ID: 1034829233 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:154294831-154294853 |
| Sequence | AACAAGCCCACAGATTGTCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 64 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 7, 4: 55} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1034829233_1034829238 | 0 | Left | 1034829233 | 7:154294831-154294853 | CCCCGACAATCTGTGGGCTTGTT | 0: 1 1: 0 2: 1 3: 7 4: 55 |
||
| Right | 1034829238 | 7:154294854-154294876 | CCACAGCTGGCACCAAATTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1034829233 | Original CRISPR | AACAAGCCCACAGATTGTCG GGG (reversed) | Intronic | ||