ID: 1034838212

View in Genome Browser
Species Human (GRCh38)
Location 7:154372033-154372055
Sequence CTAGGGCACCTGTTCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034838212_1034838221 8 Left 1034838212 7:154372033-154372055 CCCAGAGAGAACAGGTGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1034838221 7:154372064-154372086 AGACCACCCCCCGGGGAGTGGGG No data
1034838212_1034838219 6 Left 1034838212 7:154372033-154372055 CCCAGAGAGAACAGGTGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1034838219 7:154372062-154372084 TGAGACCACCCCCCGGGGAGTGG No data
1034838212_1034838216 -1 Left 1034838212 7:154372033-154372055 CCCAGAGAGAACAGGTGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1034838216 7:154372055-154372077 GCAGAGATGAGACCACCCCCCGG No data
1034838212_1034838218 1 Left 1034838212 7:154372033-154372055 CCCAGAGAGAACAGGTGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1034838218 7:154372057-154372079 AGAGATGAGACCACCCCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 81
1034838212_1034838217 0 Left 1034838212 7:154372033-154372055 CCCAGAGAGAACAGGTGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1034838217 7:154372056-154372078 CAGAGATGAGACCACCCCCCGGG 0: 1
1: 0
2: 3
3: 16
4: 195
1034838212_1034838220 7 Left 1034838212 7:154372033-154372055 CCCAGAGAGAACAGGTGCCCTAG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1034838220 7:154372063-154372085 GAGACCACCCCCCGGGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034838212 Original CRISPR CTAGGGCACCTGTTCTCTCT GGG (reversed) Intronic
900351179 1:2235407-2235429 CTGTGCCACCTGTTCTCTCGAGG + Intronic
906528103 1:46508204-46508226 CATGGGCACCTGTTCTCCCTAGG - Intronic
906762245 1:48386772-48386794 CCAGGGGAAGTGTTCTCTCTTGG - Intronic
906967525 1:50473000-50473022 CTAGAGCATCTGTTCTCATTTGG + Intronic
907185236 1:52603902-52603924 TCAGGCCTCCTGTTCTCTCTAGG + Intronic
908000791 1:59676909-59676931 CGATGTCACTTGTTCTCTCTGGG + Intronic
919329722 1:196155837-196155859 CTGGGGCACATGTTCTCTACAGG + Intergenic
922648934 1:227319426-227319448 CTAGGGCACCTGATCCCTGTAGG + Intergenic
1063098206 10:2926748-2926770 CTAGGGCACAAATTCTCTCCTGG + Intergenic
1071575804 10:86725224-86725246 CCAGGGCAGCTGTCCTCTCTAGG - Intronic
1076472632 10:130729394-130729416 GTAGGTCATCTGCTCTCTCTGGG - Intergenic
1076739824 10:132477653-132477675 CTCTGGCTCCTGTTCTCTCCTGG - Intergenic
1077035301 11:491545-491567 ATCTGGCACCTGCTCTCTCTGGG - Intergenic
1077421461 11:2452089-2452111 CCAGGGAACCTGCACTCTCTGGG - Intronic
1078003192 11:7513837-7513859 CTTGGGCACCCGCTCCCTCTCGG - Exonic
1079085959 11:17445096-17445118 GTAAGGCACCTGCCCTCTCTGGG + Intronic
1083863999 11:65443769-65443791 CTAGGGCTGCTGTTTTCCCTTGG + Intergenic
1084632133 11:70359957-70359979 CCAGAGCCCCTGTTTTCTCTGGG - Intronic
1085031361 11:73272800-73272822 CAAGGGCACTTTTCCTCTCTGGG + Intronic
1086828579 11:91531045-91531067 CAAGGGCAGCTGTTCACTTTAGG + Intergenic
1089559247 11:119335420-119335442 CTGGGGCACCTGGCCTCTCATGG + Exonic
1089645602 11:119876613-119876635 GTAGGGTACCTGTGCCCTCTGGG - Intergenic
1089665234 11:120013938-120013960 CCTGGGTACCTGTTCTCCCTTGG - Intergenic
1091583934 12:1805355-1805377 CAAGAGCACCCCTTCTCTCTGGG - Intronic
1092070263 12:5626263-5626285 CAAGGGCCCCTGCTCTCCCTGGG - Intronic
1096634569 12:52949998-52950020 CTAGTGCACCTGGTCACTCTGGG - Intronic
1097202639 12:57292574-57292596 CTCGGGCAAATATTCTCTCTCGG + Intronic
1099170299 12:79355963-79355985 CCATAGCACCTGTTATCTCTTGG - Intronic
1102345856 12:112161042-112161064 CCAGGGCACATCTTCTTTCTTGG + Exonic
1102450858 12:113041046-113041068 CGAGGCCACGTGCTCTCTCTGGG + Intergenic
1103888823 12:124223150-124223172 CCTGGGCAGCTGTTCTCTCCCGG - Intronic
1105050670 12:133047680-133047702 CTATGGCACCTGTCTTCTCATGG + Intronic
1107305331 13:39013002-39013024 CAACGGCAGCTGTTCTCTCAGGG - Exonic
1107409582 13:40146126-40146148 CTGGGGGACCTGTTCTTTCCTGG - Intergenic
1108912240 13:55569662-55569684 TTCTGGCACCTCTTCTCTCTTGG + Intergenic
1109513701 13:63413433-63413455 CTATGGCACCTGGTCCCTCATGG - Intergenic
1118699947 14:68423275-68423297 CTAAGGCACCTGGTATGTCTGGG + Intronic
1118888609 14:69887991-69888013 ACAGGGCACCCTTTCTCTCTGGG + Intronic
1119701546 14:76759085-76759107 TTAAGTCACTTGTTCTCTCTGGG + Intergenic
1120044818 14:79794080-79794102 GTGAGCCACCTGTTCTCTCTAGG - Intronic
1120185004 14:81385188-81385210 CTAGGCCACATGGCCTCTCTGGG + Intronic
1120758266 14:88264219-88264241 CTAAGGTCCCTGTTCTCTGTAGG + Intronic
1121467975 14:94128229-94128251 CAAGGTCCCCTGTCCTCTCTGGG - Intronic
1122919901 14:104875751-104875773 CTAGGGCACCTGTCCTCCGGGGG + Intronic
1125796683 15:42408845-42408867 CCAGGGCCCCTCTTCTGTCTGGG + Intronic
1127569903 15:60231728-60231750 CTAGGCCTCCTGTTGTTTCTGGG + Intergenic
1130283601 15:82538067-82538089 CCAGGACACCTTTTCTCTCTTGG - Intronic
1135166779 16:20146199-20146221 CTAGGGCACCTGTTCCCAAAGGG - Intergenic
1138457976 16:57132227-57132249 CTGGGGCAGGAGTTCTCTCTGGG - Intronic
1139729276 16:68928812-68928834 ATAAGCCACCTGTTTTCTCTGGG + Intronic
1140079740 16:71734422-71734444 CTAAGCCACCTGATGTCTCTGGG + Intronic
1143329287 17:6121708-6121730 ATAGGGGCCCTGTTCTCTCTGGG + Exonic
1145211810 17:21018919-21018941 CTTGAGCACCTGTTCTCTGCAGG - Intronic
1146886368 17:36473650-36473672 GGAGGACACCTGTTTTCTCTTGG - Intergenic
1147991823 17:44338715-44338737 CTCGGTCACCTGTCCTTTCTGGG - Intergenic
1149193662 17:54093647-54093669 CTAGGGCACCAGTGCTCTTCAGG - Intergenic
1149862708 17:60132449-60132471 CTAAGTCACGTGATCTCTCTGGG + Intergenic
1150507451 17:65713941-65713963 CAAAGCCACCTCTTCTCTCTCGG + Intronic
1203161162 17_GL000205v2_random:51485-51507 CTGGTCCACCTGCTCTCTCTGGG + Intergenic
1156360128 18:36377652-36377674 CTCGGGCACCTGGCCCCTCTGGG + Intronic
1156423342 18:36980234-36980256 CTAAGGCAGCTGGTCTCTCATGG + Intronic
1156961505 18:43037214-43037236 CTAGGACAACTGTTCTTACTTGG - Intronic
1160023035 18:75195524-75195546 ACCGGGCACCTTTTCTCTCTGGG + Exonic
1161608281 19:5226836-5226858 CTAGGGTTACTGTTCTCTGTGGG + Intronic
1161886662 19:7001852-7001874 CTAGGGTACATGTGCACTCTTGG - Intergenic
1161895645 19:7077626-7077648 CTTGAGCACCTGTTTTCTCTTGG + Intronic
1163804268 19:19386411-19386433 CTAGGGGACCCCGTCTCTCTTGG + Intronic
1163804328 19:19386624-19386646 CTAGGGGACCCCGTCTCTCTAGG + Intronic
1164761705 19:30733112-30733134 CAAGGGTACCTGTTATCTATGGG - Intergenic
1165890647 19:39110268-39110290 CTGGGGCAGCTGTTCCCTCCTGG + Exonic
1168260980 19:55194396-55194418 CTAGAGGACCTGTTCTCTCAGGG + Intronic
1168346087 19:55650866-55650888 CCAGGGCCCCTGATTTCTCTCGG + Intronic
1168667004 19:58211665-58211687 TTTGGGCACCTGGTCTCTGTGGG + Exonic
926633400 2:15157664-15157686 CAAGACCACCTCTTCTCTCTAGG - Intergenic
934761742 2:96860520-96860542 CACGGGCACCTGCTCTGTCTGGG - Exonic
935730651 2:106062532-106062554 TTAGATCACCTGTCCTCTCTAGG - Intergenic
937200797 2:120203530-120203552 CTGGGGCACCTTGTTTCTCTAGG + Intergenic
937886629 2:126903750-126903772 CCAGGGCACCCCTTCTCTCCAGG - Intergenic
938199796 2:129363317-129363339 ATTGGCCACCTGTTCACTCTGGG + Intergenic
942126615 2:172832147-172832169 TTTGGGCACCTGTTGTCTTTTGG + Intronic
944847181 2:203680817-203680839 CCAGGGCTACTGTTCTTTCTGGG - Intergenic
947282440 2:228470280-228470302 GTTGGGCACCTGTGCACTCTAGG - Intergenic
948255423 2:236564843-236564865 GCAGGTCACCTGGTCTCTCTGGG + Intergenic
1169936518 20:10889592-10889614 TGAGGGCACCTGATGTCTCTGGG + Intergenic
1172301710 20:33855066-33855088 CTGGGGCTCCTGTTCTCACCTGG + Intergenic
1175189058 20:57199039-57199061 CCTGGGCACCTGTCTTCTCTGGG + Intronic
1176943947 21:14956241-14956263 CTAGGGCTCATGATCTATCTGGG - Intergenic
1179342155 21:40522517-40522539 CTAGGTCACGTTTTCTCTTTGGG + Intronic
1179615780 21:42582318-42582340 ACAGGGCACCTCTTCCCTCTGGG + Intergenic
1180710141 22:17833859-17833881 CCAGGACAGCTGTACTCTCTTGG - Intronic
1182001770 22:26925842-26925864 GTAGGGCAGATGTCCTCTCTGGG - Intergenic
1183521271 22:38297481-38297503 CTTGGGCTTCTCTTCTCTCTGGG - Intronic
950523918 3:13512633-13512655 CCAAGGCTCCTGCTCTCTCTGGG - Intergenic
954646880 3:52137111-52137133 CTAGTGGGCCTGTTCTCCCTGGG - Intronic
954689318 3:52387346-52387368 CTTGGGCACGTGGTCTCTCGGGG + Intronic
956267930 3:67418646-67418668 CCAGGGCTCCTGTTCTCCCATGG - Intronic
960902701 3:122567759-122567781 GGAAGGCACCTGTGCTCTCTGGG - Intronic
962740021 3:138356808-138356830 CCAGGGCACCTGGCCTCTCCTGG - Intronic
963009076 3:140752538-140752560 CCAGGGCACATGTTCTTTCCAGG + Intergenic
963493588 3:146032208-146032230 CTAAGGAACCTGTCCTCTGTGGG - Intergenic
966474792 3:180331703-180331725 CTAGCTCTCCTGTTCTCTGTTGG + Intergenic
969879042 4:10157852-10157874 CTAGGGCACATGATCTTTGTTGG + Intergenic
970368859 4:15388164-15388186 CTCTGGCACCTCTTCTCTCCTGG - Intronic
972808325 4:42554431-42554453 CTAGACCACCTCTTCCCTCTTGG - Intronic
974915155 4:68170477-68170499 CTAGGACAACTATTCTATCTTGG + Intergenic
976121722 4:81790733-81790755 CTTGGGGTGCTGTTCTCTCTTGG - Intronic
977996097 4:103498573-103498595 CTAGAGCAGCTGTTCTCTTGCGG + Intergenic
982694501 4:158584024-158584046 CTAGGGCACCTCTGCTCTTGTGG + Intronic
982795581 4:159639932-159639954 CTAAGGAATGTGTTCTCTCTTGG - Intergenic
982904323 4:161048806-161048828 CCAGGGCCCCTGTACTCTATGGG - Intergenic
984436553 4:179717571-179717593 ACAGGGCACCTGATCTCTCAAGG + Intergenic
985726954 5:1521737-1521759 TTTGGGCAGCTGTTCTCCCTTGG - Intronic
986007692 5:3681867-3681889 CTAGGTCCCCAGTTCTCTCCTGG + Intergenic
989530450 5:42501787-42501809 CTAGGGCACTTTTTGCCTCTGGG - Intronic
991713130 5:69427822-69427844 CCACTGCACCTGTTCTCTATTGG - Intronic
993035830 5:82756222-82756244 GAAGGAGACCTGTTCTCTCTAGG - Intergenic
997163164 5:131630972-131630994 CTAGGGCACCACCACTCTCTCGG + Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999329168 5:150661154-150661176 CCAGGGCACCTGTCTTCCCTAGG + Intronic
1001453414 5:171843144-171843166 CTAGGGCACCTGCTAACACTTGG - Intergenic
1004529901 6:16444222-16444244 CCAGGGGAACTGTTCTCACTGGG - Intronic
1004662423 6:17722035-17722057 CAAGGGCACCTGTGTCCTCTGGG + Intergenic
1005138061 6:22594273-22594295 CTAGGGCAAATTTGCTCTCTTGG + Intergenic
1006939739 6:37743868-37743890 TTTGGGCACCTGTTCTCTTCAGG + Intergenic
1011215891 6:85005223-85005245 TTAGGGCAACTGTTCTCTCTGGG - Intergenic
1011698026 6:89930654-89930676 CAAGGGAAGCTGCTCTCTCTGGG + Exonic
1012997199 6:105985725-105985747 CCAAGGCACTTGATCTCTCTGGG + Intergenic
1014619044 6:123642966-123642988 CGAGGGCAGCTATTCTCTATAGG + Intergenic
1016355342 6:143212169-143212191 CTAGGGCAATTTTGCTCTCTGGG - Intronic
1018232476 6:161688822-161688844 CAAGGGCAGCTGTTGTCTGTTGG - Intronic
1018442443 6:163825542-163825564 CTGGGGCACCAGTTCTTCCTTGG + Intergenic
1021162585 7:17295128-17295150 GCAGGGCACTTGATCTCTCTGGG + Intergenic
1022094200 7:27129021-27129043 CCTGGACAACTGTTCTCTCTTGG + Exonic
1023146928 7:37160691-37160713 CCCAGGCACCTGTTCTCTCAAGG - Intronic
1023270598 7:38457601-38457623 CTAGCCCATTTGTTCTCTCTTGG - Intronic
1023873890 7:44276609-44276631 CTGGGGCACCTGGTCTCCCCAGG - Intronic
1023997981 7:45173774-45173796 CCAGGGCACCTGCTTTCCCTTGG + Intronic
1024668579 7:51569367-51569389 CTGGATCACCTGTGCTCTCTGGG - Intergenic
1026889118 7:73971913-73971935 CTAAGGCATCGGTGCTCTCTGGG + Intergenic
1027437866 7:78184226-78184248 CTAGGTCCCATTTTCTCTCTGGG + Intronic
1031458278 7:122011592-122011614 CAAGGGCACCTTATCACTCTCGG - Exonic
1031581126 7:123476384-123476406 CGAGAGCACCTGGTCTTTCTGGG + Intronic
1032614057 7:133446950-133446972 CTTTGCCACCTGTCCTCTCTAGG + Intronic
1033471397 7:141652974-141652996 CTGAGGCACCTGTTCCCTTTTGG - Exonic
1034073265 7:148208169-148208191 CTTTTGCATCTGTTCTCTCTTGG - Intronic
1034694676 7:153043107-153043129 CTTGGGCACCTGTGCTGTGTGGG + Intergenic
1034838212 7:154372033-154372055 CTAGGGCACCTGTTCTCTCTGGG - Intronic
1035324157 7:158054127-158054149 CTAGGGCCCCCATGCTCTCTAGG - Intronic
1036201759 8:6776180-6776202 CTAGGGAACCTGTTCCACCTGGG + Intergenic
1038360276 8:26868516-26868538 CTAAGTCACCTGCTCTCTCTGGG + Intergenic
1043986296 8:86696297-86696319 CTACTGCAGCTGTACTCTCTTGG - Intronic
1045061578 8:98415969-98415991 CTAGGGCACTTGTACTCCATGGG + Intronic
1045331111 8:101156412-101156434 TTTGGGTAGCTGTTCTCTCTGGG + Intergenic
1045753649 8:105515788-105515810 GTAGGGGAGCTCTTCTCTCTAGG + Intronic
1047569697 8:126084462-126084484 CTAGGACATCTGTTCACCCTGGG + Intergenic
1047823920 8:128552296-128552318 ATAGGGCACCTGTTATCCCAAGG - Intergenic
1048313960 8:133348553-133348575 CCAGGGCAGCTCTTCTCTCTGGG + Intergenic
1048733775 8:137474560-137474582 CTAGGGCACCTAGTTTCTGTCGG - Intergenic
1049477883 8:142805332-142805354 CTGGGACACCTGTGCTCTCTGGG - Intergenic
1052850209 9:33373585-33373607 CCAGGGAACCTGTTCCTTCTGGG - Intergenic
1053449478 9:38181163-38181185 CTAGGGGACCTGTGCTTCCTGGG + Intergenic
1057636191 9:96770074-96770096 TTTGGACACCTGTTTTCTCTTGG - Intronic
1058669795 9:107351228-107351250 CTCTGGCACCTGTTCTTCCTTGG - Intergenic
1060602963 9:124890224-124890246 CGTGGGCCCCTGTGCTCTCTAGG - Intronic
1061088182 9:128411540-128411562 CCAGGCCAGCTGTTTTCTCTGGG - Intergenic
1062283381 9:135761906-135761928 CTGGGGCTCCTCTTCGCTCTGGG - Intronic
1062464833 9:136676347-136676369 CAAGGGCAGCTGGTCACTCTGGG + Intronic
1190399305 X:50015609-50015631 CATGGGCACCTGTACTCCCTAGG - Intronic
1191612747 X:63134584-63134606 TTACGGCACATGTTCTCACTTGG + Intergenic
1191623550 X:63244342-63244364 TTACGGCACATGTTCTCACTTGG - Intergenic
1195628486 X:107029344-107029366 CTAGGGAACCACTTCCCTCTTGG - Intergenic