ID: 1034817877

View in Genome Browser
Species Human (GRCh38)
Location 7:154189215-154189237
Sequence TTCTACTAAACTATCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034817877 Original CRISPR TTCTACTAAACTATCCTGGT TGG (reversed) Intronic
904725625 1:32545263-32545285 TTGTAGCAAACTATCCTAGTGGG + Intronic
906860854 1:49357589-49357611 TTCTTCTCAACTATCCTAGGAGG + Intronic
907907051 1:58792160-58792182 TTCTACTAAATGCTACTGGTTGG + Intergenic
909507246 1:76406989-76407011 TTCTACTACACTATACTTATAGG + Intronic
910293126 1:85617707-85617729 TTCTACTGAAATATTCTAGTGGG + Intergenic
910542780 1:88379614-88379636 TTCTGCTTACCTATCCTGGGAGG - Intergenic
913708370 1:121452034-121452056 TTCTTCTAAAGTAGCCTGGTAGG + Intergenic
914325387 1:146610112-146610134 TTATCCTAGACTATCTTGGTGGG - Intergenic
915797095 1:158747163-158747185 TTCTACTAAGCTGTGCTGGATGG - Intergenic
918874012 1:190014786-190014808 TTCGTGTAAACTTTCCTGGTTGG + Intergenic
918918827 1:190677915-190677937 TTCTACTAAACTTTCTGGGAGGG + Intergenic
918934887 1:190909790-190909812 CTATACTAAACTATCAAGGTTGG - Intergenic
920641563 1:207756516-207756538 TTCTACTATACTCACCTTGTGGG - Intronic
921774738 1:219083816-219083838 TTCTAATCCACTATCCTGGAGGG + Intergenic
1071006767 10:80892333-80892355 TAATACTAAACTATCCTTTTAGG + Intergenic
1079840115 11:25386381-25386403 TGCTTTAAAACTATCCTGGTGGG + Intergenic
1080030311 11:27653637-27653659 ATCTACTAAATTATCCTACTTGG - Intergenic
1081337203 11:41881690-41881712 TTCTAATTTACTATCTTGGTTGG + Intergenic
1081538872 11:44015717-44015739 TTCTAGTACACCATCCTGCTGGG - Intergenic
1090446614 11:126770007-126770029 TCCCATTAAAATATCCTGGTTGG + Intronic
1093177878 12:15933763-15933785 TTCTACTAATCTATCAGGGCAGG + Intronic
1094522120 12:31202786-31202808 TTATATAAAAGTATCCTGGTAGG + Intergenic
1100717574 12:97322106-97322128 GTCTAATAACCTTTCCTGGTAGG - Intergenic
1101684406 12:107003417-107003439 GTTTACTTAACTCTCCTGGTAGG - Intronic
1102786520 12:115609484-115609506 TTCTACTATACTACCCTAGGAGG + Intergenic
1107157634 13:37188019-37188041 TTCTACTAAACTTTGCTGCATGG - Intergenic
1107781382 13:43906835-43906857 TTGTAATAAATTATCCTGGATGG - Intergenic
1108066886 13:46586863-46586885 TTCTAATAAACTTTCCTGCTTGG - Intronic
1108337214 13:49457173-49457195 TGCTACTAAATTATTCTGGTAGG - Intronic
1108337219 13:49457319-49457341 TGCTACTAAATTATTCTGGTAGG - Intronic
1108475093 13:50808212-50808234 TTCTTCTAACCTTCCCTGGTGGG + Intronic
1108788875 13:53942084-53942106 TTGTACTTAACCGTCCTGGTGGG - Intergenic
1108856103 13:54794732-54794754 TTATACTGAATTATCCGGGTGGG + Intergenic
1112712950 13:102151361-102151383 TTTTTCTCACCTATCCTGGTAGG + Intronic
1113157810 13:107344820-107344842 TTCTACTATTTTATCTTGGTAGG - Intronic
1116418996 14:44711434-44711456 TTCTACTTACCTATCCTCTTCGG + Intergenic
1127567390 15:60205161-60205183 TTCTACTTCACAATCCTGGGAGG + Intergenic
1129123725 15:73420174-73420196 TTCTAATTTACTATCTTGGTTGG + Intergenic
1129443216 15:75597653-75597675 TTCTCCCAAACTGTCCTGGTGGG + Intergenic
1130786341 15:87100699-87100721 CTCTAATAAGCTTTCCTGGTAGG + Intergenic
1136666575 16:31818132-31818154 TTATCCTTGACTATCCTGGTGGG + Intergenic
1140008174 16:71100835-71100857 TTATCCTAGACTATCTTGGTGGG + Intronic
1140408725 16:74728317-74728339 CTCCACTAAACTATCCTGCTTGG - Intronic
1144345884 17:14349001-14349023 TTTTACAAAAATATCCTGGCAGG - Exonic
1152985423 18:316289-316311 ATCTTCCAAACAATCCTGGTTGG - Intergenic
1154050709 18:10954204-10954226 TTCTACAAAAATATCCTGCTGGG + Intronic
1155989588 18:32266253-32266275 GTCTACAAAACTAGACTGGTGGG + Intronic
1156690728 18:39703836-39703858 TTATCCTAGACTATTCTGGTGGG - Intergenic
1158210145 18:55040020-55040042 TTATATTCCACTATCCTGGTTGG - Intergenic
1159747857 18:72261421-72261443 TTCTGATAAACTTTCCTTGTAGG - Intergenic
1160362489 18:78295660-78295682 TTCTACCTAATTATCCTGGATGG - Intergenic
932119118 2:69082033-69082055 TTCTACTAAACAATGCAGGCAGG + Intronic
932473134 2:71977447-71977469 ATCTACAAAAATATCTTGGTGGG + Intergenic
934032880 2:88064302-88064324 TTATCCTAGATTATCCTGGTAGG - Intergenic
935938720 2:108216044-108216066 TACTACAAAACCATCCTGGGAGG - Intergenic
936813831 2:116435265-116435287 TTCTAATGAACTATCCAAGTGGG + Intergenic
937111419 2:119369444-119369466 TTATACTAAACTATCGTGTTTGG - Intronic
939300198 2:140326912-140326934 TTCTACAAAAATATACTGGATGG - Intronic
939605436 2:144249316-144249338 TTCTACTATCCCATCCTAGTGGG + Intronic
940815934 2:158297623-158297645 TTCTGCTAAACTATCTAGGGTGG - Intronic
942439015 2:176012663-176012685 TTCTAGAAAACTATCTTGCTGGG + Intergenic
942500416 2:176583963-176583985 TACTACTAAACTTTCCTGGAAGG + Intergenic
943013822 2:182486412-182486434 TTCTACAAAAAAAGCCTGGTGGG - Intronic
1170229812 20:14033508-14033530 TTCTATTAAAACATCCTGTTGGG + Intronic
1175865127 20:62171701-62171723 TTCTACTTTACTTTTCTGGTTGG - Intronic
1176065812 20:63194006-63194028 TTCTACAAAACTTTCCAAGTTGG + Intergenic
1177732560 21:25046894-25046916 TTCTACTGAATAATACTGGTTGG - Intergenic
1179026774 21:37685383-37685405 TTCTAAGAATCTATCCTGGCCGG + Intronic
949809314 3:7989074-7989096 TTTGACTTAACTAACCTGGTTGG - Intergenic
951363690 3:21754487-21754509 TTGTATTAAAATATCATGGTTGG + Intronic
953676780 3:45008815-45008837 TTCTCATAAACTCTCCTGGGAGG - Intronic
959246681 3:103879689-103879711 TTCTACTCATTTTTCCTGGTAGG - Intergenic
962050499 3:131809143-131809165 TTATCTTAAATTATCCTGGTGGG + Intronic
963635780 3:147793832-147793854 TTCTGCTATACTATCCCAGTTGG + Intergenic
970531081 4:16984991-16985013 TTCTATTTAAAAATCCTGGTGGG - Intergenic
970899157 4:21138698-21138720 TTATACTAGATAATCCTGGTAGG + Intronic
971603684 4:28629813-28629835 TTCTACTAAAATATCCTCAGAGG - Intergenic
972144619 4:36007289-36007311 TTATACTAAATTATCCAGGTGGG + Intronic
975196819 4:71535358-71535380 TTCTGATAAACTATCCAAGTAGG + Intronic
975196976 4:71537052-71537074 TTCTGATAAACTATCCAAGTAGG - Intronic
976037940 4:80847082-80847104 TACTACTATACTATGCTTGTGGG - Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
984688395 4:182697387-182697409 TTCTCCTAAACTGACCTGATTGG + Intronic
987160480 5:15136459-15136481 TTCCACAAAACAATCCTGCTTGG - Intergenic
987717210 5:21587261-21587283 TTATCCTGAAGTATCCTGGTGGG - Intergenic
987885058 5:23801907-23801929 TTCTACTACACTATCCTCTTTGG + Intergenic
988079676 5:26400315-26400337 TTCTACTAAACTATCATCTGTGG - Intergenic
988083404 5:26441935-26441957 TTATTCTAGACTATCCAGGTGGG + Intergenic
988942507 5:36160424-36160446 TTTCAATAAACTATCCTGATGGG - Intronic
989774152 5:45182629-45182651 ATGTACTAAACTCACCTGGTTGG - Intergenic
989969728 5:50508524-50508546 TTCTTCTAAAGTAGCCTGGTAGG - Intergenic
992007857 5:72496035-72496057 TTTTACTTAACTATACAGGTTGG + Intronic
992924094 5:81563009-81563031 TTCTACAAAACAACCCTGTTGGG - Intronic
993105814 5:83599442-83599464 CTCTATTATTCTATCCTGGTGGG - Intergenic
1000654376 5:163858435-163858457 TTCCACTAAACTAATCTGATAGG - Intergenic
1003194214 6:3900697-3900719 TGCTACAAAACAATCCAGGTGGG + Intergenic
1007803387 6:44417402-44417424 TTTTTCTAAACTAACCTGGGAGG + Intronic
1008188053 6:48419687-48419709 TTTTAGGAAACTATTCTGGTAGG + Intergenic
1011571149 6:88737260-88737282 TACTACTAAAATATGGTGGTGGG - Intronic
1013066763 6:106691547-106691569 TTCAAATAAAGTATCTTGGTTGG + Intergenic
1021278334 7:18684337-18684359 TTCATCAAAACTATCCTGTTAGG + Intronic
1023274690 7:38505625-38505647 TTCTACTACACTTTGCTGTTTGG - Intronic
1023391669 7:39717019-39717041 TTCTCCTGAAGTGTCCTGGTGGG - Intergenic
1024014748 7:45303059-45303081 TTCTAATTAGCTATCCTAGTGGG - Intergenic
1028105100 7:86867796-86867818 GTCTATTAATCTATCCTGGAAGG + Intergenic
1028386371 7:90258570-90258592 TTATACTAGATTATCCAGGTGGG - Intronic
1030995880 7:116357884-116357906 TCCCATTAAACTGTCCTGGTTGG + Intronic
1032288234 7:130560451-130560473 TTCTACTAAACAAGCCTGCTAGG - Intronic
1034817877 7:154189215-154189237 TTCTACTAAACTATCCTGGTTGG - Intronic
1038740867 8:30215511-30215533 TTCTAGTAGAATATCCTTGTAGG + Intergenic
1044027315 8:87189460-87189482 TGCTACTATAGTATTCTGGTGGG + Intronic
1044499605 8:92938192-92938214 TTCCACAAAACTATCCCAGTTGG - Intronic
1045552408 8:103184203-103184225 TTATCCTGAAATATCCTGGTGGG - Intronic
1045843532 8:106606685-106606707 TTATACTGAATTATCCAGGTGGG - Intronic
1046699557 8:117384596-117384618 CTCTACTTAACTATCATGATGGG - Intergenic
1050780120 9:9323360-9323382 TTCTACCTAACTCTCATGGTTGG - Intronic
1051550271 9:18319881-18319903 TTATTCTAGATTATCCTGGTGGG + Intergenic
1051954666 9:22677294-22677316 TTTTCCTAAACAATCCAGGTTGG - Intergenic
1053286579 9:36853329-36853351 TTCTATTAATATATCTTGGTAGG - Intronic
1055544844 9:77358950-77358972 TTCTTCTAAACTATCCTGGGGGG + Intronic
1057319551 9:93999975-93999997 TTCTGGTTTACTATCCTGGTAGG + Intergenic
1059182031 9:112225191-112225213 TTCTGCTATACTGTCCTTGTTGG - Intronic
1059377417 9:113895382-113895404 TAATATTAAACTATCCTGGAAGG + Intronic
1188828453 X:34866067-34866089 TTATACTAAACTATCTAGATGGG - Intergenic
1189744117 X:44152472-44152494 TTCTACTTAACTTTTCTTGTTGG - Intronic
1190806800 X:53845442-53845464 TCCTATTTAAATATCCTGGTGGG + Intergenic
1193099248 X:77590041-77590063 TTCTACAAAAAAATCCTGCTGGG - Intronic
1195486452 X:105413350-105413372 TTATCCTATACTATCCAGGTGGG + Intronic
1195952685 X:110292747-110292769 TTCTATGATACTATACTGGTGGG + Intronic
1198890756 X:141393255-141393277 TTATCCTGAATTATCCTGGTAGG + Intergenic