ID: 1034823430

View in Genome Browser
Species Human (GRCh38)
Location 7:154237854-154237876
Sequence TCCCTGCTGAGGGGAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 1, 2: 3, 3: 37, 4: 325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034823425_1034823430 1 Left 1034823425 7:154237830-154237852 CCTTGTTAAAGAAAGAAGGTCAT No data
Right 1034823430 7:154237854-154237876 TCCCTGCTGAGGGGAGCCCTGGG 0: 1
1: 1
2: 3
3: 37
4: 325
1034823422_1034823430 25 Left 1034823422 7:154237806-154237828 CCCTCAGTACATCTTGAAATAAT 0: 1
1: 0
2: 2
3: 22
4: 406
Right 1034823430 7:154237854-154237876 TCCCTGCTGAGGGGAGCCCTGGG 0: 1
1: 1
2: 3
3: 37
4: 325
1034823423_1034823430 24 Left 1034823423 7:154237807-154237829 CCTCAGTACATCTTGAAATAATA 0: 1
1: 0
2: 2
3: 24
4: 337
Right 1034823430 7:154237854-154237876 TCCCTGCTGAGGGGAGCCCTGGG 0: 1
1: 1
2: 3
3: 37
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034823430 Original CRISPR TCCCTGCTGAGGGGAGCCCT GGG Intronic