ID: 1034825134

View in Genome Browser
Species Human (GRCh38)
Location 7:154255451-154255473
Sequence CTTTCCCCCAGTGCTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034825134_1034825142 7 Left 1034825134 7:154255451-154255473 CCACTCCCAGCACTGGGGGAAAG 0: 1
1: 0
2: 2
3: 20
4: 295
Right 1034825142 7:154255481-154255503 CTCTTTGAATTCTGCGGTGCGGG No data
1034825134_1034825140 1 Left 1034825134 7:154255451-154255473 CCACTCCCAGCACTGGGGGAAAG 0: 1
1: 0
2: 2
3: 20
4: 295
Right 1034825140 7:154255475-154255497 AGGTGGCTCTTTGAATTCTGCGG No data
1034825134_1034825143 12 Left 1034825134 7:154255451-154255473 CCACTCCCAGCACTGGGGGAAAG 0: 1
1: 0
2: 2
3: 20
4: 295
Right 1034825143 7:154255486-154255508 TGAATTCTGCGGTGCGGGAATGG 0: 1
1: 0
2: 0
3: 3
4: 61
1034825134_1034825141 6 Left 1034825134 7:154255451-154255473 CCACTCCCAGCACTGGGGGAAAG 0: 1
1: 0
2: 2
3: 20
4: 295
Right 1034825141 7:154255480-154255502 GCTCTTTGAATTCTGCGGTGCGG 0: 1
1: 0
2: 0
3: 12
4: 120
1034825134_1034825144 26 Left 1034825134 7:154255451-154255473 CCACTCCCAGCACTGGGGGAAAG 0: 1
1: 0
2: 2
3: 20
4: 295
Right 1034825144 7:154255500-154255522 CGGGAATGGCAGAGCACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034825134 Original CRISPR CTTTCCCCCAGTGCTGGGAG TGG (reversed) Intronic
900244707 1:1631667-1631689 GTGTCCCCGAGAGCTGGGAGGGG - Intergenic
900500044 1:2999897-2999919 CTTTCCCCAAGTACTGGAGGGGG - Intergenic
901026822 1:6282732-6282754 CTTCGTGCCAGTGCTGGGAGAGG + Intronic
901054361 1:6441861-6441883 CCATCCCCCTGTGCTGGGGGGGG - Intronic
901558637 1:10051822-10051844 TTTTCTCCCCCTGCTGGGAGGGG - Intronic
901743155 1:11355619-11355641 CGTGCCCCCCGGGCTGGGAGGGG + Intergenic
901961406 1:12829088-12829110 ATTTCCCCCAATGGTAGGAGGGG - Intronic
901967992 1:12883693-12883715 GTTTCCCCCAATGGTAGGAGGGG - Intronic
901975801 1:12942823-12942845 ATTTCCCCCAATGGTAGGAGGGG - Intronic
901983394 1:13053958-13053980 ATTTCCCCCAATGGTAGGAGGGG - Intronic
901985616 1:13073373-13073395 ATTTCCCCCAATGGTCGGAGGGG + Intronic
901996193 1:13153394-13153416 ATTTCCCCCAATGGTCGGAGGGG - Intergenic
901998695 1:13174960-13174982 ATTTCCCCCAATGGTAGGAGGGG + Intergenic
902009373 1:13258942-13258964 ATTTCCCCCAATGGTAGGAGGGG + Intronic
902017184 1:13318087-13318109 ATTTCCCCCAATGGTAGGAGGGG + Intronic
902897086 1:19486022-19486044 CGCTCCCCCAGTGCTGGGTTGGG - Intergenic
904306153 1:29591771-29591793 CATTCTCCCACTGCTGGGGGTGG + Intergenic
904470610 1:30733793-30733815 CCCAGCCCCAGTGCTGGGAGGGG - Exonic
905592320 1:39175000-39175022 CTTCCCCAAATTGCTGGGAGTGG + Intronic
905732501 1:40306338-40306360 CATTCCCACAGTGGTGGCAGAGG + Intronic
905777593 1:40679181-40679203 CTTTCCAGCAGTGGTGGTAGTGG - Intergenic
905788788 1:40779078-40779100 CTTTTCCCCAGATCTGGGTGTGG - Intergenic
905877556 1:41442727-41442749 CTGTCCCCCAGTGCTGGCCAAGG + Intergenic
907339794 1:53726716-53726738 GTTTCCCCTAGGGCTGGGGGAGG - Intronic
907581254 1:55574655-55574677 CTTTTCCACAATGCTTGGAGAGG - Intergenic
909001560 1:70223550-70223572 CTTTCTCCCAATACTGGGAAGGG - Intronic
911407433 1:97460608-97460630 CTTTCCTGAAGTGCAGGGAGAGG + Intronic
913659457 1:120993571-120993593 CAGTCCCCCAGTTCTGCGAGGGG - Intergenic
914010819 1:143776698-143776720 CAGTCCCCCAGTTCTGCGAGGGG - Intergenic
914167009 1:145184417-145184439 CAGTCCCCCAGTTCTGCGAGGGG + Intergenic
914478186 1:148041689-148041711 CTTTCCCACAGTGAGGGCAGGGG + Intergenic
914649441 1:149685355-149685377 CAGTCCCCCAGTTCTGCGAGGGG - Intergenic
915238413 1:154502292-154502314 CTTTCCTCCTGCGGTGGGAGAGG + Intronic
915585595 1:156842234-156842256 ATTTCCCCCAATGCTGGCTGTGG + Exonic
916018212 1:160769248-160769270 CTTTCCCACAGTTCTGGGTTTGG - Intergenic
916743497 1:167666602-167666624 CTTTCCGTCAGCCCTGGGAGGGG + Intronic
918251928 1:182710563-182710585 CTTCTCCCCATTGGTGGGAGAGG - Intergenic
919792296 1:201300064-201300086 CTATCTCCCAGGGCTGGGTGGGG - Intronic
919914750 1:202132535-202132557 CTGTCCCTTAGTCCTGGGAGTGG - Exonic
921192987 1:212726196-212726218 TTTTCCCCCACTGATGTGAGAGG - Intronic
921287155 1:213619453-213619475 CTTGCCCCCAGTGGTGTGTGTGG - Intergenic
922696500 1:227733584-227733606 CTTCCCCCCAGGGCAGGAAGAGG - Exonic
922968688 1:229715895-229715917 GTTGCCTCCAGAGCTGGGAGGGG - Intergenic
923993916 1:239470348-239470370 CTGGCCACCAGTGCTGGGAAAGG + Intronic
1063059895 10:2539992-2540014 ACTTCACCCAGTGTTGGGAGGGG - Intergenic
1063714400 10:8513448-8513470 CTTTCCCCCAGAGCTAGCTGAGG + Intergenic
1064304782 10:14155392-14155414 ATTGCCCCCAGTGCTGGGCTGGG - Intronic
1066046354 10:31598916-31598938 CTTATCCCCAGTGCTGGAGGTGG + Intergenic
1069735655 10:70652441-70652463 CTCTCCCCAAGTGGTGGGTGAGG + Intergenic
1070744998 10:78928351-78928373 CTTTCCCCAACTGCTTGGATAGG - Intergenic
1071464211 10:85924879-85924901 CATTCCCCCGGGGCTGTGAGCGG - Intronic
1072378700 10:94843094-94843116 CTCTCACCCAGTGATGGTAGAGG - Intronic
1074915452 10:117950835-117950857 CATTTCCTCAGGGCTGGGAGAGG + Intergenic
1076495907 10:130897892-130897914 CTCTCCCCCAGTTCCTGGAGTGG + Intergenic
1076757480 10:132580015-132580037 CTTCCTCCCACTGCTGGCAGGGG + Intronic
1077149353 11:1062556-1062578 TGTTCCCCCAGCCCTGGGAGTGG + Intergenic
1077297228 11:1831924-1831946 GTTTCCCCGAGTGCTGGGGCTGG - Intronic
1077466958 11:2738029-2738051 CCCTCCTCCACTGCTGGGAGGGG + Intronic
1078145081 11:8716931-8716953 ATTTACCCCATAGCTGGGAGTGG - Intronic
1078623050 11:12926390-12926412 CTTTCCCACAATGGTGGCAGTGG + Intronic
1079136620 11:17779235-17779257 GCTGCCCACAGTGCTGGGAGTGG - Intronic
1080243143 11:30150439-30150461 CTTTTCCCCAGTGGTGGGGTTGG + Intergenic
1081531098 11:43959843-43959865 CTCTCCCCAAGTGCGGGAAGAGG - Intergenic
1081746736 11:45478397-45478419 TTTTCCACCAGGGCTGGCAGTGG + Intergenic
1081866872 11:46365027-46365049 CCTTCCCCCACTGTTAGGAGAGG + Intronic
1082173882 11:49039592-49039614 GTCTCCCCAAGTGCTGGGATTGG - Intergenic
1082221509 11:49643896-49643918 GTTTCTCCCAGTGCTGGAATTGG + Intergenic
1083628507 11:64084204-64084226 CTTTGCCCCAGGCCTGGGAGGGG - Intronic
1083628557 11:64084423-64084445 CCTGCCCACAGTGCAGGGAGGGG - Intronic
1083899288 11:65635958-65635980 CTTACCCCCAGAGCTGACAGTGG + Intronic
1083943308 11:65910329-65910351 CTTTCCACCTGTGGTGGGGGTGG + Intergenic
1084285015 11:68125354-68125376 CTTTCCCTGAGTGCTGAGCGTGG + Intergenic
1084734232 11:71094106-71094128 GTAACCCCCAGTGCTGGGGGTGG + Intronic
1086627535 11:88975257-88975279 GTTTCTCCCAGTGCTGGAATTGG - Intronic
1088420992 11:109646738-109646760 CATTCCCCGAGTGCTGGGACTGG - Intergenic
1089601912 11:119621561-119621583 CTGGCCCCCAGTGCTGTGTGCGG - Intergenic
1090151562 11:124389969-124389991 TTTTCCACGAGTTCTGGGAGTGG - Intergenic
1096231188 12:49897766-49897788 TTTTCTCCCAATGCTGGGGGGGG - Intronic
1096459213 12:51813027-51813049 CTTTCCCACACACCTGGGAGTGG - Intergenic
1096636651 12:52964725-52964747 GCTTCCCCAAGGGCTGGGAGTGG + Intergenic
1097245713 12:57606569-57606591 TTTTCCCCAAGAGGTGGGAGGGG + Intronic
1098205492 12:68104935-68104957 GTTTCCCCTAGTGATGGCAGTGG - Intergenic
1098508440 12:71282615-71282637 CTTACCCTCAGTGCGGGGTGTGG + Intronic
1098827743 12:75318849-75318871 CTTACCCCCAGTGCCTGGACAGG + Intronic
1100564975 12:95787067-95787089 TTTTCCCAAAGTCCTGGGAGCGG + Exonic
1102253812 12:111405210-111405232 CTGTCCCCCAATTCTAGGAGGGG - Intergenic
1102925246 12:116821352-116821374 GTCTCCTCCAGTGCTGGGGGTGG - Intronic
1102964953 12:117118802-117118824 CTGCCCCCCACTGCTGGGAAAGG + Intergenic
1103673013 12:122633642-122633664 GTAATCCCCAGTGCTGGGAGAGG + Intergenic
1103957239 12:124584051-124584073 CATTCTCCCTGTGCTGGGATTGG - Intergenic
1103967975 12:124652252-124652274 CTCTCCCCCAGGTCTGGGATGGG - Intergenic
1105944103 13:25175194-25175216 ATTCCACCCAGTGCTGGGTGCGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107869321 13:44732623-44732645 CTTCTCCCCAGGGCTGGCAGGGG + Intergenic
1108592604 13:51924421-51924443 CTTTCCCCCAGTCCCAGGAGAGG + Intergenic
1110594852 13:77308886-77308908 CTTTCCACCAGTGATGGATGGGG - Intronic
1113382044 13:109813175-109813197 CTCTCCCCCAGTGAAGAGAGGGG - Intergenic
1115628865 14:35223252-35223274 CCTCTCCCCAATGCTGGGAGAGG + Intronic
1116984891 14:51207963-51207985 CTTCCCTCTAGTTCTGGGAGGGG + Intergenic
1118001932 14:61531018-61531040 CTTTCTCTTAGGGCTGGGAGAGG + Intronic
1119001567 14:70886711-70886733 TTTTCCCCCAGAACTGGGAAGGG + Intergenic
1120906533 14:89625636-89625658 CCTTCCTCCCGGGCTGGGAGTGG - Intergenic
1121207587 14:92182438-92182460 CTTCCCCTCAGTGCAGGGAAAGG - Intergenic
1121517042 14:94559556-94559578 CTGTCCACCACTGCTGGGATGGG + Intergenic
1121533304 14:94673600-94673622 CTTACCCCAAGCCCTGGGAGGGG + Intergenic
1121565125 14:94903657-94903679 GTTTCCCCCTGTGGTGGGACTGG + Intergenic
1122165414 14:99819695-99819717 GTTTCCCTCCGTGGTGGGAGGGG + Intronic
1122641716 14:103163952-103163974 CTTTCCACCAGTGAGGGCAGAGG - Intergenic
1122643355 14:103175503-103175525 CTTTCCACCAGTGAGGGCAGAGG - Intergenic
1122781935 14:104147412-104147434 CCTTCCTCCTCTGCTGGGAGGGG - Intronic
1123781938 15:23637351-23637373 CTTTTCCCCAGTGTTGAGTGTGG - Intergenic
1124914888 15:33960172-33960194 CTCTCCCCCTGTGCTGAAAGAGG - Intronic
1126413088 15:48392392-48392414 CCTTCCCACAGTTCTGGCAGTGG + Intergenic
1129108069 15:73322719-73322741 CTCTTCCCCAGGGCTGGGGGTGG - Exonic
1129330327 15:74823789-74823811 CTTGCCAGCAGTCCTGGGAGGGG - Intronic
1129701230 15:77769660-77769682 CTGTCCCCCAGGGGTGGGTGGGG - Intronic
1132648135 16:1008386-1008408 CTGGCCCCCAGAGCTGTGAGGGG - Intergenic
1132715589 16:1288576-1288598 CTTTCCCTGAATCCTGGGAGGGG + Intergenic
1133023591 16:2977740-2977762 CCTGCCCCCAGTGCTAGGCGGGG - Intronic
1133917384 16:10121297-10121319 CTTTCCCCCAGTGTTTCCAGGGG - Intronic
1134170779 16:11967725-11967747 CCTTCCTCCATAGCTGGGAGTGG - Exonic
1138303167 16:55949427-55949449 ATTTCCCCAACTGCTGGCAGTGG - Intronic
1138521862 16:57575681-57575703 CTTCCCCTCAGTGCCTGGAGAGG - Exonic
1138998343 16:62478828-62478850 ATTGCCCACAGTGCTGTGAGAGG - Intergenic
1139328965 16:66172977-66172999 TTTTCCTCCTGTGCTGGGAGGGG + Intergenic
1140829803 16:78740612-78740634 ATTTCTCCTAGTGCTGGAAGGGG + Intronic
1141526521 16:84615311-84615333 CTGCCCCCCAGGGATGGGAGTGG - Intronic
1141930651 16:87200259-87200281 CCATCCCCCAGTGCTGGGTCTGG + Intronic
1142341008 16:89522671-89522693 CTCTCCTCCAGTTCTGGGAAGGG - Intronic
1142579008 17:929205-929227 CTTTCCCCGAGGGCTGGCTGCGG + Intronic
1143360492 17:6365248-6365270 CTCCCCCACAGTGCAGGGAGAGG + Intergenic
1143500586 17:7336521-7336543 CTTCCAGGCAGTGCTGGGAGGGG - Exonic
1144442928 17:15300295-15300317 CTTTGCAGCAGTGCTGGAAGGGG - Intergenic
1144781799 17:17811999-17812021 CTTTCCCTAGGTGCTGGGGGAGG + Intronic
1146283893 17:31561494-31561516 CTGATCCCCAGGGCTGGGAGAGG - Intergenic
1147391632 17:40112788-40112810 ATGTTCCCCAGTGCTGAGAGAGG + Intergenic
1147782996 17:42957081-42957103 CTCCCTCCCAGTGCTGGGATGGG + Intronic
1147948389 17:44093181-44093203 CTTTACCTCAGTGCTGGCAATGG + Exonic
1148355236 17:46971443-46971465 CTCTCCTCCAGTGCTGGGTTAGG + Intronic
1148600821 17:48892972-48892994 TTTCCCCCCAGTGCTGGGAGAGG + Intronic
1149385999 17:56143930-56143952 CTGTCCCCCAGAACTGTGAGAGG + Intronic
1149582166 17:57758213-57758235 CCTTCCCACAGTGCGGTGAGAGG - Intergenic
1149983739 17:61331710-61331732 CTTTCCCACACTGCTAGGAGTGG - Intronic
1150307622 17:64099888-64099910 CTTTCTCCCATTCCAGGGAGTGG - Intronic
1150379493 17:64709513-64709535 CATGCCTCCAGTTCTGGGAGTGG - Intergenic
1150423576 17:65058605-65058627 CTATGCCCCAATCCTGGGAGAGG - Intergenic
1151571360 17:74927448-74927470 CTTTCTCCCAGGGGAGGGAGTGG + Intronic
1151972555 17:77466344-77466366 ATTTCTCCCAAGGCTGGGAGGGG - Intronic
1152344132 17:79741495-79741517 CCTTCTCCCAGGGCTGGGAGGGG - Intronic
1153828727 18:8900912-8900934 CTTTCCCCCATTCCCTGGAGAGG + Intergenic
1154052496 18:10974345-10974367 CTTTCCCCCTGTGGGAGGAGGGG - Intronic
1155812766 18:30259215-30259237 CATTCTCCCAGTGGTGGAAGCGG + Intergenic
1156202115 18:34845278-34845300 CATTCACTCAGTGCTGGGGGAGG + Intronic
1157580590 18:48771786-48771808 CTTCCCCCCAGCTCTGTGAGCGG + Intronic
1157619271 18:49006746-49006768 CATTCCCCCAGTGCTGGGCAGGG + Intergenic
1159754272 18:72344658-72344680 CTGTACCCCTGTGCTGGGGGTGG - Intergenic
1160529944 18:79556937-79556959 CTCTCCCTCCGTGCTGGGAGGGG - Intergenic
1160867512 19:1262388-1262410 CATTCCCATGGTGCTGGGAGAGG - Intronic
1160867704 19:1263001-1263023 CTCTCCCCCAGGGCTGAGTGTGG - Intronic
1160935459 19:1592581-1592603 CGCTCCCGCAGGGCTGGGAGAGG - Exonic
1161010625 19:1957959-1957981 CTTCCCCCGTGTGCAGGGAGGGG + Intronic
1161597338 19:5157351-5157373 CTGGCCTCCAGGGCTGGGAGAGG - Intergenic
1161805424 19:6440653-6440675 TTTCCCCACAGGGCTGGGAGGGG + Exonic
1163404872 19:17116021-17116043 CTCTGCCCCACAGCTGGGAGTGG + Intronic
1163439514 19:17314615-17314637 CTGTCCCCAGGGGCTGGGAGTGG - Intronic
1165114139 19:33518876-33518898 CTTTACCCGAGGGCTGGGAAAGG + Intronic
1165229151 19:34375843-34375865 GCTTCCGCCTGTGCTGGGAGGGG - Intronic
1166287256 19:41838802-41838824 CAGTCCCTCGGTGCTGGGAGTGG + Intronic
1166293459 19:41877800-41877822 CATTCCCCCAGTGCTGAGAAGGG - Intronic
1166503944 19:43360032-43360054 CGTTCCCCCAGGGCTGTGAGAGG + Intronic
925687089 2:6483558-6483580 GTATTCCCCAGTGTTGGGAGAGG - Intergenic
925905095 2:8535424-8535446 TTCTCCCCCAGGCCTGGGAGCGG - Intergenic
926242243 2:11097220-11097242 CTTGCGACCAGTGCTGGAAGTGG + Intergenic
933738040 2:85510976-85510998 TTTTCCCCCACTGCTGGGGGAGG - Intergenic
933901917 2:86856182-86856204 CATTCCTATAGTGCTGGGAGGGG + Intronic
934119693 2:88827559-88827581 ACTTCCCCCAGTCCTGGGACTGG + Intergenic
934765461 2:96877855-96877877 CTAGCCCCCAGACCTGGGAGGGG - Intronic
935167818 2:100585086-100585108 CTTGACCCCAGTGTTGGAAGTGG + Intergenic
935778627 2:106493082-106493104 CATTCCTGTAGTGCTGGGAGGGG - Intergenic
936163157 2:110100098-110100120 ACTTCCCCCAGTCCTGGGACTGG + Intronic
941296063 2:163739624-163739646 CTTTACCTAAGTGATGGGAGAGG + Intergenic
941925284 2:170888228-170888250 CTTTCCCCCAGGGCTGGGGGTGG + Intergenic
941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG + Intronic
942539775 2:177003335-177003357 CTTTCCCCACTTGCTTGGAGTGG + Intergenic
943219791 2:185090353-185090375 TTTTCCTCCTGTGATGGGAGGGG - Intergenic
943345730 2:186734912-186734934 CTTTGCCCCAGGGCTGGCACCGG + Intronic
944109473 2:196116632-196116654 GCTTCCCAAAGTGCTGGGAGGGG + Intergenic
945621898 2:212150138-212150160 CTTGCCCCCAGAACTGTGAGAGG - Intronic
946079838 2:217108230-217108252 ACTACCCACAGTGCTGGGAGGGG - Intergenic
946371880 2:219286047-219286069 CTTCCCCCATGCGCTGGGAGGGG + Exonic
946726801 2:222669783-222669805 TCTTCCCCCAGTGCTAGGTGGGG - Intergenic
946952260 2:224889850-224889872 CTCTCCCCCACTCCTGTGAGAGG + Intronic
948147710 2:235720458-235720480 CACTCCCACAGTGGTGGGAGTGG + Intronic
948303275 2:236925135-236925157 CATTCTCCCAGTGCTGTGAGAGG - Intergenic
948513025 2:238484740-238484762 TTTTCTCACAGTTCTGGGAGCGG - Intergenic
948679207 2:239621169-239621191 CTTTCCCTCAAAGCTGGGAGTGG + Intergenic
1168821434 20:776024-776046 CTTTCCCCGAGCTCTGGGCGGGG - Intergenic
1169527678 20:6447993-6448015 CTTTATCCCAGTTCTGTGAGTGG - Intergenic
1169770919 20:9199323-9199345 CTTTCCACCACTGTTGGGATGGG - Intronic
1171179407 20:23081539-23081561 CTCTCCCCCCGTGGTGGGAGTGG + Exonic
1172206239 20:33164749-33164771 CGTTCCCCCAGAGCTGGCACAGG - Intronic
1172237192 20:33385701-33385723 CTTTCACCCGGGGCAGGGAGAGG - Exonic
1172244835 20:33438736-33438758 CCAGCCCCCAGTGCTGGGATGGG + Intronic
1172905344 20:38364942-38364964 CTTTCTCCCATGGCTGGGTGTGG + Intronic
1173744890 20:45428791-45428813 GCTTCCCAAAGTGCTGGGAGTGG - Intergenic
1173850251 20:46213238-46213260 CCCTCCCCCACTGCTGGCAGAGG - Intronic
1174341076 20:49895858-49895880 CTTTGCCCCAGGGCTAGAAGAGG - Intergenic
1175201496 20:57280923-57280945 CTCTTCCCCAGTGATGTGAGCGG - Intergenic
1175290067 20:57869747-57869769 CTGACCCCCAGGGCTGGGACAGG - Intergenic
1175845210 20:62054646-62054668 CTGGCCAGCAGTGCTGGGAGTGG - Intronic
1175910598 20:62403569-62403591 CTGGCCTCCAGAGCTGGGAGAGG + Intronic
1176220725 20:63968312-63968334 CTCCTACCCAGTGCTGGGAGGGG + Intronic
1178537895 21:33425324-33425346 CCTTCCTCCAGTGCTGTGAGAGG + Intronic
1179253588 21:39696071-39696093 TTTTCCCCCAGTGCTTTGGGAGG - Intergenic
1179430723 21:41319346-41319368 CTTTCCCCCTGTGCTAAGAACGG + Intronic
1179484142 21:41698967-41698989 GTTATCCCCAGTGCTGGGGGTGG - Intergenic
1183485557 22:38086099-38086121 CTGTTCCTCAGTGCAGGGAGGGG - Intronic
1184130278 22:42513278-42513300 CCTTCCCCCTGTGCAGGGATGGG - Intronic
1184140456 22:42575106-42575128 CCTTCCCCCTGTGCAGGGATGGG - Intergenic
1184214985 22:43060622-43060644 CTTTCCTCCTGGGCTGGGATGGG + Intronic
949788726 3:7769815-7769837 ATGTCCCCTAGTGTTGGGAGTGG - Intergenic
950525274 3:13519451-13519473 AACTCCCGCAGTGCTGGGAGAGG - Intergenic
950549791 3:13659174-13659196 CTTTCCCCCTTGGCTTGGAGAGG + Intergenic
952988086 3:38805236-38805258 CTTTCACCCAGTGCTATGAAAGG - Intergenic
954928921 3:54262805-54262827 CCACCTCCCAGTGCTGGGAGTGG + Intronic
955924218 3:63990046-63990068 TTTTCCCCCAGTGCTAGAGGTGG + Intronic
956874173 3:73445784-73445806 CTTTCCCCCATTTATAGGAGAGG - Intronic
958833208 3:99114729-99114751 CTGTCCCCTAGTGCTGAGAGAGG - Intergenic
960497667 3:118394787-118394809 TTTCCCCACAGGGCTGGGAGGGG + Intergenic
960870848 3:122248128-122248150 GTTTCCCCCAGTGCCGAAAGAGG + Intronic
962579210 3:136782497-136782519 ATTGCCCCAACTGCTGGGAGTGG - Intergenic
963466256 3:145686315-145686337 TCTTCCTCCAGTGCTAGGAGAGG + Intergenic
964422954 3:156523816-156523838 CTTTTCCCCAGTGCTACCAGTGG + Exonic
968037450 3:195560034-195560056 CTTTCCCCCAAACCGGGGAGTGG - Intergenic
968487773 4:872212-872234 CTCTCCCCTCGTGCAGGGAGAGG - Intronic
969660089 4:8522327-8522349 CTTTGCCCCAGCTCTGGGCGTGG + Intergenic
971140758 4:23922415-23922437 CTTTCCCCCAGAAATGGCAGTGG + Intergenic
973619271 4:52711502-52711524 CTTTCCCCAGGTGTTGGGGGTGG - Intergenic
976467907 4:85392010-85392032 CTTTCCAGGAGTGCTGGGACTGG + Intergenic
983651363 4:170040136-170040158 CTTTCCCCCACAGCTTGCAGCGG + Intergenic
985662256 5:1163186-1163208 CTCTCCCCCAGTGCTGCCATGGG - Intergenic
994164920 5:96598405-96598427 GTTTTCCCCAGTGCTTGGATGGG - Intronic
995537638 5:113153275-113153297 CTTTCCCCCAGAAGTAGGAGGGG - Intronic
996133509 5:119810132-119810154 CTTGCCTCCACTGCTGGGGGTGG + Intergenic
997285284 5:132673458-132673480 TTGTCCCCCAGTGCTGGGGTAGG + Intergenic
998643360 5:144036743-144036765 CTTTTCCCCAGTGCTGGAGTTGG + Intergenic
999228523 5:150047497-150047519 CCCTCCCCCAGTGCTGGCAGAGG - Intronic
999282073 5:150372582-150372604 CCTTCCCCATCTGCTGGGAGTGG + Intronic
999771050 5:154775769-154775791 GTTTCCTGCAGTGCTGAGAGGGG + Intronic
1002158359 5:177300428-177300450 CTTTCTCCCTCTGTTGGGAGTGG + Intergenic
1003215573 6:4106397-4106419 CTTCCCACAAGTGCAGGGAGGGG - Intronic
1003445269 6:6178062-6178084 CTTTTAAGCAGTGCTGGGAGAGG + Intronic
1004179831 6:13371673-13371695 CATTTCCCAAGTGGTGGGAGAGG + Intronic
1005187413 6:23178668-23178690 ATTTCAACCAGGGCTGGGAGAGG - Intergenic
1005247195 6:23900743-23900765 CCTTCCCCCAAGGCTGGCAGAGG - Intergenic
1005387119 6:25296248-25296270 CTATCTCCCTGTCCTGGGAGAGG + Intronic
1006071199 6:31498962-31498984 ACTTCCCCCGGTGCTGGGGGCGG + Intronic
1006502364 6:34466742-34466764 CCTTCCCCCACAGCTGGGATGGG + Intronic
1007363859 6:41376259-41376281 CCTTCCTCCAGTCCAGGGAGAGG - Intergenic
1007697828 6:43744795-43744817 CCTGTCCCCAGAGCTGGGAGGGG - Intergenic
1007699614 6:43759017-43759039 CAGTCCCCCAGGGCTGGCAGGGG - Intergenic
1012700772 6:102453866-102453888 CATGCCCCCAGTGCTGGCTGGGG - Intergenic
1013294813 6:108749577-108749599 CTTTCCCCCATGGCTGGTGGGGG - Intergenic
1013338176 6:109186582-109186604 ATTTCCCCCACTGCAGGCAGTGG - Intergenic
1014014780 6:116517811-116517833 CCTTCCCCAAGGTCTGGGAGTGG - Exonic
1015256659 6:131185248-131185270 TTTTCCGCCAGTGCTGGGCAGGG + Intronic
1017913907 6:158818295-158818317 CATGCCCGCAGTGCTGGGCGGGG - Intronic
1018423606 6:163661439-163661461 CATTGCCCCAGTGATGGGAAGGG + Intergenic
1018481345 6:164194268-164194290 CTTCCCCCCACTCTTGGGAGTGG + Intergenic
1019111550 6:169720916-169720938 CTTTCCCCCAGCTCTGGCAAAGG - Intronic
1019262270 7:88248-88270 CTCACCTCCAGAGCTGGGAGAGG - Intergenic
1019685491 7:2379723-2379745 CTTTCAGGCAGTGCTGGGTGAGG + Intronic
1019696916 7:2451343-2451365 CTGTCCCGCAGCCCTGGGAGTGG + Intergenic
1022116981 7:27269729-27269751 CTTTCCCTCAGAGCAGGCAGCGG - Intergenic
1023984864 7:45088640-45088662 CTTCCCCGCAGTTCTGAGAGAGG + Intronic
1024414012 7:49081373-49081395 CTTGCCCCCAGGACTGTGAGAGG - Intergenic
1025078317 7:55962529-55962551 CTTTGCCCCAGAGCAGGGAAAGG - Intronic
1025990388 7:66492724-66492746 CTCTGCCCCACTCCTGGGAGTGG - Intergenic
1026933307 7:74237331-74237353 CCTTCCCCCCGTCCTGGCAGAGG - Intronic
1028588659 7:92474865-92474887 CTTCCTCCCACTGCTTGGAGGGG + Intronic
1031603975 7:123747963-123747985 TTTCCCCCCATTGGTGGGAGGGG - Intronic
1033989155 7:147263089-147263111 GTTTCCCAAAGTGCTGGGATTGG - Intronic
1034670154 7:152851739-152851761 CTTTCCCCCAGTGATGGTTAAGG + Intronic
1034825134 7:154255451-154255473 CTTTCCCCCAGTGCTGGGAGTGG - Intronic
1038680422 8:29662401-29662423 CCTTCTCCCAGTTCTTGGAGGGG + Intergenic
1040038900 8:42896982-42897004 CTCTCGCCCAGCGCTGGCAGCGG - Exonic
1041451715 8:58013053-58013075 CTTCCCCCCAGACCTGGGAGGGG + Intronic
1041773661 8:61499741-61499763 TTTTCCCCCAGTGAGGGGACTGG + Exonic
1042737005 8:72000935-72000957 CTCTCCCCCAGTGATGGGCAAGG + Intronic
1044999825 8:97869452-97869474 CTCTCCCCCTGTCCTCGGAGGGG - Intronic
1047499337 8:125430009-125430031 CACGCCCCCAGGGCTGGGAGGGG - Intergenic
1048030987 8:130631931-130631953 CTCTACCCCAGCTCTGGGAGTGG + Intergenic
1048115206 8:131514098-131514120 GTAACCCCCAGTGCTGGAAGTGG + Intergenic
1048405351 8:134113767-134113789 CTGTCCCCAAGTGTGGGGAGGGG + Intergenic
1049088093 8:140493499-140493521 CAGTCCCCCAGTGCTGGGGTGGG + Intergenic
1049526656 8:143130205-143130227 CTTGGCCCCAGGTCTGGGAGAGG - Intergenic
1049783837 8:144441100-144441122 CTTCCCGGCAGTGCTGGCAGTGG - Exonic
1054915412 9:70491080-70491102 CTGTTCCCCAGTGCTGTGAGTGG + Intergenic
1054921076 9:70542745-70542767 CATTCCCTGAGTGCTGGCAGTGG + Intronic
1055307467 9:74944504-74944526 TTTTCCCACAGTCCTGGGGGTGG - Intergenic
1056969425 9:91190192-91190214 CTTACCACCTGTGCTGGGACTGG - Intergenic
1057913201 9:99035956-99035978 CCCTCACCCAATGCTGGGAGAGG + Intronic
1058809975 9:108630213-108630235 TTTACCTCCAGTGATGGGAGAGG - Intergenic
1059195365 9:112366379-112366401 TTTTCCTCCTGTGATGGGAGGGG - Intergenic
1059496944 9:114717842-114717864 AGTTCCTCCAGTGCTGGCAGAGG + Intergenic
1061049727 9:128187340-128187362 TCTTGCCCCAGTGCTGGGATGGG + Intronic
1061929228 9:133823968-133823990 CTCTCCCTCAGTGGTGGGGGTGG + Intronic
1186250445 X:7660323-7660345 CATTCATCCAGTGGTGGGAGAGG + Intergenic
1186567290 X:10676904-10676926 CTATCCCTCAGGGATGGGAGAGG + Intronic
1189106224 X:38238496-38238518 TTTTCCCCTAGAGCTGGGAATGG - Intronic
1190746681 X:53327544-53327566 CTTTCCCCTAGTGGGGGAAGGGG + Intergenic
1190878152 X:54474460-54474482 TGTTCCCTCAGTGCTGGGAAAGG - Intronic
1191065523 X:56343321-56343343 CCATCCCCCATTGCTGGGTGTGG - Intergenic
1199601745 X:149545216-149545238 CTCTCCCTCTGTGCTGGAAGAGG + Intronic
1199601951 X:149546311-149546333 CTTTCCCAGGGTGCTGTGAGTGG - Intronic
1199648435 X:149933173-149933195 CTTTCCCAGGGTGCTGTGAGTGG + Intronic
1199648632 X:149934267-149934289 CTGTCCCTCTGTGCTGGAAGAGG - Intronic
1199672036 X:150155566-150155588 GTTTTCCCCAGTCCTGGGTGGGG - Intergenic