ID: 1034811074

View in Genome Browser
Species Human (GRCh38)
Location 7:154132703-154132725
Sequence TTTTTGATGAATAAGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 2, 1: 0, 2: 2, 3: 38, 4: 429}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034811074_1034811084 23 Left 1034811074 7:154132703-154132725 CCCTATTCCTTATTCATCAAAAA 0: 2
1: 0
2: 2
3: 38
4: 429
Right 1034811084 7:154132749-154132771 TATCTGGCTTTATCCCTCACTGG No data
1034811074_1034811081 7 Left 1034811074 7:154132703-154132725 CCCTATTCCTTATTCATCAAAAA 0: 2
1: 0
2: 2
3: 38
4: 429
Right 1034811081 7:154132733-154132755 ATTGGGTGGCCCTGATTATCTGG No data
1034811074_1034811085 24 Left 1034811074 7:154132703-154132725 CCCTATTCCTTATTCATCAAAAA 0: 2
1: 0
2: 2
3: 38
4: 429
Right 1034811085 7:154132750-154132772 ATCTGGCTTTATCCCTCACTGGG 0: 2
1: 0
2: 1
3: 15
4: 173
1034811074_1034811078 -10 Left 1034811074 7:154132703-154132725 CCCTATTCCTTATTCATCAAAAA 0: 2
1: 0
2: 2
3: 38
4: 429
Right 1034811078 7:154132716-154132738 TCATCAAAAAATCTTCCATTGGG 0: 2
1: 0
2: 1
3: 30
4: 309
1034811074_1034811079 -7 Left 1034811074 7:154132703-154132725 CCCTATTCCTTATTCATCAAAAA 0: 2
1: 0
2: 2
3: 38
4: 429
Right 1034811079 7:154132719-154132741 TCAAAAAATCTTCCATTGGGTGG 0: 2
1: 0
2: 1
3: 19
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034811074 Original CRISPR TTTTTGATGAATAAGGAATA GGG (reversed) Intronic
901419567 1:9141696-9141718 TTATTCATGAATAAAGAAAATGG - Intergenic
904623690 1:31790433-31790455 TTTTTGTTCAATAAAGAATTTGG - Exonic
908017699 1:59861601-59861623 TTTTCTATGGATAAGGAATATGG + Intronic
908285586 1:62595571-62595593 CTTTTGATGACTTAGGATTAAGG - Intronic
908494805 1:64683767-64683789 TTTATGATGCATTTGGAATATGG - Intronic
909877372 1:80824714-80824736 TTTTTAATGAATGAGGAAACAGG + Intergenic
910028237 1:82683993-82684015 TTTTGGATGAGTTAGGAATCAGG + Intergenic
910467557 1:87516384-87516406 TTTATGATGGATCAGGAATCAGG + Intergenic
911836911 1:102631039-102631061 TTTTAAATGAATAATGACTAGGG + Intergenic
912197769 1:107419609-107419631 TTTTTTTTGAAGAAGGAAGAAGG - Intronic
916091137 1:161308779-161308801 ATCTTGATGTATAAGGAAGAGGG - Intronic
917065434 1:171087650-171087672 TTTTGGATGCATGAGGAATGGGG - Intergenic
917196261 1:172469106-172469128 CTGTTGATGAAAATGGAATATGG + Intergenic
918467689 1:184838133-184838155 TTTTATATGAAAAAGGTATAAGG - Intronic
918610059 1:186479219-186479241 TTTTTTTTAAATAAAGAATACGG + Intergenic
919722943 1:200860159-200860181 TTATTAATGCAGAAGGAATATGG + Exonic
919784328 1:201249726-201249748 TATTTGATAAATAATGAATAGGG + Intergenic
919797168 1:201327850-201327872 ATTTTGCTGAATAGGGAATCAGG + Intronic
920571298 1:207019990-207020012 AAATTAATGAATAAGGAATAAGG + Exonic
921997532 1:221437489-221437511 CTTTTGATGAACAAAGAAAATGG - Intergenic
922168124 1:223132604-223132626 TTTTTGGTGAATCAGGAGAAAGG + Exonic
922192215 1:223329298-223329320 TTCTTGATCAATAATGAACAAGG + Intronic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
922794652 1:228334080-228334102 TTTTTGAACAATAAGGAAGTAGG - Intronic
923297029 1:232603881-232603903 TTTTTGACGACTAAGTAAAAGGG + Intergenic
923805498 1:237252848-237252870 TTTATAATAAATAAAGAATATGG - Intronic
923849096 1:237773563-237773585 TTATTGATGAACAAGGACAACGG + Exonic
923879656 1:238089612-238089634 TTTCTGATAAATAAGAAATCTGG + Intergenic
924370644 1:243346533-243346555 TTTTTGATGTATACAAAATAGGG + Intronic
924651773 1:245935369-245935391 TTTTTGATGAAACAGGCATGAGG - Intronic
1063525313 10:6779143-6779165 TTTTTGATGCATGATGCATATGG - Intergenic
1063762926 10:9100597-9100619 ATTTTGAGGAATAAGGCACATGG + Intergenic
1064640601 10:17411787-17411809 TTTCAGATGAATAGGAAATAGGG - Intronic
1064782798 10:18860933-18860955 GTTTTGATGAATAACTAAAATGG - Intergenic
1064926568 10:20575898-20575920 TGTTAGATAAATAAGGGATATGG + Intergenic
1066316299 10:34250405-34250427 TTATTGATGAAAAATGAATAAGG + Intronic
1068115959 10:52738207-52738229 TCTTTCAGGAAGAAGGAATAAGG + Intergenic
1068219358 10:54024833-54024855 TTTTTGGTGAAAAAGGGAGAAGG - Intronic
1068445827 10:57121557-57121579 TTTGGGATTAATAAGTAATATGG - Intergenic
1068468357 10:57426156-57426178 TATTTGATTATTAAAGAATATGG + Intergenic
1068919927 10:62472836-62472858 TTGTTGATGAATGGGTAATATGG + Intronic
1069165958 10:65159161-65159183 TTTTAAATTAATAAGGCATAGGG + Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1070854973 10:79600581-79600603 TTTTTAATGTATAAGAGATAGGG - Intergenic
1071167088 10:82819400-82819422 CTTTTGATGAATAAGTAAATGGG - Intronic
1072281532 10:93870195-93870217 TTTTTGATGAATTATGAAGCTGG - Intergenic
1073812933 10:107170989-107171011 ATTTTGCAGATTAAGGAATAGGG - Intergenic
1073855254 10:107666104-107666126 TTTTTCTTGATTAAGGAATTTGG - Intergenic
1073882220 10:107996264-107996286 TTTTTGAGGATTAAGTAAAATGG - Intergenic
1073890334 10:108093538-108093560 TTATTGAAAAATAAGGTATAAGG - Intergenic
1075258819 10:120945599-120945621 TATTTGATGAATGATGAATAAGG + Intergenic
1075879776 10:125840762-125840784 TGTTTGATGAATAACTAATAAGG + Intronic
1078490005 11:11759843-11759865 TATTTGATGAATAAAGATTTGGG - Intergenic
1078728205 11:13951685-13951707 TTTATGAAAAAGAAGGAATAAGG + Intergenic
1079748739 11:24167469-24167491 TTTTTGATAAATTATAAATAGGG + Intergenic
1079797615 11:24825824-24825846 TTTCTAATCAATAAGGAAAATGG - Intronic
1079849187 11:25509328-25509350 TTTTTGATAAATAAGGTAAGAGG + Intergenic
1080816567 11:35763416-35763438 TATTTGAGGAATAAGGGAGAAGG + Intronic
1081025738 11:38012272-38012294 TTTTAGATGAATAAATATTAAGG + Intergenic
1081296243 11:41393186-41393208 ATTTTGATGTATAAGAAATTTGG - Intronic
1081318001 11:41654868-41654890 TTTTTGCTGAATGTGGAATTTGG + Intergenic
1081385652 11:42469129-42469151 TATCTGATGCATAAGCAATAAGG + Intergenic
1082040095 11:47677752-47677774 TATTTGATGAATAAATAAAATGG - Intronic
1085549059 11:77349882-77349904 TTATTTATCAAAAAGGAATATGG + Intronic
1085932305 11:81098228-81098250 TTTTTAATGAAAGAGGAATCTGG + Intergenic
1086052444 11:82609259-82609281 TTTTTGGAGAGAAAGGAATAAGG + Intergenic
1086157694 11:83685949-83685971 TTGATGATGAATAAGGCATGGGG - Intronic
1086208930 11:84294670-84294692 TTATTGCTGAATAAAAAATATGG - Intronic
1086225577 11:84504479-84504501 TCTTTGATAAATAAGTAATAAGG - Intronic
1086363270 11:86081346-86081368 TTTTTCATGAATCATGCATAGGG + Intergenic
1087636116 11:100703279-100703301 TTTTTGATGAAAATAGAGTATGG - Intronic
1087790104 11:102396624-102396646 TTTTTTATGCTTAAGAAATATGG + Exonic
1088801120 11:113308211-113308233 TTCTAGATGGAAAAGGAATAAGG - Intergenic
1089067596 11:115673686-115673708 TTTTTAAAGAAAAAGAAATATGG + Intergenic
1090138207 11:124222854-124222876 TTCCTGATGAATAATGAATTTGG + Intergenic
1090498348 11:127236583-127236605 TTTTTAATGACTAAGCAATGAGG + Intergenic
1090703159 11:129314536-129314558 TTATAGATGAATGAGGAACAGGG - Intergenic
1090793717 11:130115568-130115590 TTTTTGCTGATCAATGAATATGG - Intronic
1091009604 11:131986836-131986858 TTATTTAAGACTAAGGAATAAGG - Intronic
1092580667 12:9837574-9837596 TGTTTCATGAATAAGGACTTTGG - Intronic
1095159036 12:38893730-38893752 TTTGTGAAGAAAAAGTAATAGGG - Intronic
1095228808 12:39709274-39709296 CTTTTGATGAATCAGTAATTTGG + Intronic
1095611329 12:44132077-44132099 TTATTGATGGATAAGAATTAGGG + Intronic
1095849184 12:46782488-46782510 TATTTGTTGAATTAGGCATAGGG + Intronic
1098347165 12:69518005-69518027 TTTTTTATGTATAAGGAATGAGG + Intronic
1098774175 12:74590029-74590051 TTCTTGTTGAATATTGAATAAGG + Intergenic
1098938354 12:76506099-76506121 TTATTGATGAATCAGATATAAGG + Intronic
1099083836 12:78220378-78220400 TGTTTGGTGAATAAGGGATGGGG - Intergenic
1099354311 12:81614582-81614604 ATCTTGATGAGTAAGAAATAAGG - Intronic
1100011621 12:89960783-89960805 TGTTTAATGAATAAGGAATTAGG + Intergenic
1100013869 12:89985265-89985287 TTTCTGATTAATAAGGGGTATGG + Intergenic
1100210305 12:92392388-92392410 CTTATGATGAACAAAGAATAGGG + Intergenic
1100470014 12:94882865-94882887 TTTTTAATGATAAATGAATATGG + Intergenic
1101018147 12:100523764-100523786 TATTTGCTGAATAAAGAATTGGG - Intronic
1101696440 12:107131746-107131768 TTTTTTACAAATATGGAATAAGG + Intergenic
1102191081 12:110988745-110988767 TCTTTGATGAATAAAAAATGGGG + Intergenic
1104199426 12:126574094-126574116 TGTTTGATAAATAAGAAATAAGG - Intergenic
1105314015 13:19240611-19240633 GTGTAGATGAATAAGAAATATGG + Intergenic
1106641673 13:31590476-31590498 GTTTTAATGATTAAGAAATAGGG - Intergenic
1106775697 13:33006890-33006912 CTTTTGTTGATTAAGGACTAAGG - Intergenic
1107991745 13:45824793-45824815 TTTTTAATAAATGAGGAATAAGG - Intronic
1108130938 13:47299697-47299719 TTTTAGATGAATAAACAATGTGG - Intergenic
1109010103 13:56929482-56929504 TTTTTGCTGAGTATTGAATATGG - Intergenic
1109182145 13:59226318-59226340 TTTTTGGTGAATGAGGAGTGAGG - Intergenic
1109226159 13:59698673-59698695 TTTTTAAGGAAGCAGGAATATGG - Intronic
1109469189 13:62782791-62782813 TATTTTATAAATAAGTAATATGG + Intergenic
1109671693 13:65616344-65616366 TGTGTCATGAATAATGAATATGG - Intergenic
1111040958 13:82746851-82746873 TTTTTGATGAATTAGCACAAAGG - Intergenic
1111820049 13:93202558-93202580 TATCTGATGAATGAGAAATAAGG - Intergenic
1112548045 13:100390967-100390989 TTTTTGATGATTAAAGAATAAGG + Intronic
1112820489 13:103328921-103328943 TTTTTCATCAGGAAGGAATAAGG + Intergenic
1113314483 13:109163779-109163801 ATTTTGCTGAAGAAGGAATTAGG - Intronic
1114061402 14:19020046-19020068 TTCTTGAGGCAAAAGGAATATGG - Intergenic
1114100846 14:19379918-19379940 TTCTTGAGGCAAAAGGAATATGG + Intergenic
1114667139 14:24385350-24385372 TTATAAATGTATAAGGAATAAGG + Intergenic
1116300115 14:43168929-43168951 TTTATGATTTATAAGGAATCAGG - Intergenic
1116634024 14:47370931-47370953 CTTTTGATGAATTTGTAATAAGG - Intronic
1117476240 14:56097923-56097945 TTTTTGATGAACAAGAAATATGG - Intergenic
1119427483 14:74545270-74545292 TATTTGATGGATGAGGAAAATGG - Intronic
1119905730 14:78300080-78300102 TTTTTCATGTTGAAGGAATAAGG - Intronic
1120089999 14:80320516-80320538 TTTTTTATGTAGAAGGAAAATGG + Intronic
1120375590 14:83702536-83702558 TATTTAATGAATAAAGCATAAGG + Intergenic
1120380119 14:83766620-83766642 CTTAGGATGAATAAGGAATTAGG - Intergenic
1120851413 14:89175509-89175531 TGTTTGATAAATAAGTAACATGG - Intronic
1120934353 14:89879413-89879435 TTTAAATTGAATAAGGAATATGG - Intronic
1121070182 14:91012206-91012228 TTATTGAGGAATAGGGAATAAGG - Intronic
1123495807 15:20824903-20824925 TTCTTGAGGCAAAAGGAATATGG + Intergenic
1123552293 15:21393995-21394017 TTCTTGAGGCAAAAGGAATATGG + Intergenic
1123588537 15:21831392-21831414 TTCTTGAGGCAAAAGGAATATGG + Intergenic
1124993824 15:34702975-34702997 TTAATGTTGAATAATGAATAAGG - Intergenic
1124997706 15:34739917-34739939 TTTTTAAGGAATGAGGAAAAGGG - Intergenic
1125305161 15:38303960-38303982 TTTATGATTAATAAGTAATTAGG + Intronic
1125427904 15:39568064-39568086 TTTTTAATGAAGAGGGTATAAGG - Intergenic
1126219204 15:46192970-46192992 TATTTCCTGAATAATGAATATGG + Intergenic
1128476232 15:67999181-67999203 TTTTGGAGGAATGAGGAATTGGG + Intergenic
1128615710 15:69107389-69107411 TTTTTGACTAGTAAGGAAGAGGG + Intergenic
1128855906 15:71014914-71014936 TTTTTTCTGAATTGGGAATAAGG - Intronic
1128873472 15:71182771-71182793 TTTTTGATGATGTAGGAATTTGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130391965 15:83464670-83464692 TTGCTGATGAATTGGGAATAAGG - Intronic
1130566350 15:84999422-84999444 TTATTGTTCAATAAGGAATATGG - Intronic
1131143242 15:89994887-89994909 TTTTTGAAGAATAATGACTTGGG - Intergenic
1131665629 15:94568420-94568442 TTTGGGATGAAAAAGGAATATGG + Intergenic
1131887407 15:96931765-96931787 TTTTATATGAAAAAGGAACATGG + Intergenic
1202960641 15_KI270727v1_random:121228-121250 TTCTTGAGGCAAAAGGAATATGG + Intergenic
1133618871 16:7507050-7507072 TATTTTATGAATAAGGAAACTGG + Intronic
1134502930 16:14783220-14783242 AATTTGATGTATAAGGAAGAAGG + Intronic
1134577634 16:15345676-15345698 AATTTGATGTATAAGGAAGAAGG - Intergenic
1135882886 16:26276280-26276302 CTTTTACTGAATTAGGAATAGGG - Intergenic
1138906161 16:61337215-61337237 TTTGTTATAAATAAGTAATATGG + Intergenic
1139570684 16:67810001-67810023 ATGCTGGTGAATAAGGAATATGG - Intronic
1143244478 17:5471515-5471537 TTTTTGAGGAATCAGGAACAAGG + Exonic
1144001759 17:11061749-11061771 TTTTTGATGGATATTGAAAAAGG - Intergenic
1144030493 17:11317410-11317432 TTTATGATCAATAAGAAATCAGG - Intronic
1144354988 17:14436722-14436744 TTTTGGAAGAAAAAGGAAGATGG + Intergenic
1144768694 17:17747048-17747070 TCTTTGATTAATAAGAAATGGGG - Intronic
1146503195 17:33381931-33381953 TTTTTGATGCATAAGAACTCAGG + Intronic
1146563708 17:33893725-33893747 TATTTTATAAATAAGGATTATGG - Intronic
1147517864 17:41139221-41139243 TTTTTTATGAATATGGAGAAGGG - Intergenic
1148499219 17:48076725-48076747 TTATTGTTTAATTAGGAATATGG - Intronic
1149295287 17:55256597-55256619 TCATTGATAAATAAGGAAAAAGG - Intergenic
1150601113 17:66651866-66651888 TTTGTAATTAATAAGGAATCTGG + Intronic
1153255778 18:3169373-3169395 ATTTTTATGAATAATGGATATGG - Intronic
1154453209 18:14497357-14497379 TTCTTGAGGCAAAAGGAATATGG + Intergenic
1155922961 18:31622052-31622074 TTTTTGAGATAAAAGGAATAAGG + Intergenic
1156097631 18:33554093-33554115 TTTTTAATAAAAAAGGAAAATGG + Intergenic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156350793 18:36299203-36299225 GTTTTCAGGAATAAGGAATGGGG + Intronic
1156520531 18:37718860-37718882 TTTATTAGGATTAAGGAATAAGG - Intergenic
1157453252 18:47803660-47803682 TTTTTTAAAAATAAGGGATAAGG - Intergenic
1157837042 18:50914125-50914147 TTTCTGATGAAAAAGAAAAAAGG + Intronic
1158528748 18:58239266-58239288 TTTTTGCTGTAAAAGGAAGATGG - Intronic
1159801184 18:72901339-72901361 TCTTTAATGAAAAAGAAATATGG - Intergenic
1160365195 18:78318806-78318828 ATTTTGATGATGAAGGAATTTGG + Intergenic
1165471634 19:36007721-36007743 TTTTTAATAAAAAAGAAATATGG + Intronic
1168663473 19:58184813-58184835 TTTCAAATGAATAAGAAATAGGG + Intronic
925381971 2:3434760-3434782 TTTTTGATGAATTGGGATTAGGG + Intronic
926330335 2:11820113-11820135 ATTTTCATGAAGTAGGAATATGG + Intronic
928325563 2:30316890-30316912 ATTTTCATTAATAAGGAATGTGG + Intronic
928461130 2:31473684-31473706 TTGTTGATGAATAAGATACAGGG + Intergenic
928498349 2:31859365-31859387 TTATTAAAGATTAAGGAATATGG - Intergenic
928697512 2:33864188-33864210 TTTTTGATGAATGAAAAAAATGG - Intergenic
928835203 2:35535794-35535816 ATTTAGATGAATAAGATATATGG - Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930487825 2:52030337-52030359 ATTTTGTTGAATATGGAATATGG + Intergenic
930630669 2:53751185-53751207 TTTTTGGTGAATAAGGGAAGAGG + Intronic
930854315 2:55996316-55996338 TTGATGATGAATAATGAATATGG + Intergenic
930937564 2:56973270-56973292 TTTCTGAGCAATAATGAATAAGG + Intergenic
931578455 2:63746380-63746402 TTTTTGAACAATATGAAATATGG + Intronic
931670900 2:64645992-64646014 TTTTTAATTTATAAGGAAAAAGG + Intronic
933136643 2:78743682-78743704 GTTTTTATGAAAGAGGAATAAGG - Intergenic
933981971 2:87557670-87557692 ATTTAGATCAATAAAGAATAAGG + Intergenic
935327455 2:101949609-101949631 TTGTTTTTGAATATGGAATAAGG - Intergenic
936311867 2:111393147-111393169 ATTTAGATCAATAAAGAATAAGG - Intergenic
936659674 2:114528819-114528841 TTGATGATGAATCAGGAAGAAGG - Intronic
936687406 2:114843931-114843953 TTTTTGATGAAAAGGGGATTGGG - Intronic
937510816 2:122593136-122593158 AATCTGATGAATAAGGAATATGG + Intergenic
937629168 2:124080064-124080086 TTTTTGTTTAATATGGAACAAGG + Intronic
937776117 2:125777718-125777740 GTTTGCATGAATAATGAATATGG + Intergenic
938262269 2:129904552-129904574 TTTTTAAGGAAGTAGGAATATGG - Intergenic
938478771 2:131640380-131640402 TTCTTGAGGCAAAAGGAATATGG - Intergenic
938559530 2:132459422-132459444 CTTTTGAGGAACAAGGAATCTGG - Intronic
939272483 2:139958625-139958647 ATTTGGATGATTAGGGAATAGGG + Intergenic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
939562265 2:143746279-143746301 TTTTTTTTGAAAAAGGAATTTGG - Intronic
939808116 2:146799545-146799567 CATTTGATGAAAAAGGAATTTGG - Intergenic
940221434 2:151355948-151355970 TTTTTGATAAATGAGAACTAGGG + Intergenic
940482502 2:154252690-154252712 CTTTTGCTGTATAAGGTATATGG + Intronic
940594995 2:155779904-155779926 TTCTTGATAAAAAAGTAATAAGG - Intergenic
942422516 2:175822439-175822461 TTATTTATGAATAAATAATATGG + Intergenic
942705904 2:178771763-178771785 CTTTTGAAGAAGAAGGAATTGGG - Intronic
943210392 2:184957289-184957311 TTTTTCATGAATAAAGCACAAGG + Intergenic
943279385 2:185911804-185911826 TTTTTAAGGAATAAGGAAAAGGG - Intergenic
945289641 2:208114659-208114681 CTTATTAGGAATAAGGAATAAGG - Intergenic
946041083 2:216783428-216783450 TATTTGTTGAATAAACAATAAGG + Intergenic
1168736839 20:147639-147661 TTCTTGTTGAATAAGTAAGAGGG + Intergenic
1168951779 20:1807136-1807158 ATTTTGTTGACTAAGGAAGAAGG + Intergenic
1174569117 20:51488620-51488642 TTTCTGATGGACAAGGGATAGGG - Intronic
1174874579 20:54212858-54212880 ATTTTGATGAATATGGAAGTTGG - Intronic
1174907793 20:54570988-54571010 TTTATGATGAATAAGACATCTGG + Intronic
1174972945 20:55297761-55297783 TGTTTGGTCAATGAGGAATATGG + Intergenic
1176442820 21:6790924-6790946 TTCTTGAGGCAAAAGGAATATGG - Intergenic
1176741805 21:10611627-10611649 TTTTTAATGAATAAAAATTAAGG - Intergenic
1176820975 21:13655926-13655948 TTCTTGAGGCAAAAGGAATATGG - Intergenic
1177492830 21:21849658-21849680 TTTTTGAAGAATAGAGAAGATGG - Intergenic
1177611086 21:23449630-23449652 TTTTTGATGTATGAGGAAACTGG - Intergenic
1177907764 21:26992797-26992819 TTTTTGTTGAATTAGGCAAAAGG - Intergenic
1178080755 21:29062231-29062253 TTTTTGATAGAAAAGGAAGATGG - Exonic
1179264834 21:39794174-39794196 TCCTTGATGATTAAGGATTATGG + Intronic
1179453819 21:41484612-41484634 TTTTATATGAATAATCAATATGG + Intronic
1180479890 22:15742644-15742666 TTCTTGAGGCAAAAGGAATATGG - Intergenic
1180752577 22:18134858-18134880 TTTTTCATGAATATGCAGTATGG + Intronic
1182981536 22:34676219-34676241 TATTTGTTGAATAAATAATATGG - Intergenic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1185261391 22:49866380-49866402 TTTTTAATGAAAAAGAAATGAGG - Intronic
949244655 3:1912498-1912520 TTTTTGTTTAAAAAAGAATAAGG + Intergenic
950061782 3:10077855-10077877 TTTTTAATTAATAAGAAATGAGG - Intronic
950728492 3:14935501-14935523 ATTTTCATGGATAAGGAAAAAGG - Intergenic
950945373 3:16940319-16940341 TTTTTGATTAAAAAGGACGAGGG - Intronic
951081368 3:18454003-18454025 TTTTTTAGAAATAAGGAAAATGG + Intergenic
951979391 3:28548823-28548845 TTTTTAAGGAATAAAGAATAGGG - Intergenic
952142644 3:30497195-30497217 CTTTTGATGAATGAAGAAAATGG - Intergenic
953178778 3:40577563-40577585 ATTTTGATGAAAAATGAATAAGG - Intergenic
953565025 3:44024889-44024911 ATTTTGATGAATAATTAAAAGGG + Intergenic
955093374 3:55773680-55773702 TATTCAATGAATATGGAATATGG + Intronic
956467409 3:69533117-69533139 TTTTTTATAAATAATGATTAAGG + Intronic
956988514 3:74733430-74733452 TTCTAGATGAATGAGGCATATGG + Intergenic
957023113 3:75146738-75146760 ATTTTGAAGAATAAAGAATGTGG - Intergenic
957335255 3:78819403-78819425 TCTTTGTAGAATATGGAATATGG + Intronic
958625756 3:96622342-96622364 TTTTTGACAAATAATGACTAAGG - Intergenic
958733254 3:97980456-97980478 TGTTGTAGGAATAAGGAATAAGG - Intergenic
959428216 3:106219574-106219596 TTTTTTTTGTATAAGGTATAAGG + Intergenic
960310845 3:116114426-116114448 TTTGTGTTGTATAAGGAACAAGG + Intronic
960659844 3:120045490-120045512 TTTTTTTTAAATAAGGAAGAGGG - Intronic
960849717 3:122039519-122039541 TTTTTGCTGCATAAAGAACATGG - Intergenic
961096422 3:124160363-124160385 GTTTTTATGAAGAAGGAATCTGG + Intronic
962413864 3:135164959-135164981 TTTCTGATAAATAATGAAAAAGG - Intronic
963489458 3:145981336-145981358 TTATTGCTGAATAAGAAACAAGG + Intergenic
963737346 3:149034777-149034799 TTATTGATGAAGGAGGAAAAAGG + Intronic
964506232 3:157403026-157403048 TTTTTGATAAATAATGAAGAAGG + Intronic
966365694 3:179185023-179185045 TTTTTGATGAAGAAAGACTGTGG + Intronic
966812362 3:183858514-183858536 TTTTTGATCAAGAAGGAGCAAGG - Intronic
967258180 3:187614520-187614542 TTTTGGATTAACAAGTAATAAGG - Intergenic
967480920 3:189972567-189972589 ATTTTGAGGAATCAGGAACATGG - Intronic
969505085 4:7581180-7581202 TTTTTAATGAAAAAGGAAAAAGG + Intronic
973700955 4:53536620-53536642 CTTTTTATGAAGAAGCAATATGG - Intronic
974756379 4:66213915-66213937 TTTTGGATGAATATAGAATTTGG - Intergenic
974900387 4:67989240-67989262 TGTTGGATGAATAAGTAATTAGG + Intergenic
974974860 4:68878664-68878686 TTATTGACTAATAAGGAATAAGG + Intergenic
974981793 4:68966393-68966415 TCCTTGATGTATAAGGATTATGG + Intergenic
975814236 4:78201315-78201337 TTTTTGATGAATTAGAAGTTAGG + Intronic
975919182 4:79363588-79363610 TTCTTTATGCATAAGGATTAGGG + Intergenic
976881354 4:89929207-89929229 TTTTTAATGAATAAAGCAAAAGG - Intronic
976937154 4:90650287-90650309 TTTTTGAGCAAAAAGGAAGAAGG + Intronic
977283634 4:95073417-95073439 TTTTTTATGAAAAAGGTTTATGG + Intronic
977645765 4:99410059-99410081 TTTTTGATAAATGATAAATAAGG - Intergenic
977680359 4:99792106-99792128 TTTTCGATGTATAAATAATAAGG + Intergenic
978218136 4:106233121-106233143 TATTTAATGAACAAGGATTAAGG - Intronic
978321833 4:107504907-107504929 TTTTTCATGAAATATGAATATGG + Intergenic
978447811 4:108797362-108797384 TCTTTGAGGAATAATGAAGAGGG + Intergenic
978737554 4:112101064-112101086 ACTTTGAAGAATATGGAATATGG + Intergenic
978753428 4:112278025-112278047 TTTCTGATGGAGAAGGAAGATGG - Exonic
978957812 4:114636242-114636264 TTTCAGCTGAATAGGGAATAAGG + Intronic
979020970 4:115497521-115497543 TTTTTGATGAAATAGGCATGTGG + Intergenic
979309380 4:119184236-119184258 CTTTTTCTAAATAAGGAATATGG - Intronic
979538309 4:121849939-121849961 TTTTAGATAAAGAAAGAATATGG + Intronic
979955444 4:126948421-126948443 TATTTGAGGAAAAAGGAAGAAGG + Intergenic
981453194 4:144922669-144922691 TTTTAGATTAATAATGACTAAGG + Intergenic
982080066 4:151780660-151780682 ATTTTGAAGCATAAGGAATATGG - Intergenic
982140680 4:152314705-152314727 TTTATTATGAATCAGGAATGAGG - Intergenic
982462754 4:155691499-155691521 ATTTTCATAAATAAGGAAAAAGG - Intronic
983556941 4:169067680-169067702 TTTTTTTTGTTTAAGGAATAGGG - Intergenic
984263439 4:177469270-177469292 TTTATTTTGTATAAGGAATAGGG + Intergenic
984459913 4:180020994-180021016 TGTTTGATGATTAAGAAAGAAGG - Intergenic
984549719 4:181145820-181145842 TTTTTAATGTACAAAGAATATGG - Intergenic
984752735 4:183294512-183294534 TGTGTGATGCATAAGTAATAGGG + Intronic
985018150 4:185659164-185659186 TTTTTGATGAAGAATGGATAAGG + Intronic
985072955 4:186186188-186186210 TTTTTGAAGAATAAAGAATCTGG - Intergenic
986349501 5:6864647-6864669 GTTTTGATGAATAACAGATACGG + Intergenic
986854456 5:11852792-11852814 TTTTTGCTGAATAATTAATTGGG - Intronic
987725868 5:21699093-21699115 TTTGTGAAGAACAAGGAAGAGGG - Intergenic
988084739 5:26460607-26460629 TTTTTAATGATTAAGACATAAGG - Intergenic
988926593 5:35996626-35996648 CTTTTGATGAAAAAGAGATATGG - Intergenic
989277617 5:39608249-39608271 TTTTTGTGAAATAAGGAATGAGG + Intergenic
989280853 5:39641594-39641616 TTTTCAATTAATAAGTAATACGG + Intergenic
989291739 5:39775560-39775582 TTTTTGATGAAGAAAAAATGAGG + Intergenic
989398389 5:40982754-40982776 GTTTTGATGAAAGAGAAATAAGG - Exonic
989400417 5:41002058-41002080 TTTTAGATTTATTAGGAATAAGG + Intronic
989423342 5:41266632-41266654 TTTTTTATGGACAAGGAATCTGG - Intergenic
991297721 5:65099557-65099579 TTCTTAATCCATAAGGAATAAGG - Intergenic
992366172 5:76092467-76092489 TTTTGAATGAAAAAGGAACATGG + Intronic
992391504 5:76335373-76335395 CTTTTCTTAAATAAGGAATAGGG - Intronic
992714706 5:79498480-79498502 TGTTTGCTGAATAAGGGATCAGG + Intronic
992862488 5:80926160-80926182 TTTTTGAGGAAGAGGGATTAAGG - Intergenic
992936749 5:81715085-81715107 TCTTTGATGTAGTAGGAATATGG - Intronic
993405034 5:87500450-87500472 TTTTTTTTGAATGAGGATTAAGG + Intergenic
993427221 5:87781732-87781754 TTTTTGATGAAAAAAAAATCAGG - Intergenic
994133057 5:96253133-96253155 TTTGTGATGAAAAATGAAAATGG - Intergenic
995669349 5:114583424-114583446 TTTCTGATATATAAGAAATATGG + Intergenic
995678698 5:114693088-114693110 TTTTTGATGTACAAAGATTATGG - Intergenic
995880917 5:116843882-116843904 CTTTTTCTTAATAAGGAATAAGG - Intergenic
995937751 5:117537667-117537689 TCTTTGATGAATAATGATTATGG - Intergenic
996343318 5:122462347-122462369 ATTTAGATGAATAAGGGAAATGG - Intronic
996606659 5:125330751-125330773 TTTTGGATGAAGAAGGATTTGGG + Intergenic
996859838 5:128052746-128052768 TTTTTTATCAATAAGGAACTTGG - Intergenic
997172386 5:131736223-131736245 TTGGTGATCAATAAGTAATAAGG - Intronic
997280274 5:132638825-132638847 GTTTTAAAGAATCAGGAATATGG + Intronic
997651990 5:135529073-135529095 CTTTTGCTGAATGAGGAAAAGGG - Intergenic
998267676 5:140678291-140678313 TTCTGGATGAATAGGGAAAATGG - Intronic
998457139 5:142282071-142282093 TTTATGATGAATAAAGCATTAGG + Intergenic
999021947 5:148175799-148175821 TTTTTAATGCCAAAGGAATATGG - Intergenic
1001230470 5:169982971-169982993 TTATTGATGAATGAGCCATAAGG + Intronic
1001260551 5:170224915-170224937 TTTTTGGTTTATAAGGCATAAGG + Intergenic
1001372007 5:171214117-171214139 TATTTGATGGATAAGGAAACTGG + Intronic
1001405722 5:171475676-171475698 CTTTTGATGATTCAGGAATCAGG - Intergenic
1003080095 6:3014824-3014846 TATTTGATGAATCAGGAAAAAGG + Intronic
1004015703 6:11730061-11730083 TTTTGGTTGAATAAGAACTAAGG + Intronic
1004321128 6:14632587-14632609 TTTTTAATAAATGAGGAAGAAGG + Intergenic
1005053873 6:21711427-21711449 TCTTTGTTGAAAATGGAATAGGG + Intergenic
1005365523 6:25072575-25072597 TTATGGATGAACAAGGAAAATGG - Intergenic
1007103758 6:39269153-39269175 TTTTTAATGAAAAAAGAAGAAGG - Intergenic
1008011348 6:46471064-46471086 TCTCTGATCAATAAGGAAGAAGG + Intronic
1008711276 6:54230181-54230203 TTTGTCATGGATAAGGAATCAGG - Intronic
1009408921 6:63342847-63342869 TGATTGGTGAATAAGGATTAAGG - Intergenic
1010744928 6:79550030-79550052 TTTTTGATTAGTAAGAATTATGG + Intergenic
1010770282 6:79820466-79820488 TTTTAGATGAATATTTAATAAGG + Intergenic
1011699031 6:89938436-89938458 TTTATGATGACCAAGTAATATGG + Intronic
1012304741 6:97640410-97640432 TTATGCATGAATAGGGAATATGG + Intergenic
1012755081 6:103219623-103219645 TTTTTAAAGAAGATGGAATAAGG - Intergenic
1012831630 6:104210781-104210803 TTTCAGATGAATGAGGAACACGG + Intergenic
1012990616 6:105922229-105922251 TTTCTGTTGAAAATGGAATAAGG + Intergenic
1012993658 6:105951259-105951281 TCTTTAAGAAATAAGGAATAAGG + Intergenic
1013669290 6:112381404-112381426 TTTTTGATTATTTAGGAACAAGG + Intergenic
1013864680 6:114680804-114680826 CTTTTAATGTATAATGAATAAGG - Intergenic
1013952432 6:115799757-115799779 TTTTTGATGAATAATTTATCTGG - Intergenic
1014569809 6:122995862-122995884 ATTTTGATGTAGAAGGAGTACGG - Intergenic
1016641362 6:146353048-146353070 TGTTTGATTAATAAGCCATAGGG - Intronic
1017219646 6:151950904-151950926 TTTTTGAGGCAAAAGAAATAAGG + Intronic
1017576610 6:155812215-155812237 TGTTTGATAAATAAGTAATGGGG + Intergenic
1017669249 6:156754362-156754384 TACTTGATCAATAAGGAAAAGGG - Intergenic
1019073397 6:169367911-169367933 CTTTTGATGCGTAAGGAATAAGG - Intergenic
1020290776 7:6720886-6720908 TTTTTGCTGGAAAAGGAAGAGGG - Intergenic
1020536811 7:9408633-9408655 TTATTGAATATTAAGGAATAAGG + Intergenic
1020743433 7:12051389-12051411 TTTTTGCTGAATTAGGTAAAAGG - Intergenic
1020831270 7:13098656-13098678 ATTTTGATCAAGAAAGAATAAGG + Intergenic
1021020637 7:15594308-15594330 TTTTCAATGAATAAGAAATGGGG + Intergenic
1021136838 7:16975408-16975430 TTTTTGATGATTAAATAAGAAGG - Intergenic
1021310728 7:19092870-19092892 TATTTGATAAATAAGTATTAAGG - Intronic
1021407524 7:20289838-20289860 TTTCTGACCAAAAAGGAATAAGG + Intergenic
1021468082 7:20968689-20968711 TGTTTAATAAATGAGGAATACGG + Intergenic
1022839130 7:34145896-34145918 TTTCTAATGGAAAAGGAATATGG + Intronic
1022843658 7:34189604-34189626 TTATTTATAAATAAGGAACATGG - Intergenic
1022976282 7:35559303-35559325 TCTTTGACAAATAAGGAATAAGG - Intergenic
1023498552 7:40824194-40824216 TTTTTTTTGAGCAAGGAATATGG - Intronic
1023704735 7:42929877-42929899 TATTTGAAGATTCAGGAATAAGG - Intronic
1024142369 7:46475119-46475141 TTAAGGATGAATAAGGGATAAGG + Intergenic
1024206678 7:47168663-47168685 TTTTCAATGAATAAGTAACAAGG + Intergenic
1024224076 7:47312387-47312409 TTTTTAATGGAAAAGAAATACGG - Intronic
1024311764 7:47975949-47975971 TTTTGGCTCAAGAAGGAATAGGG + Intronic
1024707237 7:51973633-51973655 ATTTTGATGGATAAGGAAATGGG + Intergenic
1024887014 7:54154904-54154926 TTTTTGAAAAATAAGGTGTATGG - Intergenic
1025076537 7:55948843-55948865 TTTTAGGTCAATAATGAATAAGG + Intergenic
1025243844 7:57300921-57300943 TTTTTGATGACTAAGGGAAAAGG + Intergenic
1026169412 7:67940789-67940811 TTTTTGGTGACTAAGGGAAAAGG + Intergenic
1027378888 7:77583709-77583731 ATTTTACTGAATAAGGAATGAGG + Intronic
1027919718 7:84377604-84377626 TATTTTGTAAATAAGGAATAAGG + Intronic
1028166554 7:87544371-87544393 TTATTCATTGATAAGGAATAAGG - Intronic
1028800429 7:94958008-94958030 TTAATGATTAATAAAGAATAAGG - Intronic
1029940121 7:104471108-104471130 TTTTTCATGTATTAGTAATATGG - Intronic
1030400624 7:109044488-109044510 TTTATGATGGATAAAGAAGAGGG - Intergenic
1030450079 7:109697982-109698004 TTTTAGATAAATAAAAAATAAGG - Intergenic
1030858797 7:114596982-114597004 TTTTTGATTAACAAAGAAAATGG - Intronic
1032166080 7:129546121-129546143 TTTATAATAAAAAAGGAATATGG - Intergenic
1032728402 7:134613635-134613657 CTTCTGATGATTAAGGAATGGGG - Intergenic
1032927990 7:136630775-136630797 TTATGGATGATGAAGGAATATGG - Intergenic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1035796795 8:2365020-2365042 TTTTTGGTGATTAAGGAACAGGG + Intergenic
1036052742 8:5218075-5218097 CTTTTTGTGAATGAGGAATATGG - Intergenic
1036509752 8:9389370-9389392 TGTTTGTTGAATAAAAAATAAGG + Intergenic
1037165947 8:15828609-15828631 TTTTGGATCAAGAAAGAATAAGG + Intergenic
1037226092 8:16592021-16592043 TTTTTCATGCAGAAGGAATGTGG + Intergenic
1038905136 8:31893017-31893039 TTTATGCTGAGTAAAGAATATGG + Intronic
1038920899 8:32082940-32082962 TTTTTGATGAGGGAGGAATTGGG - Intronic
1039017109 8:33162293-33162315 ATTTTGATGAAGAACTAATAGGG + Intergenic
1039263174 8:35795180-35795202 TTTTTGAAAAATAAGTAAGATGG - Intronic
1039322959 8:36452984-36453006 TTTTTCATAAATAAGGAGTTTGG - Intergenic
1039551549 8:38446708-38446730 TTTTTTATAAATAATGAAGAAGG - Intronic
1040734714 8:50491397-50491419 TTTTTGATGGATATGGATAAAGG + Intronic
1041467441 8:58170966-58170988 TATTTGTTGAATAATGAATCTGG + Intronic
1041871511 8:62639818-62639840 CTTTTTATTAATAAGGAATGAGG + Intronic
1042153249 8:65812374-65812396 TTATTGTGGTATAAGGAATAAGG - Intronic
1043066550 8:75578727-75578749 TATTTGCTGAACAAGTAATACGG + Intergenic
1043108166 8:76141290-76141312 CTTTTGATGAATGAAGAAAAGGG + Intergenic
1043448157 8:80339667-80339689 TATTTTAAAAATAAGGAATATGG - Intergenic
1043530955 8:81149387-81149409 TTTTCTATGAATAATGAATATGG + Intergenic
1044041893 8:87379598-87379620 TTTTTGATGAAGAAATAAAAGGG + Intronic
1044051333 8:87509497-87509519 TTTCTGATGACTAACAAATACGG + Intronic
1045130283 8:99144188-99144210 TGTTTCATGAAAAAGAAATAAGG + Intronic
1045138692 8:99254303-99254325 TTTTTGCTGAATATAGAATTTGG + Intronic
1045186886 8:99847347-99847369 TTTTTGATCAAATAGAAATATGG + Intronic
1045669863 8:104538328-104538350 TGTTTGATGCACAAGGAGTATGG - Intronic
1046180653 8:110642971-110642993 TTATTGATAAAGTAGGAATAAGG + Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047070223 8:121334801-121334823 TTTTTGGTGGGTAAGGAAGATGG - Intergenic
1047834684 8:128675534-128675556 TCTCTGATGACTAATGAATATGG + Intergenic
1047987546 8:130250559-130250581 GTTTTGATGAATAAACAATTGGG - Intronic
1048121757 8:131589423-131589445 TGTTTGACAAATAAAGAATATGG + Intergenic
1048824784 8:138413506-138413528 TTTTTTATGAAAAATGAATAAGG - Intronic
1050005014 9:1120397-1120419 TCTTTTTTGAATAAGGAATCTGG + Intergenic
1050690316 9:8220180-8220202 TTGTTGATTATTAAGGAGTAGGG - Intergenic
1052392570 9:27898046-27898068 TTTTTGATGATTAATCATTATGG - Intergenic
1052926872 9:34024494-34024516 CTTTTTATGAATAGGGAATTAGG - Intronic
1055184169 9:73430215-73430237 TTTTAGATCAATTAAGAATAAGG + Intergenic
1055296939 9:74843151-74843173 TTATGGATGAATAAAGAAAATGG - Intronic
1055344678 9:75322865-75322887 TTTTTTTTGAATAAGGTGTAAGG + Intergenic
1055602469 9:77934074-77934096 CTCTTGATGAATATGCAATAAGG - Intronic
1056196109 9:84230332-84230354 TTTTCGATGACTTAGGAACAAGG + Intergenic
1056782833 9:89564206-89564228 TTTTTGTTGAATGGGGAATAAGG + Intergenic
1058795557 9:108495071-108495093 TCTTTGATGAAGAAAGAATTTGG - Intergenic
1059160110 9:112026011-112026033 TTATTGATTACTAAGGAATGTGG + Intergenic
1059458056 9:114412202-114412224 TTTCAGATGCATAAGGAACATGG - Intronic
1060624533 9:125098886-125098908 TTCTTGTTGATTAAGGGATAAGG - Intronic
1062291147 9:135795121-135795143 TGTTAGATGAATTAGGTATAAGG - Intergenic
1062639853 9:137513529-137513551 TTATTTATGACTCAGGAATAAGG + Intronic
1203526384 Un_GL000213v1:93609-93631 TTCTTGAGGCAAAAGGAATATGG + Intergenic
1185850288 X:3479475-3479497 TTATGGAGAAATAAGGAATAAGG + Intergenic
1187631253 X:21175241-21175263 TGTTTGATGATTCAGGAATCTGG + Intergenic
1188360704 X:29249348-29249370 TTTTTGTTGTATTAGGAATCTGG + Intronic
1188636461 X:32437826-32437848 TTTATGAAGAATAAATAATATGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190436545 X:50431331-50431353 TTTTTGATGCATAAGGCTTTGGG + Intronic
1191007406 X:55724330-55724352 TTTTTTATGGATGAGGAAAAAGG - Intronic
1191091101 X:56622577-56622599 TTTTAGGTTAGTAAGGAATATGG + Intergenic
1192680779 X:73251474-73251496 TTTTGGATGGAGAAGGAAAATGG - Intergenic
1192803248 X:74487126-74487148 TTTTTGGTGAAAAAGGATTTGGG + Intronic
1193264396 X:79451643-79451665 TTTCTTATAAATAAGGAAAAGGG - Intergenic
1193295111 X:79824531-79824553 CTTTTGATGAAAAAGAGATATGG + Intergenic
1193412469 X:81181254-81181276 ATTTTAATTAATAATGAATAAGG - Intronic
1193815412 X:86099545-86099567 TTTTTCAAGAATAATGAATTTGG - Intergenic
1194757396 X:97753285-97753307 TTTTTGCTGAAAAGGAAATAAGG + Intergenic
1195017473 X:100793437-100793459 CTTTTGATGAAAAAGAGATATGG - Intergenic
1195836944 X:109126588-109126610 TTTTAGATTAATAATCAATATGG - Intergenic
1196414889 X:115460418-115460440 TCTTTGCTGAACAAGGAAGATGG + Intergenic
1197318362 X:124996622-124996644 TTTATGATGAATAAAATATAGGG - Intergenic
1198473624 X:136974189-136974211 TTTTAGAAGAATAAAGAGTAAGG - Intergenic
1198563021 X:137871703-137871725 TTTTTGAACAAAAAAGAATATGG - Intergenic
1199146063 X:144368570-144368592 TATTTCATGAAAAAAGAATAAGG + Intergenic
1199443923 X:147899458-147899480 GTTTTTATGAATTAGGAATGAGG - Intergenic
1199919189 X:152379746-152379768 GTTTTGAAGAATAAGGCAAAAGG + Intronic
1200812050 Y:7495989-7496011 TTATGGAGAAATAAGGAATAAGG - Intergenic