ID: 1034834173

View in Genome Browser
Species Human (GRCh38)
Location 7:154336676-154336698
Sequence CTGACTCACGTGCCCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 105}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034834173_1034834185 25 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834185 7:154336724-154336746 TAGGATTGTGGCAACTGGAAGGG No data
1034834173_1034834179 1 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834179 7:154336700-154336722 GAAGCAGCATGGAAGCGGCTTGG No data
1034834173_1034834178 -4 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834178 7:154336695-154336717 TCAGGGAAGCAGCATGGAAGCGG 0: 1
1: 0
2: 3
3: 41
4: 472
1034834173_1034834184 24 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834184 7:154336723-154336745 GTAGGATTGTGGCAACTGGAAGG No data
1034834173_1034834183 20 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834183 7:154336719-154336741 TTGGGTAGGATTGTGGCAACTGG 0: 1
1: 0
2: 1
3: 8
4: 116
1034834173_1034834180 2 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834180 7:154336701-154336723 AAGCAGCATGGAAGCGGCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 141
1034834173_1034834182 13 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834182 7:154336712-154336734 AAGCGGCTTGGGTAGGATTGTGG 0: 1
1: 0
2: 0
3: 8
4: 82
1034834173_1034834181 6 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834181 7:154336705-154336727 AGCATGGAAGCGGCTTGGGTAGG No data
1034834173_1034834177 -10 Left 1034834173 7:154336676-154336698 CCCACTGTGGGCACGTGAGTCAG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1034834177 7:154336689-154336711 CGTGAGTCAGGGAAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034834173 Original CRISPR CTGACTCACGTGCCCACAGT GGG (reversed) Intronic
904911412 1:33937010-33937032 CTTACTCACGGTCCCACAGGTGG - Intronic
905013171 1:34760487-34760509 CTGACTGTCTTGACCACAGTGGG - Intronic
910719662 1:90272236-90272258 CTGACTAACTTTCCCACTGTTGG + Intergenic
911887952 1:103327379-103327401 CAAACTCACCTGCCCACAGGGGG - Intergenic
915801311 1:158795749-158795771 ATGACACACATTCCCACAGTGGG - Intergenic
916689321 1:167175499-167175521 CTGATGCACAAGCCCACAGTAGG + Intergenic
916732092 1:167575411-167575433 TTGCCTAACATGCCCACAGTGGG + Intergenic
918327669 1:183425889-183425911 CTGGGTCACTTGCCCACACTAGG + Intergenic
920029393 1:203027295-203027317 CTGACTTACGTCCACGCAGTAGG + Intronic
1066580755 10:36878666-36878688 CTGGTTCAAGTGCCCACAGGCGG - Intergenic
1066716796 10:38295524-38295546 CTGACTCACACGCCCAATGTTGG - Intergenic
1067089776 10:43260619-43260641 CAGACTCCCGTGCCCATAGGAGG + Intronic
1075002682 10:118809757-118809779 CTCTCTCACCTGACCACAGTGGG - Intergenic
1075120357 10:119660070-119660092 CTGACTCAGGTGCCCCCAGCAGG + Intronic
1078537801 11:12189067-12189089 CTGACTCAGGTTCTCAGAGTGGG - Intronic
1080626171 11:34032684-34032706 CTGACTCAGTTCCCCACTGTTGG + Intergenic
1082068250 11:47918086-47918108 CTGAGTCACATGCCCACTCTTGG + Intergenic
1083766432 11:64843644-64843666 CTGGCGCCAGTGCCCACAGTGGG + Intronic
1084921560 11:72474917-72474939 CTGATTCAAGTCACCACAGTGGG + Intergenic
1091771216 12:3152410-3152432 CTGACACACCTGCCCCCACTTGG + Intronic
1093525607 12:20101477-20101499 CAGATGCAGGTGCCCACAGTGGG - Intergenic
1101512110 12:105402861-105402883 GTGACTCACTTGCCCACTGTGGG + Intergenic
1106721339 13:32437774-32437796 ATGACTAAGGTGCCCACTGTAGG - Intronic
1107045418 13:35987717-35987739 CTGAGTAACGCGGCCACAGTGGG + Intronic
1107840541 13:44452432-44452454 CTCACCCTCGTGCCCACTGTAGG - Intronic
1112215726 13:97429920-97429942 CTGAGTCACGTGCCTACTTTTGG + Intergenic
1114169960 14:20262421-20262443 CTGTTTCATGTGTCCACAGTGGG - Intronic
1117243333 14:53857961-53857983 CTGACCCACGTGCCCTAAGCAGG + Intergenic
1119129290 14:72156788-72156810 CTGATTGGCGTGCCCACACTGGG + Intronic
1120077658 14:80177845-80177867 CAAACTCACTGGCCCACAGTTGG - Intergenic
1122610808 14:102982034-102982056 CTGACCCAAGAGCCCACAGGTGG + Intronic
1124511553 15:30331637-30331659 CTGACTAAGCTGCCCACAGGAGG + Intergenic
1124731361 15:32199120-32199142 CTGACTAAGCTGCCCACAGGAGG - Intergenic
1124907942 15:33889386-33889408 CAGACTCACAAGCCAACAGTGGG - Intronic
1129633903 15:77293568-77293590 CTGACTAACGTGGCCAGCGTTGG - Intronic
1132805927 16:1775139-1775161 CTCACTCTCATGCCCACAGCAGG + Intronic
1135559251 16:23462878-23462900 CTGACTCCCCAGCCCACACTTGG + Intergenic
1135559271 16:23463088-23463110 CTGACTCCCCAGCCCACACTTGG + Intergenic
1135735522 16:24928685-24928707 CTGGCTAAGGGGCCCACAGTAGG + Intronic
1141429053 16:83961565-83961587 CTGGCTCACGGGCTCACTGTGGG - Intronic
1142140106 16:88469001-88469023 CAGACCCACGTGGCCTCAGTTGG + Intronic
1144428481 17:15168696-15168718 CTGACCCAGATACCCACAGTTGG + Intergenic
1146687912 17:34853965-34853987 GTGTCTCACGTCCCCACAGTGGG + Intergenic
1148220543 17:45858707-45858729 CTGACTCAGGTGCCCACCCCAGG + Intergenic
1148975228 17:51521647-51521669 CAAACTCACGAGCCCACTGTGGG - Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161377880 19:3949531-3949553 GGGATTCTCGTGCCCACAGTGGG + Intergenic
1162058222 19:8078160-8078182 CAAACTCACATGGCCACAGTAGG - Intronic
1162444294 19:10712850-10712872 CTGCCCCACGTGCCAAAAGTAGG + Exonic
1164669215 19:30063339-30063361 CAGCCTCACCTGCCCACAGGCGG + Intergenic
1165022478 19:32935906-32935928 CTGGAGCAGGTGCCCACAGTGGG - Intronic
1166151989 19:40881496-40881518 CTGACTCTCCTGCCCACTGGAGG - Intronic
1166170872 19:41027009-41027031 CTGACTCTCCTGCCCACTGAAGG - Intergenic
1166178177 19:41089162-41089184 CTGACTCTCCTGCCCACTGGAGG + Intronic
1166687270 19:44802839-44802861 CTGAGTCAGGTGCCCACTCTGGG - Intergenic
1167772850 19:51531573-51531595 CCCACTCACCTGCCCACAGCAGG + Exonic
1168394867 19:56039177-56039199 CTGTGTCACTTGTCCACAGTTGG + Intronic
927173488 2:20389538-20389560 CTCACTCTTGTCCCCACAGTGGG + Intergenic
928399833 2:30969751-30969773 TTGGCTCACGTACCCACAGCTGG - Intronic
933455009 2:82508732-82508754 CAGACACAGGTGCCCACAGCAGG + Intergenic
933646302 2:84815354-84815376 ATGACTCAGATGCCCACAATTGG + Intronic
942066623 2:172277621-172277643 CTGACTCAGGTGCCCAAATTAGG + Intergenic
945272982 2:207960447-207960469 CTTACTCACCTGGCCACAGCTGG - Intronic
947569654 2:231222529-231222551 AAGATTCAAGTGCCCACAGTAGG - Intronic
947747903 2:232518779-232518801 CTGATTCCTGTGCCCACAGCTGG - Intergenic
1170325939 20:15154412-15154434 GTGACTCATCTGCCCAAAGTAGG - Intronic
1172207589 20:33175317-33175339 CTGACTCATGTCCACACAGGTGG + Intronic
1172970853 20:38872120-38872142 CTGACTTAAGTGCCCTCAGCAGG - Intronic
1174380078 20:50150617-50150639 CTGTCTCACGTGCCCAGTGGTGG - Intronic
1175774812 20:61646437-61646459 CTGACACCCATGCCCACAGCCGG - Intronic
1178477486 21:32950135-32950157 CTGTCTCATGTGCCCAGGGTTGG + Intergenic
1178900844 21:36597326-36597348 CTGACGCACGTGGCAGCAGTGGG - Intergenic
1182715166 22:32352514-32352536 CTGACTCAGGTGCCAGCAGGAGG + Intergenic
1183821509 22:40349943-40349965 ATGGCTCACGTGCACACATTTGG + Exonic
1185092135 22:48781588-48781610 CCGACCCACCTGCCCACTGTGGG + Intronic
950904552 3:16525875-16525897 CTGGTTCACATGCCCACCGTTGG + Intergenic
953730533 3:45443637-45443659 GTGACTCACCTGCCCAGAGGAGG - Intronic
953880951 3:46691071-46691093 CTGCCTCAGGGGCCCACAGAGGG - Intronic
955879526 3:63529029-63529051 CTGACCCCCTTGCCCACAGTGGG + Intronic
956692601 3:71891708-71891730 CTGAGTCACTTGCCCACTTTTGG + Intergenic
969903404 4:10370914-10370936 CTGATTCACCTGCCCACACGTGG + Intergenic
974803323 4:66847455-66847477 CGGACTCACATGACCACCGTAGG + Intergenic
981000894 4:139828046-139828068 CTGACACACTTGCACATAGTAGG + Intronic
985524567 5:395406-395428 CTGACTCACCAGCCCAGAGCAGG + Intronic
985826949 5:2199617-2199639 CTCACACACATGCCCACCGTTGG + Intergenic
987476036 5:18393536-18393558 CTCACACAGGTGCTCACAGTGGG - Intergenic
990050382 5:51492949-51492971 CTGTCTAACGTTCCCTCAGTAGG - Intergenic
1001522554 5:172405029-172405051 CTGAGTGACTGGCCCACAGTAGG + Intronic
1002323632 5:178390568-178390590 GTAACTCAGGTGCCCACAGATGG - Intronic
1003088795 6:3083628-3083650 CCGACTCAAGTGCCCACAGTAGG - Intronic
1006637807 6:35473191-35473213 CTGAGCCACCTGTCCACAGTAGG - Intergenic
1007782025 6:44259898-44259920 CAGGCTCAAGTTCCCACAGTTGG + Intronic
1011557523 6:88586254-88586276 CTCAATCACGTGCCCACAAAAGG + Intergenic
1012867831 6:104639167-104639189 CTGGCTCACTTGCCCACAGCTGG - Intergenic
1017700100 6:157061057-157061079 CTGAGTCACGAGTCCACAGGAGG - Intronic
1024586925 7:50849999-50850021 CAGCCTCACATTCCCACAGTTGG + Intergenic
1028155899 7:87429126-87429148 CTGACTCTCAGGCTCACAGTGGG + Intronic
1030754095 7:113267939-113267961 CTGACTCACAGGTCCACATTGGG - Intergenic
1034834173 7:154336676-154336698 CTGACTCACGTGCCCACAGTGGG - Intronic
1035835783 8:2750149-2750171 CTGCCTCAGGTGCCCAGACTGGG + Intergenic
1036823436 8:11957658-11957680 CTGTCTCATGGGCCCACAGCAGG + Intergenic
1040471558 8:47738641-47738663 CTCACGCGCGTGCCCACGGTCGG - Exonic
1041551041 8:59101971-59101993 CATCCTCACCTGCCCACAGTGGG - Intronic
1045760117 8:105595457-105595479 CTGTCTCAGATGCCCACAGAAGG + Intronic
1049474946 8:142792824-142792846 CTGACTCACTTGCCCAGAGGAGG - Intergenic
1056795715 9:89657405-89657427 CTGGCTCAGGTGTCCACAGTTGG + Intergenic
1056967915 9:91179682-91179704 CTGACTCACTGGCCCAGAGTGGG + Intergenic
1058733128 9:107869205-107869227 CTGACTTCCGTGCCTACAGAAGG - Intergenic
1059390227 9:113994537-113994559 CTTATTCAAGTCCCCACAGTAGG - Intronic
1061386127 9:130290250-130290272 CTGACCCTCTTGCCCACAGCAGG - Intronic
1061630819 9:131871088-131871110 CTGAATCCCGGGCACACAGTGGG - Intronic
1186194629 X:7098555-7098577 CTGACTGACATGCCCACTGTGGG - Intronic
1187251914 X:17606318-17606340 CTGACTCACAAGACCACTGTAGG - Intronic
1190874259 X:54448769-54448791 CTGACTAACTCTCCCACAGTGGG - Intronic
1191849062 X:65572115-65572137 CTAACTCAAGTGCCCAGAGGAGG - Intergenic
1199070601 X:143470680-143470702 CTGACTCACCTCACAACAGTGGG - Intergenic
1200766048 Y:7081690-7081712 GTGTCTCACGTGGCCAAAGTAGG + Intronic