGGGACTCCGGCCGG - Exonic
1128944988 15:71813854-71813876 GAGCCACCAGGGGCTCCGGCTGG - Intronic
1129051587 15:72785724-72785746 AAGCCACATCAGGCTCCGCCAGG - Intronic
1129737356 15:77973783-77973805 GCTGCACATGTGGCTCCTGCGGG - Intergenic
1129848716 15:78779842-78779864 GCTGCACATGTGGCTCCTGCGGG + Intronic
1130253204 15:82314104-82314126 GCTGCACATGTGGCTCCTGCAGG - Intergenic
1130256724 15:82329273-82329295 GGGCCACAGGTGGCAGCGGCGGG - Intergenic
1130403310 15:83577263-83577285 AAGCCACATGTGGCCCAGGATGG - Intronic
1130598226 15:85260715-85260737 GGGCCACAGGTGGCAGCGGCGGG + Intergenic
1132941295 16:2509712-2509734 GAGCCATGTGTGGCCCCAGCAGG - Intronic
1132997097 16:2829092-2829114 GAGCCAGACGTGGGTCCAGCCGG - Intergenic
1134012935 16:10868679-10868701 AAGGCACATGTGGCTGGGGCAGG - Intergenic
1137816814 16:51405881-51405903 GAGCCACATGTGGCCCAGGATGG + Intergenic
1138434479 16:56989450-56989472 GAGCCCCATCTGGCTCGGGCTGG + Intergenic
1139310911 16:66027286-66027308 GAGCCACATGTGGCTGTGGCTGG - Intergenic
1139653292 16:68373255-68373277 GACCCACTTGTGGCTCCCACAGG - Intronic
1141287367 16:82685028-82685050 GAGCAACATGTGTGTCTGGCCGG + Intronic
1141649403 16:85385141-85385163 GAGCCACATGGGGCTTGGGATGG + Intergenic
1142267283 16:89070530-89070552 GAGCCACATGTGGCCCCTGATGG + Intergenic
1143024911 17:3935820-3935842 GAGCCACATGTTGGCCAGGCTGG + Intronic
1143084381 17:4405117-4405139 GAGGAACATGTGGCTCCTCCGGG - Intergenic
1144646509 17:16978248-16978270 CAGCCACATGTGGCTGCTGGTGG - Intergenic
1145240289 17:21236989-21237011 CAGCCACATGGGCCTCCTGCTGG - Intergenic
1145745533 17:27316967-27316989 GGGCCACATGTGGCCCAGGATGG - Intergenic
1146622452 17:34409618-34409640 TAGCCACATGTGGACCCGGCTGG - Intergenic
1148061678 17:44841022-44841044 AATCCACATGGGGCTCAGGCAGG + Intergenic
1150202006 17:63367321-63367343 GGGCCACATGTGTCCCCGGGAGG + Intronic
1151219289 17:72600250-72600272 GAGTCACAGGTGGCTGAGGCAGG - Intergenic
1152332934 17:79684210-79684232 CAGCCATCTGTGCCTCCGGCCGG + Intergenic
1152924370 17:83080478-83080500 GGGCCGAGTGTGGCTCCGGCCGG + Intronic
1156450759 18:37265456-37265478 GAGCCACAGCTGACTCCAGCTGG + Intronic
1156803612 18:41149134-41149156 GGGCCACATGTGGCCCAGGATGG - Intergenic
1157006591 18:43590323-43590345 GAGCCACATGTCCCACCGGCAGG - Intergenic
1159250887 18:65874991-65875013 GGGCCACATGTGGCCCAGGATGG + Intronic
1161717728 19:5886344-5886366 GAGCTGCAAGGGGCTCCGGCAGG - Intronic
1161918385 19:7247918-7247940 TTGCCACATGTGGCTGTGGCTGG + Intronic
1162755723 19:12858444-12858466 GAGCCACCCGGGGCTCTGGCGGG + Intronic
1163430133 19:17262519-17262541 GAGCCACATGGGACTCAGGATGG + Intronic
1165329064 19:35131426-35131448 GAGCTGCATGTGGCTCAGGGAGG + Exonic
1165385939 19:35510749-35510771 GAGCCACATCTGGCTTCCTCGGG - Intronic
1166406121 19:42523091-42523113 GACCCACAGGTGGGTCAGGCAGG - Intronic
929858531 2:45655270-45655292 TAGCCACATGTGGCCCGGGATGG + Intronic
930949212 2:57116963-57116985 GGGCCCCATGTGGCTCAGGATGG + Intergenic
931249539 2:60517615-60517637 GGGCCACCTCTGGCTCCTGCTGG + Intronic
933444450 2:82361017-82361039 GGGCCACATGTGGCTCAGGATGG + Intergenic
934157806 2:89219428-89219450 GAGCCAGCTGTGGCTTCTGCTGG + Intergenic
934209457 2:89962998-89963020 GAGCCAGCTGTGGCTTCTGCTGG - Intergenic
938825877 2:135004863-135004885 GAGACACGTGTGGTTCCGGAAGG + Intronic
939112104 2:138020566-138020588 GAGCCCAGTGTGGCTCCAGCTGG + Intergenic
940372409 2:152918053-152918075 GCCCCACATGTGGCTCCAGTGGG + Intergenic
941226779 2:162859681-162859703 GGGCCACATGTGGCCCAGGAAGG + Intergenic
941474061 2:165926478-165926500 GAGACAAATGTGGCTGGGGCAGG - Intronic
946186621 2:217984346-217984368 AGGCCACATGTGGCTCAGGATGG + Intronic
947871553 2:233441479-233441501 GGGCCACATGTGGATGGGGCAGG + Intronic
948897483 2:240934123-240934145 GAGGCACAAGTGCCTCCGGGGGG - Intronic
1169080905 20:2797276-2797298 GGGCCACCTGGGGCTCCGGCAGG + Exonic
1170698717 20:18684098-18684120 GACCCTCATGTGGCTCCAGTAGG - Intronic
1174117600 20:48237938-48237960 GAGGCCCATGTGGCTGCAGCAGG - Intergenic
1174163912 20:48571209-48571231 GAGGCCCATGTGGCTGCAGCAGG + Intergenic
1175054665 20:56187340-56187362 GAGCCACATCTGCCTGCGACAGG + Intergenic
1175777070 20:61660107-61660129 CACCCACAGGTGGCTGCGGCCGG + Intronic
1175995810 20:62811921-62811943 GAGCCACAAGGGGCCCCTGCAGG - Intronic
1176383186 21:6123938-6123960 GGGCCACCTGTGGCTGCCGCAGG - Intergenic
1179740281 21:43414301-43414323 GGGCCACCTGTGGCTGCCGCAGG + Intergenic
1179776922 21:43670603-43670625 CAGCCACATGTGGCCCAGGATGG + Intronic
1179779400 21:43689758-43689780 GACACACGGGTGGCTCCGGCAGG - Intronic
1181958548 22:26605937-26605959 AGGCCACATGTGGCTCAGGATGG + Intronic
1182351095 22:29700439-29700461 GAGCCACTTGGGGCTCCGATGGG - Intergenic
1185269320 22:49921663-49921685 GTACCCCATGTGGCACCGGCAGG - Exonic
955141757 3:56276911-56276933 AAGCCACATGTGGCCCAGGATGG - Intronic
955726051 3:61933961-61933983 GAGCCACATGTGGGTCAGGCAGG + Intronic
955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG + Intergenic
958659699 3:97050394-97050416 GAGCTACATGTGACTCGGGCTGG + Intronic
958700970 3:97589061-97589083 GAGCCTCATGTGGCCCAGGATGG + Intronic
959574738 3:107922464-107922486 GGGCCACATGTGGCCCAGGATGG - Intergenic
962923651 3:139972815-139972837 GAGCCACCTGTGGGCCAGGCAGG - Intronic
963801710 3:149682919-149682941 GAACCTCCTGTGGCTCTGGCAGG + Intronic
966856843 3:184200091-184200113 GTGCCACATGAGGCTCTGCCTGG + Intronic
967393271 3:188978433-188978455 GAGCCACACCTGGCTGCAGCTGG + Intronic
967820590 3:193835601-193835623 CAGCCCCATGTGGCTGCCGCAGG - Intergenic
968739630 4:2320863-2320885 GGGCCGCATGTGGCTGAGGCCGG + Intronic
968764138 4:2459338-2459360 GACCCACCTGTGGCTCTGGTGGG - Intronic
969099381 4:4757381-4757403 GACCCACATGTGGCTCTAGAAGG + Intergenic
969878922 4:10157075-10157097 GAGCTACATGTGGCCCCAGGAGG + Intergenic
981194009 4:141896886-141896908 GAGCAACATGTGGCCCAGTCAGG + Intergenic
981881199 4:149614800-149614822 GGGCCACATGTGGCCCAGGATGG - Intergenic
982160658 4:152565701-152565723 GGGCCGCATGTGGCTCAGGATGG + Intergenic
985559065 5:572932-572954 GGGCCACATGTGGCCCAGGATGG + Intergenic
985683831 5:1271419-1271441 GGGCCACCTGTGGGTCCAGCTGG + Intronic
993548983 5:89250154-89250176 GGGCCACATGTGGCCCAGGATGG - Intergenic
993719804 5:91311223-91311245 GGGCCACATGTGGCCCAGGATGG - Intergenic
996563429 5:124855190-124855212 GGGCCACATGTGGCCCAGGATGG - Intergenic
996833394 5:127764813-127764835 GGGCCACATGTGGCCCAGGATGG - Intergenic
997304972 5:132830294-132830316 GCGCCGCGTGTGGCGCCGGCGGG - Intronic
997694542 5:135850862-135850884 CAGACACATCTGGCTCCGGCCGG - Intronic
998949821 5:147382044-147382066 GGGCCACATGTGCCTCAGGATGG - Intronic
999777578 5:154823354-154823376 GAGCCAGCTGTGCCTCAGGCAGG + Intronic
1002100572 5:176855660-176855682 GTGCCACTTGTGCCTCTGGCTGG - Intronic
1006633112 6:35443403-35443425 GAGTGACATGTGGCTCCGAATGG - Intergenic
1006633113 6:35443410-35443432 GAGCCACATGTCACTCTGCCAGG + Intergenic
1008394412 6:50990318-50990340 GGGCCACATGTGGCCCAGGATGG + Intergenic
1009666213 6:66684439-66684461 AAGACACAAGTGGGTCCGGCGGG - Intergenic
1010015770 6:71103880-71103902 GAGGCACATGGGGCCCAGGCAGG + Intergenic
1014927035 6:127284801-127284823 GGGCCACATGTGGCCCAGGATGG + Intronic
1018582110 6:165316503-165316525 GAGGCCCATGTGGCTCCCGGGGG + Intergenic
1019180490 6:170184540-170184562 GCCCCTCCTGTGGCTCCGGCGGG - Intergenic
1019307403 7:342367-342389 GGGCAACATGTGGCCCGGGCAGG - Intergenic
1021139530 7:17006930-17006952 GGGCCACATGTGGCTCAGGATGG + Intergenic
1022118753 7:27286377-27286399 GGGCCACATGTGGGTCGGGACGG + Intergenic
1022796041 7:33732030-33732052 GAGCCACGTGAGGCTCAGGAGGG - Intergenic
1023164891 7:37333975-37333997 GAGCCAAAGGTAGCTCCTGCAGG + Intronic
1023862445 7:44224680-44224702 GAGCCAGAGGTGGCTGCGGGAGG + Intronic
1024142682 7:46478212-46478234 TAGCCACATGTGGACCCAGCAGG + Intergenic
1024529922 7:50383186-50383208 GAGCCACACGGGGCTCAGTCTGG - Intronic
1024640591 7:51325526-51325548 GAGACTCCTGTGGTTCCGGCAGG + Intergenic
1026906894 7:74068024-74068046 GAGCCATATCTGGCTCAAGCAGG + Intronic
1030306057 7:108019766-108019788 GAGCCTCATGAGGCTCAGGCTGG - Intergenic
1030307992 7:108038575-108038597 GGGCCACATGTGGCCCAGGACGG + Intronic
1030895984 7:115060307-115060329 GAACCACATGTGGCAGGGGCAGG + Intergenic
1031087775 7:117320763-117320785 GAGCTACAGGTGGCTCCTCCAGG - Exonic
1031421538 7:121557626-121557648 GAGACACAAGTGGCTCAGGATGG - Intergenic
1033156835 7:138964198-138964220 GGGCCACAGGTGGCTCTGACTGG + Intronic
1034300150 7:150008390-150008412 GAGCCACGTGCGGCTCCGGCTGG - Intergenic
1034415903 7:150964095-150964117 GAGCCACATTTGGCTGTGGCAGG + Intronic
1034805900 7:154088920-154088942 GAGCCACATGTGGCTCCGGCTGG + Intronic
1035697973 8:1614599-1614621 GTGCCACAGGGGGCTCCGCCTGG - Intronic
1039830008 8:41205767-41205789 GGGCCACATGTGGCCCAGGATGG - Intergenic
1042168818 8:65973041-65973063 GCCCCACATGTGGCTCCAGTAGG + Intergenic
1043576179 8:81660200-81660222 GGGCCACATGTGGCTCAGGATGG - Intronic
1045367030 8:101485728-101485750 GGGCCACATGTGGCCCAGGATGG + Intergenic
1045733240 8:105266166-105266188 GGGCCACATGTGGCTCAGGATGG + Intronic
1046009166 8:108525515-108525537 GAGCCACATGTGGATCAGGAAGG - Intergenic
1048562401 8:135555293-135555315 GTGCCACATGTGGCCCAGGAAGG + Intronic
1048941031 8:139401027-139401049 CAGCCACATGTGACTCAGGCAGG + Intergenic
1049071266 8:140357698-140357720 GAGCCACCCGTGTCTCCTGCTGG - Intronic
1049098496 8:140562854-140562876 GAGCCACATGTGGCAGTGGCTGG + Intronic
1049354290 8:142179968-142179990 GGGCCACCTGTGGCCCAGGCTGG - Intergenic
1050248075 9:3713120-3713142 GACCCACATCTGGCTAGGGCTGG - Intergenic
1058586665 9:106514466-106514488 GGGCTACATGTGGCTCAGGAAGG - Intergenic
1058797591 9:108513427-108513449 GGGCCACATGTGGCCCAGGATGG + Intergenic
1059703036 9:116794455-116794477 AAGCCATATGTGGCTCAGGATGG - Intronic
1059774088 9:117457586-117457608 GAGCCCCTTGTGTCTCTGGCAGG + Intergenic
1060405058 9:123368917-123368939 GAGCCACAGGTGGCCCAGGAAGG - Intronic
1062030434 9:134359714-134359736 GAGCCACGTGTGGCCCTGGCGGG + Intronic
1062346694 9:136118400-136118422 GACCCGGAAGTGGCTCCGGCAGG - Intronic
1187527556 X:20067891-20067913 GAGCCACATCTGTGTCCAGCTGG - Intronic
1189983449 X:46532931-46532953 GAGCCACATGCGGCCCAGGATGG - Intronic
1190069404 X:47267014-47267036 GGGCCACATGTGGCCCAGGACGG + Intergenic
1193418376 X:81252692-81252714 GGGCCACATGTGGCCCAGGACGG - Intronic
1197949663 X:131880868-131880890 GATCCCCATGTGGCTTCTGCTGG - Intergenic
1198230801 X:134687308-134687330 GGGCCACATGTGGCCCAGGATGG + Intronic
1198672595 X:139097384-139097406 GAGCCACATGTGGCCCAGGATGG - Intronic