ID: 1034840706

View in Genome Browser
Species Human (GRCh38)
Location 7:154392837-154392859
Sequence GGGCCCTCCCCAAAGTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034840706 Original CRISPR GGGCCCTCCCCAAAGTCCCA TGG Intronic
900168826 1:1256417-1256439 TGGCCCACCCCAAGATCCCAAGG + Intronic
900473294 1:2864822-2864844 GTGTCCTCCCCACAGTCTCATGG - Intergenic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
902922068 1:19672038-19672060 GGACCCTCCACAATCTCCCAAGG - Intronic
903214412 1:21835567-21835589 GGGCCTTCCCCCAAGGTCCATGG + Exonic
903479331 1:23641678-23641700 GGGCACTCCACAAAATGCCAAGG - Intergenic
903590644 1:24453312-24453334 GGGCCATCACCAGAGTCACAGGG - Intronic
903797590 1:25941517-25941539 GGACCCTCTGCAGAGTCCCAAGG + Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
904901533 1:33861637-33861659 GGACCCTGACCAAAGTACCATGG - Intronic
905345512 1:37308667-37308689 GGGCACTGGCCAAAGTCCCAAGG - Intergenic
905397147 1:37674115-37674137 GGGCTGTCGCCACAGTCCCAGGG + Intergenic
905685092 1:39902054-39902076 GGGCCCGCCCCCCAGTCCCTGGG - Intronic
907626178 1:56032390-56032412 GCACCCTCCCTAAAGGCCCAGGG + Intergenic
911143740 1:94532879-94532901 GGGCCCTGCCCAGAGTCACAGGG + Intronic
913195409 1:116452382-116452404 GGACCCTTCCCAAGGTCCCCTGG - Intergenic
914747596 1:150511321-150511343 TGGGCCTCCCCAATGTGCCAGGG + Intronic
915146589 1:153799302-153799324 ATGACCTGCCCAAAGTCCCATGG - Intergenic
917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG + Exonic
918781227 1:188702937-188702959 GGGAACTCCACAGAGTCCCAAGG + Intergenic
919785182 1:201254165-201254187 GGGCCTTGCCCTGAGTCCCACGG + Intergenic
921133238 1:212237631-212237653 GGACCCTCTGCAGAGTCCCAAGG + Intergenic
923336489 1:232975542-232975564 GGGCCCTTCCCACAGTTTCAAGG - Intronic
1062834084 10:624619-624641 GGGCGGGCTCCAAAGTCCCACGG + Intronic
1063128346 10:3155076-3155098 AGGCCCTCCCCAGAGCCACAGGG + Intronic
1064277616 10:13921095-13921117 GAGCCCTCACCAAAATCCAATGG - Intronic
1067027648 10:42858389-42858411 GCGTCACCCCCAAAGTCCCAAGG + Intergenic
1067067149 10:43110633-43110655 AGGCTCTGCTCAAAGTCCCAGGG + Intronic
1068650741 10:59519835-59519857 CTGCCCCCTCCAAAGTCCCATGG - Intergenic
1069521198 10:69123493-69123515 GCGCTCCCCCGAAAGTCCCACGG - Exonic
1069954328 10:72040532-72040554 TGGCCCTCCCCAAGGCCCCTGGG - Intergenic
1069995085 10:72336940-72336962 GGCCTCTCCCCAAAGGCCCCAGG - Intronic
1071570711 10:86695312-86695334 GGTCCACCCCCAGAGTCCCAGGG + Intronic
1072552075 10:96486828-96486850 AGCCCCTTCCCAAAGTCACAGGG + Intronic
1074535405 10:114325291-114325313 GGGGCCCCTCCACAGTCCCAGGG + Intronic
1074777053 10:116774482-116774504 GGGCCCTACCCAGAGTCTCTGGG - Intergenic
1075737995 10:124675819-124675841 GGGCCTTGCCCAAAGTCACATGG - Intronic
1076437268 10:130454763-130454785 GGGACCTCCCCACAACCCCAGGG - Intergenic
1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG + Intergenic
1076849557 10:133086330-133086352 GAGCCCTGCCCTGAGTCCCACGG - Intronic
1076901387 10:133340167-133340189 GGGCCCCCCCCAGAGTCTCCAGG + Intronic
1077282078 11:1750379-1750401 CGACCCTCTCCAAAGTCCCCCGG + Exonic
1077366724 11:2164193-2164215 GGGCCCTTCCCAACCTCCCCTGG - Exonic
1077394524 11:2314628-2314650 GGGCCCAACCCCAAGACCCAGGG + Intronic
1077704061 11:4467332-4467354 GGGGCCTCCCTACAGTCTCAAGG - Intergenic
1078170480 11:8925586-8925608 GGGCCCTCCCCAGAGACTGATGG - Exonic
1080144116 11:28958940-28958962 GGGCTCTCTGCAGAGTCCCAAGG - Intergenic
1080331174 11:31140884-31140906 GTGCCCTCTCCAAAGCCCTAAGG + Intronic
1080590552 11:33719758-33719780 GGGCCCTGCCCACAGGCCCCAGG - Intronic
1081824775 11:46038667-46038689 GGACTCTCTGCAAAGTCCCAAGG + Intronic
1082200175 11:49357373-49357395 ATGCCCTACCCAAAGTCACATGG + Intergenic
1083707971 11:64529736-64529758 GGGCCCTCCCCACAGTGCTCAGG + Intergenic
1084432988 11:69121891-69121913 GGGGCCTCCCCAGAGTCCCTGGG - Intergenic
1084773523 11:71359746-71359768 GGGGCCTCCTCAAAGTCACATGG - Intergenic
1084968258 11:72755670-72755692 CACCCCTCCCCAAAATCCCAAGG + Intronic
1086655497 11:89348823-89348845 ATGCCCTACCCAAAGTCACATGG - Intronic
1086776912 11:90847866-90847888 GGACCCTGCCCAAAGTACTAGGG - Intergenic
1089633025 11:119795122-119795144 GGGCCCTTTCCAGGGTCCCATGG - Intergenic
1091677677 12:2503179-2503201 GGGCCTTCCCCACAGTGTCAGGG + Intronic
1096656639 12:53096658-53096680 AGTCCCTCCCCAAAGTCCCCTGG + Intergenic
1096760847 12:53840643-53840665 AGGCCATCCCCAAAGTGCCCAGG - Intergenic
1099286453 12:80718196-80718218 TAGCCCTCTCCAAATTCCCAGGG - Intronic
1100097752 12:91064268-91064290 GAGCTCTCCCCAAAATCACAAGG - Intergenic
1102236797 12:111298756-111298778 CTGCCCTCCCCAAGCTCCCAGGG + Intronic
1104016211 12:124964252-124964274 GGGAGCACCCCAAAGTCACAGGG + Intronic
1104464886 12:128982229-128982251 CAGCCCTACCCCAAGTCCCAGGG - Intronic
1104638205 12:130450851-130450873 GGGCCCTCCCCAACCTCCACAGG + Intronic
1104972584 12:132538613-132538635 GCACCCTCCCCACAGTGCCAAGG - Intronic
1106691132 13:32117922-32117944 GGGAGCTGCCCAAAGTCACATGG - Intronic
1108470610 13:50763186-50763208 GAGCCCTCCCCAGCGTCCCCAGG - Intronic
1108623515 13:52206164-52206186 GGTCCCTTCCCACAGCCCCAAGG + Intergenic
1108663202 13:52604880-52604902 GGTCCCTTCCCACAGCCCCAAGG - Intergenic
1114650865 14:24283960-24283982 GGGTCCTCCTCAGAGCCCCATGG - Intergenic
1116965539 14:51010974-51010996 TGCCCCTCCCCACAGCCCCACGG + Intronic
1119435508 14:74595423-74595445 TGTCCATCCCCACAGTCCCAAGG + Intronic
1119479946 14:74952966-74952988 GGGTCCTTCCCCAAATCCCAAGG + Intronic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121748062 14:96318368-96318390 GTGACCTTCCCAAAGTCACATGG + Intronic
1121752480 14:96369136-96369158 GGGCCTTCCACAAAGCCCTAGGG - Intronic
1123845395 15:24295859-24295881 AGGTTCTCCCCAAAGTCACAAGG + Intergenic
1123864440 15:24503655-24503677 AGGTTCTCCCCAAAGTCACAAGG + Intergenic
1128147065 15:65337642-65337664 GCCCCCTCCCCCAAGTCCCTGGG - Intronic
1129263645 15:74382612-74382634 AGGCCCATCCCAAGGTCCCAGGG + Intergenic
1129364741 15:75047394-75047416 AGCACCTCCCCCAAGTCCCAGGG - Intronic
1131395427 15:92081766-92081788 GGGCTTTTCCCAAAGTCCCCAGG - Intronic
1132384098 15:101387702-101387724 GGGCCCTCCCCAGACTCTCAGGG + Intronic
1132632964 16:928716-928738 GGGCCCACCCCACACCCCCACGG + Intronic
1132685209 16:1159251-1159273 GGGCCCACCCCACCGTCCGAGGG - Intronic
1132724516 16:1333135-1333157 GGGCCCTCACCAGAGCCCCAGGG + Intergenic
1132999458 16:2841711-2841733 GGGGCCTGCCCGAAGCCCCATGG + Intergenic
1134217031 16:12324166-12324188 GGGACCCCCCCAAAAGCCCATGG - Intronic
1135204809 16:20474437-20474459 GGGGACTCCGCAGAGTCCCAAGG - Intronic
1135490910 16:22908562-22908584 GGGCTCTCCGTAGAGTCCCAAGG + Intronic
1135944967 16:26857584-26857606 AGGTCTTCCCCAAGGTCCCAAGG - Intergenic
1137456422 16:48621391-48621413 GTGCCTTGCCCACAGTCCCATGG + Intergenic
1138271999 16:55702124-55702146 AGAACCTCCCCAAAGTCACAGGG - Intronic
1138493311 16:57390869-57390891 GGGGCCTCTGCAGAGTCCCAAGG - Intergenic
1139891050 16:70253502-70253524 GGGTCCTCCCCACAGGCCCTGGG - Intronic
1141167504 16:81670136-81670158 GGGCACTTCCCAAAGTCCTGTGG - Exonic
1141623446 16:85249282-85249304 GGCCCCTTCCCTAGGTCCCATGG + Intergenic
1141635377 16:85311489-85311511 CCTCCCTCCCCAATGTCCCACGG - Intergenic
1144424956 17:15132985-15133007 GAGACATCCCTAAAGTCCCATGG - Intergenic
1144582327 17:16465961-16465983 TGGGGCTCCCCAAGGTCCCAGGG + Intronic
1145198964 17:20922573-20922595 GCACCCTCCCCAGAGGCCCAGGG + Intergenic
1146175574 17:30664042-30664064 GTGCCCTCCCCCATTTCCCAAGG - Intergenic
1146254046 17:31378702-31378724 GGCCCCTCCTCAACATCCCATGG - Intronic
1146349021 17:32080088-32080110 GTGCCCTCCCCCATTTCCCAAGG - Intergenic
1147161261 17:38570717-38570739 GGGCCTGCCCCAGGGTCCCAAGG + Intronic
1147317962 17:39629807-39629829 GGGCCCCCCCTAAAGCCACAGGG + Intronic
1151206695 17:72513154-72513176 GGGCCCTGCCCAGAGTCTCTTGG - Intergenic
1151342544 17:73481177-73481199 GGGCCCTCCCCCACCTTCCAAGG - Intronic
1151417978 17:73979105-73979127 CCGCCTGCCCCAAAGTCCCATGG + Intergenic
1151553379 17:74834635-74834657 GGGCCCCCCGCAGAGCCCCAGGG - Intronic
1152547580 17:81009558-81009580 GGTTCCTCCTCAGAGTCCCAAGG - Intergenic
1152612988 17:81324588-81324610 GGGCCATCCTCAAACTCACAAGG - Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1155607715 18:27626305-27626327 GGGCTCTCTGCAGAGTCCCAAGG - Intergenic
1156340172 18:36203528-36203550 GGGTCCTCCCCACTGCCCCACGG + Intronic
1157474000 18:48009805-48009827 GGGCCCTGCCCAAAGGTCCTGGG - Intergenic
1158322886 18:56282661-56282683 GTGCCCTGCCCATATTCCCAGGG + Intergenic
1159878005 18:73832162-73832184 GGGCCCCTCCCAAAGAGCCAAGG + Intergenic
1159883130 18:73878570-73878592 TGGCCCTGCTCTAAGTCCCATGG - Intergenic
1159885535 18:73900622-73900644 GGGCCCTACCCTGAGCCCCAGGG - Intergenic
1160902751 19:1436892-1436914 CAGCCGTCCCCACAGTCCCAAGG - Intergenic
1160984721 19:1833298-1833320 TGGCCCTCCACACAGTCCCGCGG - Intronic
1161283114 19:3456366-3456388 GGGCCCCCCTGAAAGGCCCAAGG - Intronic
1162029702 19:7912056-7912078 AGGCCCTCCCCAAGGGGCCAGGG - Intronic
1162806117 19:13138801-13138823 GGGGCCCCCCTCAAGTCCCAAGG - Exonic
1162983388 19:14253868-14253890 GTGCCCTCCCCCATTTCCCAAGG + Intergenic
1163630035 19:18413609-18413631 GGGCCCTTCCCCAGCTCCCATGG - Intergenic
1166369818 19:42294466-42294488 GGGTCCTGCCCACAGTCACAGGG - Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
927066640 2:19478310-19478332 GGACCCTCTTCAGAGTCCCAAGG + Intergenic
929947740 2:46383110-46383132 GGGTTCTCCCTAAAGCCCCAGGG - Intronic
930386194 2:50698254-50698276 TGGCCCTCCCGAAAGTCTCAGGG - Intronic
930870553 2:56166718-56166740 GGTTCCTCCCAATAGTCCCAGGG - Intergenic
931609713 2:64085792-64085814 GGGCCACCACCAAAGACCCAAGG + Intergenic
932706824 2:74032403-74032425 GGGCCATCGCCCAAGCCCCATGG - Intronic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
934761567 2:96859628-96859650 GGGCCTCCCCCACAATCCCAGGG - Intergenic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
936670123 2:114646963-114646985 GGGCCTTGACTAAAGTCCCATGG + Intronic
937082583 2:119151076-119151098 GGGTCATCCCCAAGGCCCCAAGG + Intergenic
937340310 2:121086919-121086941 GGGCCCTCCCCACAGGGTCAGGG + Intergenic
938956889 2:136307238-136307260 GGGCACTCCCCAATTCCCCAAGG - Intergenic
940156409 2:150661442-150661464 TGGCCTTCCACAAAGCCCCAGGG - Intergenic
941635008 2:167927028-167927050 GGACCCTCTGCAGAGTCCCAGGG + Intergenic
941653731 2:168121219-168121241 AGGACCTGCCCAAAGTCACATGG - Intronic
945250929 2:207766374-207766396 AGGGCCTCCCCAAAGTGACAAGG - Exonic
946364395 2:219239765-219239787 GGCCCCTCACCAATGGCCCATGG + Exonic
947793464 2:232880432-232880454 GGGCTGTTCCCAAAGGCCCAGGG - Intronic
948362020 2:237428665-237428687 GAGCCCTGCACAAACTCCCAAGG + Intergenic
948590923 2:239049749-239049771 CGCCCCTCCCCAGCGTCCCAGGG - Exonic
949034390 2:241809962-241809984 GGGCCATCCCCTAAGTACCCAGG - Intronic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1172006873 20:31823942-31823964 GTGCCCTCCCCCAGGGCCCAGGG + Intronic
1172307609 20:33892394-33892416 GGCCCCACCCCCAAGACCCAGGG + Intergenic
1173143651 20:40506532-40506554 GGGACATCCCCAAAGGCCCCTGG + Intergenic
1173814288 20:45975214-45975236 GGGCCCCTCCCAAAGTATCAGGG - Intergenic
1174753543 20:53136088-53136110 GGACACTCCACAGAGTCCCAAGG + Intronic
1175945756 20:62558007-62558029 GGGCCCTCCCCGGAGGCCCCTGG + Intronic
1175964573 20:62654111-62654133 GGACCCTCCTCAGAGCCCCAGGG - Intronic
1176233873 20:64045243-64045265 AGTCCCTCCCCCAAGTGCCAGGG - Intronic
1177807631 21:25889595-25889617 CCGCCCTCCCCAACCTCCCAAGG - Intronic
1179568456 21:42263744-42263766 GGCCCCTCCCCACAGTCTAACGG - Intronic
1180049204 21:45323766-45323788 GGGCCCTCCCCAAGCCCCCGCGG + Intergenic
1180174597 21:46081547-46081569 GGGCCCACCCCTCAGTCCCTAGG - Intergenic
1181312019 22:21950047-21950069 GGAACTTGCCCAAAGTCCCAGGG + Intronic
1181465047 22:23106453-23106475 GGGCCCCACCCACAGTGCCAGGG - Intronic
1181920344 22:26315614-26315636 GAGCCCAGCCCAAAGTCACATGG - Intronic
1181964827 22:26649228-26649250 GTTCCCTACCCAAAGTCACATGG + Intergenic
1182217907 22:28734612-28734634 GGCTCCTCCTCACAGTCCCAGGG - Exonic
1182766673 22:32762575-32762597 GTGACCTCCCCAAGGTCTCATGG - Intronic
1183355864 22:37359050-37359072 GTGCACTCCCCCAAGCCCCAGGG - Intergenic
1184250759 22:43258840-43258862 GGTCCCCCCTCAGAGTCCCAGGG + Intronic
1184619297 22:45662813-45662835 GGACTCTCTCCAGAGTCCCAAGG + Intergenic
1185129987 22:49033348-49033370 AGAGGCTCCCCAAAGTCCCACGG - Intergenic
1185284522 22:49994345-49994367 GGCACCTCCCCTGAGTCCCAAGG + Intergenic
950329628 3:12146019-12146041 CAGCCCTCCCCCATGTCCCAGGG - Intronic
953879412 3:46683901-46683923 GGGCCCAAGCCAGAGTCCCAGGG + Intronic
954136687 3:48585147-48585169 GGACCCTCCCCCAAGGCCCCTGG + Intronic
954389148 3:50259932-50259954 GGGCCCTTCCCACAGCCTCATGG - Intergenic
954756817 3:52845064-52845086 GAGCCCCCCCAAAAGTCCAAAGG + Intronic
956705440 3:71995275-71995297 TGTCTCTCCTCAAAGTCCCATGG + Intergenic
957044782 3:75365075-75365097 GGGGCCTCCCCAAAGAGGCAAGG - Intergenic
960719957 3:120616202-120616224 GGGGGCTCCCCCAAGTGCCATGG + Intergenic
961566893 3:127770452-127770474 GGACCCTCCCCACAGCCCCTTGG + Intronic
963793105 3:149604531-149604553 TGGCCCTCCTGGAAGTCCCAGGG - Intronic
966930875 3:184674677-184674699 TGGCCCTCCCCTGAGTCCCAAGG - Intronic
968233153 3:197016028-197016050 GCCTCCTCCCCAAAGCCCCAGGG + Intronic
969166429 4:5319814-5319836 GAGCTCTGCCCAAAGTCACAGGG + Intronic
969594384 4:8140700-8140722 GGGGCCTCCTGAAGGTCCCACGG + Intronic
969652706 4:8477416-8477438 GGGCCTGCCCCAAAGGGCCACGG - Intronic
969785265 4:9452738-9452760 GGGCCCCCCCCAAAGAGGCAAGG + Intergenic
969978539 4:11130231-11130253 AGGTCCTACCCAAAGTCCCAGGG + Intergenic
970427975 4:15963066-15963088 GGGCCTGACCCAAAGTCCCCAGG + Exonic
972251729 4:37309232-37309254 GTGCACTCCCCAAAGGCCCTAGG - Intronic
974096029 4:57365387-57365409 GGGCCATCCCGAAAGTACAAGGG - Intergenic
977838612 4:101674301-101674323 GGGCCCTCCGCAGCATCCCAGGG - Intronic
981423442 4:144577543-144577565 GGACTCTCCACAGAGTCCCAAGG - Intergenic
984621983 4:181964086-181964108 GGTCTCTCCCAAAAGTCCCCGGG + Intergenic
985521560 5:376183-376205 GGCCCCTCCCCTGAGACCCACGG - Intronic
988788266 5:34584106-34584128 GGACTCTCCGCAAAGTCCCAAGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991616718 5:68504583-68504605 GGCCTCTCCACAGAGTCCCAGGG + Intergenic
993098913 5:83512272-83512294 GGGCCCTGGCCACAGTCACAGGG - Exonic
995858969 5:116622111-116622133 GAGCCCTCCACAAAGTCAGACGG + Intergenic
997510884 5:134453023-134453045 AGGCCCTCCTTAAAGTCACATGG + Intergenic
1000363136 5:160466657-160466679 GGGTCCACCCCAAACCCCCAAGG + Intergenic
1001412413 5:171520540-171520562 AGGCCCTGCCCAAGGCCCCATGG - Intergenic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1003300546 6:4877403-4877425 TTGCCTTCCCCAAAGTCACAAGG + Intronic
1006171676 6:32096804-32096826 CCGCCCTCGCCACAGTCCCAGGG + Intronic
1006904048 6:37521306-37521328 AGGCCCTCTCCGAAGTCCAAAGG + Intergenic
1007212710 6:40208395-40208417 AGGCCTCCCCCACAGTCCCAAGG + Intergenic
1007250561 6:40492235-40492257 GAGCCCTCCCCTGAGTCCCAAGG + Intronic
1009788408 6:68367685-68367707 GGGCCCTGCATAAAGTTCCATGG - Intergenic
1013830988 6:114272671-114272693 GGGACCTCCACAAAGACCCCTGG + Intronic
1014948830 6:127530260-127530282 GGACCCTCTGCAGAGTCCCAAGG + Intronic
1017213329 6:151880787-151880809 GGGCCATCCCCAAGGGCCCCTGG - Intronic
1017859578 6:158383132-158383154 GCATCCTCCTCAAAGTCCCATGG + Intronic
1018705298 6:166459975-166459997 GTGCTGGCCCCAAAGTCCCAGGG - Intronic
1019274410 7:168335-168357 AGGCCCTGGCCAGAGTCCCATGG + Intergenic
1019620271 7:1988383-1988405 GGGCGCTCCACAAAGTGCCTGGG - Intronic
1019649321 7:2148277-2148299 AGGCCCTCCGCACAGACCCACGG + Intronic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020271968 7:6602221-6602243 GGGCTCTCCCCAAAGAACCCAGG - Intronic
1020877735 7:13719365-13719387 GGTCCCGCCCCACAGTACCAGGG - Intergenic
1022975290 7:35550615-35550637 GGTCCTCCCCCAAAGCCCCATGG - Intergenic
1024963324 7:55001344-55001366 GGGCCCTCTGCAGAGTCCCCAGG - Intergenic
1029433524 7:100548057-100548079 AGCCCATCCCCAAGGTCCCAGGG - Intronic
1030615879 7:111737932-111737954 TGATCCTCCCGAAAGTCCCAGGG - Intronic
1032433600 7:131882491-131882513 GCTCCCTCCCCCAAGTCACATGG + Intergenic
1032991032 7:137395339-137395361 AGGACAACCCCAAAGTCCCAAGG + Intronic
1033845364 7:145425586-145425608 TGGCCCAACCCAAATTCCCATGG + Intergenic
1034280703 7:149852077-149852099 AGGCCCTGCCCATAGTCCCCAGG - Intronic
1034840706 7:154392837-154392859 GGGCCCTCCCCAAAGTCCCATGG + Intronic
1035228245 7:157445365-157445387 GGGCCCTGCCCAAAGTCAGCTGG - Intergenic
1037787310 8:21910736-21910758 GGGCCCACCCCACAGCTCCAGGG + Exonic
1038426782 8:27469028-27469050 GAATCCTCCCCAAAGCCCCACGG - Intronic
1038681887 8:29676228-29676250 GGACCCTCTGCAGAGTCCCAAGG - Intergenic
1039376858 8:37043385-37043407 GGACTCTCTACAAAGTCCCAAGG - Intergenic
1039474538 8:37832900-37832922 GATCCCTCCCCAAGGCCCCAAGG + Intronic
1045115307 8:98974201-98974223 CGACCCTCCCCACAGGCCCAGGG + Intergenic
1048360271 8:133691681-133691703 GGGACCTACCTAAAGTCTCATGG - Intergenic
1049726345 8:144148196-144148218 GGCGCCTCCCCAAGGTCACAGGG + Intronic
1049795150 8:144493789-144493811 GGAACCTGCCCAGAGTCCCATGG + Intronic
1050092853 9:2033044-2033066 GGGCCCTCCCCAGAGTCCAATGG + Exonic
1050917941 9:11161430-11161452 TGGCCCTCCACAAAGTTCTAGGG - Intergenic
1057912620 9:99031694-99031716 GGCACTTCCACAAAGTCCCATGG - Intronic
1061001462 9:127905170-127905192 GGAGCCTCCCCACAGCCCCAGGG - Intronic
1061007237 9:127935144-127935166 GGCCCAGCCCCAAAGCCCCAGGG - Exonic
1061137270 9:128742067-128742089 GGGCTGTGCCCAAAGTCACAGGG - Intronic
1061445681 9:130635923-130635945 GGACCCTTCCCAAAGGCCCTGGG - Intronic
1061765206 9:132877564-132877586 GGGCCTCGCCCAAAGTCACACGG + Intronic
1062253999 9:135612620-135612642 GGGGCCTCCCCAGGGCCCCAGGG + Intergenic
1062267169 9:135692507-135692529 GGCCCCTCACCAAAGCCCCCTGG + Intergenic
1062353673 9:136151973-136151995 GGGCCTTTCCCAATATCCCAGGG - Intergenic
1062617615 9:137405111-137405133 TGGCCATTCCCAAATTCCCAGGG + Intronic
1189232490 X:39463503-39463525 TGATCCTCCCCAAAGTCCCATGG - Intergenic
1189240737 X:39522513-39522535 AGACCCTCCCCTAAGACCCAGGG + Intergenic
1189579737 X:42393659-42393681 GGGTCATCCCTCAAGTCCCAAGG + Intergenic
1192183641 X:68931375-68931397 GGGCCCACTCCAGTGTCCCAGGG + Intergenic
1192800685 X:74462131-74462153 GGGCTCTACCCAAACTCCGAGGG - Intronic
1195322130 X:103728687-103728709 TGGCCCTCCCCAAACAGCCATGG - Intergenic
1198719407 X:139599540-139599562 CTGCCCTCCACAAAGTCTCAGGG + Intronic
1199787333 X:151117081-151117103 GGGCTCTTCCCAAATGCCCATGG - Intergenic
1200097749 X:153672113-153672135 AGGCCCTCCTCACAGTTCCATGG + Exonic