ID: 1034814864

View in Genome Browser
Species Human (GRCh38)
Location 7:154163677-154163699
Sequence CTATGGGGATGGTGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034814855_1034814864 0 Left 1034814855 7:154163654-154163676 CCTTATACAGCAAATTATTTTTC 0: 2
1: 0
2: 6
3: 63
4: 698
Right 1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG No data
1034814854_1034814864 26 Left 1034814854 7:154163628-154163650 CCAGATTTGCTAGTGCAATGATG 0: 2
1: 0
2: 0
3: 7
4: 103
Right 1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034814864 Original CRISPR CTATGGGGATGGTGGGGAGA TGG Intronic
No off target data available for this crispr