ID: 1034817387

View in Genome Browser
Species Human (GRCh38)
Location 7:154184146-154184168
Sequence CAGTGAGGACCCTCAGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034817381_1034817387 3 Left 1034817381 7:154184120-154184142 CCAAGAAGCAGGGACCAGCCCAG 0: 1
1: 0
2: 2
3: 49
4: 367
Right 1034817387 7:154184146-154184168 CAGTGAGGACCCTCAGCATCAGG No data
1034817380_1034817387 7 Left 1034817380 7:154184116-154184138 CCAACCAAGAAGCAGGGACCAGC 0: 1
1: 0
2: 0
3: 37
4: 723
Right 1034817387 7:154184146-154184168 CAGTGAGGACCCTCAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034817387 Original CRISPR CAGTGAGGACCCTCAGCATC AGG Intronic
No off target data available for this crispr