ID: 1034829233

View in Genome Browser
Species Human (GRCh38)
Location 7:154294831-154294853
Sequence AACAAGCCCACAGATTGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034829233_1034829238 0 Left 1034829233 7:154294831-154294853 CCCCGACAATCTGTGGGCTTGTT 0: 1
1: 0
2: 1
3: 7
4: 55
Right 1034829238 7:154294854-154294876 CCACAGCTGGCACCAAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034829233 Original CRISPR AACAAGCCCACAGATTGTCG GGG (reversed) Intronic