ID: 1034842145

View in Genome Browser
Species Human (GRCh38)
Location 7:154408833-154408855
Sequence ACATATAAATTTGAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 1, 2: 9, 3: 56, 4: 383}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034842145_1034842158 23 Left 1034842145 7:154408833-154408855 CCCCCCAACTCAAATTTATATGT 0: 1
1: 1
2: 9
3: 56
4: 383
Right 1034842158 7:154408879-154408901 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1034842145_1034842157 22 Left 1034842145 7:154408833-154408855 CCCCCCAACTCAAATTTATATGT 0: 1
1: 1
2: 9
3: 56
4: 383
Right 1034842157 7:154408878-154408900 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
1034842145_1034842154 -5 Left 1034842145 7:154408833-154408855 CCCCCCAACTCAAATTTATATGT 0: 1
1: 1
2: 9
3: 56
4: 383
Right 1034842154 7:154408851-154408873 TATGTTAAGGCCGGGCCTGGTGG No data
1034842145_1034842153 -8 Left 1034842145 7:154408833-154408855 CCCCCCAACTCAAATTTATATGT 0: 1
1: 1
2: 9
3: 56
4: 383
Right 1034842153 7:154408848-154408870 TTATATGTTAAGGCCGGGCCTGG No data
1034842145_1034842160 26 Left 1034842145 7:154408833-154408855 CCCCCCAACTCAAATTTATATGT 0: 1
1: 1
2: 9
3: 56
4: 383
Right 1034842160 7:154408882-154408904 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034842145 Original CRISPR ACATATAAATTTGAGTTGGG GGG (reversed) Intronic
900763288 1:4487152-4487174 ACAGATTAATATGAGCTGGGTGG + Intergenic
900855708 1:5180899-5180921 ACATATAAATTGGGGGAGGGAGG + Intergenic
903289119 1:22296819-22296841 ACATATGAATTTGGGTGTGGTGG + Intergenic
904414600 1:30350552-30350574 ACATATGAATTTGAAGTTGGGGG + Intergenic
904941804 1:34168877-34168899 ACCTATGAATTTGGGTGGGGGGG + Intronic
907062023 1:51437235-51437257 ATATATAAACTTGAGTTAGTTGG - Intronic
907100209 1:51825853-51825875 ACATAGAAATTTTGGGTGGGGGG - Intronic
907830707 1:58061660-58061682 ACATATAAATTTGGGGTGAGAGG + Intronic
907890660 1:58633389-58633411 GAATATAAATTTGTGTTGGGGGG + Intergenic
907957552 1:59244545-59244567 ACATATAAATTTGGGTGTGGGGG + Intergenic
908985299 1:70010606-70010628 AAAAATGAATTTGAGTTAGGTGG - Intronic
909118260 1:71567719-71567741 ACATACAAATTTGAGGCGGAGGG - Intronic
909180201 1:72414357-72414379 ACATATAAATCTTATTTTGGGGG - Intergenic
909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG + Intronic
909440648 1:75691940-75691962 ATATATAAATTTGGAGTGGGGGG + Intergenic
910819767 1:91333934-91333956 ACATACAAACTTGAGTATGGAGG + Intronic
910826443 1:91413093-91413115 ATATAGAAATTTGAGTTTGCTGG - Intergenic
913471857 1:119196211-119196233 ATAAATAAAATTGAGTTGTGGGG + Intergenic
913677180 1:121151812-121151834 ACATATGAATTTGGGAGGGGAGG - Intergenic
914029018 1:143939441-143939463 ACATATGAATTTGGGAGGGGAGG - Intergenic
914160433 1:145128509-145128531 ACATATGAATTTGGGAGGGGAGG + Intergenic
914508819 1:148312623-148312645 ACATATGAATTTGGGGTGGCTGG - Intergenic
915759385 1:158295444-158295466 ACACAGACATTTGAGTTGGCAGG + Intergenic
917265309 1:173214993-173215015 ACATATGAATTTGGGGTCGGGGG - Intergenic
918631321 1:186722259-186722281 ACACATAAATTTGGGTTAGGTGG - Intergenic
919154583 1:193746942-193746964 AAATAAAAATTTGAGTTGTAGGG + Intergenic
919264530 1:195244697-195244719 ACATTAGAATTTGAGTTAGGTGG - Intergenic
919784120 1:201247916-201247938 ACATATAAATTGGAATTGCTGGG - Intergenic
919957952 1:202438307-202438329 ACATAAAAATTTCAGTATGGCGG + Intronic
920464483 1:206170327-206170349 ACATATGAATTTGGGAGGGGAGG - Intergenic
920831389 1:209468940-209468962 ACATATAAATTTGGGAGGAGAGG + Intergenic
920975582 1:210782322-210782344 GCATATAAATTTGAGGGGGTGGG - Intronic
921361967 1:214338652-214338674 ACATAAAACTTTGCGTTGTGTGG + Intergenic
922199351 1:223388923-223388945 ACAGATGAATTTGAATTGTGGGG + Intergenic
922869796 1:228892935-228892957 TCAGATACATTTGAGGTGGGGGG - Intergenic
924278387 1:242411151-242411173 ATATATCAATTAGAGTTGGAAGG - Intronic
1063572609 10:7230027-7230049 ATATATATATTTAAGATGGGAGG + Intronic
1064613007 10:17123456-17123478 ATATTTCAATTTGATTTGGGAGG + Intronic
1065304507 10:24355602-24355624 ACATGTAAATTTGGGGTTGGGGG + Intronic
1065325551 10:24548073-24548095 ATAAATAAATTTAAGTTAGGTGG + Intergenic
1065655257 10:27941852-27941874 CCTTATAAATTTGAGATTGGTGG - Intronic
1065911780 10:30312984-30313006 ACATATAAATTAAAGTGGGTTGG - Exonic
1066587050 10:36947175-36947197 ACATATAAATTTGTGTGGTGGGG - Intergenic
1067968270 10:50939899-50939921 ACATATGAATTTGGGGTAGGGGG - Intergenic
1068076402 10:52261100-52261122 ACATTTAACTTTCAGTTTGGAGG - Intronic
1068971244 10:62960767-62960789 AAATATAAAAATTAGTTGGGCGG + Intergenic
1068973668 10:62985176-62985198 CCACATAAATGTGAGTTTGGTGG + Intergenic
1069413597 10:68178020-68178042 ATTTATAAATTTGAGTTCTGGGG - Intronic
1069938520 10:71936915-71936937 ACATATGAATTGGAGGTGGGGGG + Intergenic
1072764744 10:98086303-98086325 ACATGTTAATTTTATTTGGGTGG - Intergenic
1073806723 10:107106716-107106738 ACATATGAATTTGGGAGGGGAGG - Intronic
1074071972 10:110080317-110080339 ACATAAATATTGAAGTTGGGTGG - Intronic
1074346534 10:112691627-112691649 ACATAGAAATGTGAGTTAGCAGG + Intronic
1078681177 11:13477921-13477943 AATTATAAATTTGTGTTAGGAGG - Intergenic
1078772683 11:14365414-14365436 ACATATGAATTTTGGTAGGGGGG - Intergenic
1079850300 11:25524917-25524939 ACATATTAATTTGGGTGGGAGGG + Intergenic
1081440286 11:43073244-43073266 GCATATGAATTCGAGGTGGGAGG + Intergenic
1083043044 11:59706635-59706657 ACATATAAATTTGGTTTGGAGGG + Intergenic
1083043125 11:59707440-59707462 ACATATAAATTTGGGTTGGAGGG - Intergenic
1083223655 11:61269875-61269897 TCATTGAAATTAGAGTTGGGAGG - Intronic
1083510237 11:63202532-63202554 ACAAGGAAATTTGAATTGGGCGG + Intronic
1083520737 11:63310113-63310135 ACATATAAATTTTCTTTGGTGGG + Intronic
1083541941 11:63517624-63517646 ACATATAAATTTTAGTTGGGAGG - Intergenic
1083843788 11:65319534-65319556 ACATATATTTTTTAGTTGAGGGG - Intronic
1085610861 11:77947748-77947770 AAATATAAATTGAAGTGGGGAGG + Intronic
1085904772 11:80747233-80747255 AGATAAAAATTAGAGTTGGGAGG - Intergenic
1087513029 11:99122135-99122157 ACATAAAAAGTGGAGTTGGGGGG - Intronic
1087522889 11:99265675-99265697 AAATATAAATATGAGTTGGGTGG - Intronic
1087813282 11:102631603-102631625 ACATATGAATTTGGGTGGGGGGG - Intergenic
1087822502 11:102728459-102728481 ACATGTAAATTTGGGGTTGGGGG - Intergenic
1088241720 11:107780085-107780107 CCTTGTAAATTTGAGTTGGTCGG - Intergenic
1088565467 11:111167839-111167861 ACCTGGAAATTTGAGTTGAGAGG + Intergenic
1089098178 11:115937268-115937290 ACATATAAATTTGGCAGGGGAGG - Intergenic
1090591252 11:128272223-128272245 ACTTATATATGTAAGTTGGGTGG + Intergenic
1090949175 11:131457719-131457741 ACACATAAATTTGGGGGGGGAGG - Intronic
1091933215 12:4414179-4414201 ATATATGAATTTGGGTGGGGAGG - Intergenic
1091945049 12:4532057-4532079 ATTTATGAATTTGTGTTGGGCGG - Intronic
1093132226 12:15405358-15405380 ACATAAAAGTTTCAGTTGGCTGG - Intronic
1093555662 12:20470774-20470796 ACATATCAATTCGGGTTGGGGGG - Intronic
1093903640 12:24663895-24663917 ACATATATTTTAGAGTTGGAAGG - Intergenic
1095299055 12:40561082-40561104 ACATAAGAAGTTGAGTTAGGAGG + Intronic
1096120321 12:49084756-49084778 ATATATGAATTTGAGCTGGGGGG + Intergenic
1097716688 12:62973778-62973800 ACATAGAAATTTGGGTTTGGAGG + Intergenic
1097914147 12:65002499-65002521 ACATATGAATGTGAGGTGAGAGG - Intergenic
1098468979 12:70822610-70822632 TTATATAAATGTGAGCTGGGAGG - Intronic
1098854127 12:75633209-75633231 ACATAAAAATTTGGGGGGGGGGG - Intergenic
1100030242 12:90178787-90178809 ACATAGAAATTATAATTGGGAGG - Intergenic
1100214998 12:92438585-92438607 TCATATGAATTTGCGGTGGGCGG - Intergenic
1100784155 12:98061450-98061472 AAATTTAAATTCTAGTTGGGGGG + Intergenic
1101274507 12:103184714-103184736 ACATATATATTTGGGGGGGGGGG - Intergenic
1101468228 12:104970106-104970128 ATATATGAATTTGAGGTGGGGGG - Intergenic
1102993740 12:117332874-117332896 GAATATAAATTTGATTTTGGCGG - Intronic
1103774651 12:123357927-123357949 ACACAAATAATTGAGTTGGGGGG + Intronic
1103897769 12:124285250-124285272 ACATATAAATTTGGGGAAGGGGG + Intronic
1105047849 12:133021013-133021035 ACATATCTCTTTGAGTTGGGGGG + Exonic
1105234566 13:18536685-18536707 ACATATGAATTTGGGTGGGGGGG + Intergenic
1105901501 13:24758290-24758312 AGGTAAAAATTTGAGGTGGGTGG - Intergenic
1106096418 13:26649260-26649282 AAATATAAATATGAGATAGGTGG + Intronic
1106222889 13:27761500-27761522 ACAAATAAATGGGAGTAGGGAGG - Intergenic
1106752992 13:32794135-32794157 ATATATGAATTTGAGTGGGTAGG + Intergenic
1106824084 13:33500170-33500192 ACATATAAATTTGGGAAGGAGGG + Intergenic
1107331949 13:39310854-39310876 ACATACAAATTTGAGGGGGGTGG + Intergenic
1107679320 13:42832002-42832024 AAATATAAGTTTGAATAGGGAGG - Intergenic
1108169495 13:47726467-47726489 ACAAATAAATTTTAGTCGGTAGG - Intergenic
1108374751 13:49803557-49803579 ACATAGAAATTTGAAATAGGGGG - Intergenic
1108530926 13:51326261-51326283 AGAAAGAAATTTGAGTTGAGGGG - Intergenic
1109155111 13:58900116-58900138 ACATCTAAATTTGGGTTGTGTGG + Intergenic
1109233499 13:59787756-59787778 ACATATAAATTTGGGGTTGGGGG - Intronic
1109650777 13:65323081-65323103 ATATATATTTTTGAGTTGTGTGG + Intergenic
1110164723 13:72426692-72426714 ACATATATATTTCATTTTGGAGG - Intergenic
1111482131 13:88843676-88843698 ACATATAAATGAGAAGTGGGAGG + Intergenic
1112152512 13:96779487-96779509 AAAAATACATTTGAGTTTGGAGG + Intronic
1112288319 13:98123476-98123498 ATATATAAATTTGAGTAGGGGGG + Intergenic
1113399518 13:109978079-109978101 ACATATAAATTTTTTTTGGGGGG + Intergenic
1113591905 13:111507252-111507274 ACAAATAAATATGTGTTGGCTGG + Intergenic
1114359837 14:21959316-21959338 CCATAGAAATTTGAGCTGGCAGG - Intergenic
1115488501 14:33936241-33936263 ATAAATAAATAAGAGTTGGGAGG + Intronic
1115715268 14:36096611-36096633 AGATATCAATTAGAGATGGGTGG + Intergenic
1115996481 14:39200904-39200926 ACATATGAATTTGATGGGGGGGG + Intergenic
1116053738 14:39837956-39837978 ACATATGAATTTGGGGTTGGGGG - Intergenic
1116891837 14:50276464-50276486 ACATATGAATTGGGGTGGGGGGG - Intronic
1116936862 14:50749642-50749664 ATATAAAAATTTAAGCTGGGAGG - Intronic
1117793226 14:59362911-59362933 ACATATAAATTAAGGTTTGGAGG - Intronic
1118428064 14:65689047-65689069 ACATATGAATTTGAGGGGAGAGG + Intronic
1118670182 14:68117260-68117282 ACATTGAAATTTGTGTTGGAAGG - Intronic
1119502099 14:75137864-75137886 ACATATAAAAATTAGCTGGGTGG - Intronic
1120041961 14:79763841-79763863 ATATATAAATTTGGGTGGCGGGG + Intronic
1120167729 14:81219641-81219663 TCATAAAAATAAGAGTTGGGTGG + Intronic
1120727357 14:87959790-87959812 ACATATATATTTTATTTTGGGGG - Intronic
1120738844 14:88085287-88085309 ACATTCAACTTTGAATTGGGAGG - Intergenic
1121672270 14:95721296-95721318 ACATATAAAATGTAGTTGGAGGG - Intergenic
1122357110 14:101129756-101129778 ACAAAGGAAATTGAGTTGGGTGG + Intergenic
1124719054 15:32096076-32096098 ACATATAAAATTAAATTTGGGGG + Intronic
1125063969 15:35459473-35459495 ACATATGAATTTGGGTTGGGGGG + Intronic
1125416556 15:39460006-39460028 ACATATGAATTTGTGTGGGGAGG + Intergenic
1126027829 15:44465264-44465286 ACAAATATATTTTAGTTGTGAGG - Intronic
1126600532 15:50423494-50423516 AAACATAAAATTGACTTGGGTGG - Intergenic
1126643551 15:50852708-50852730 ACATATAAATCTGAGGTATGGGG + Intergenic
1126754811 15:51915874-51915896 ACATGTGAATTTGGGGTGGGGGG - Intronic
1129809204 15:78493438-78493460 AAACATGAATTTGAGTTGTGTGG - Intronic
1130657249 15:85800314-85800336 AGATATAAATTTTATTTGGGGGG + Intergenic
1131358806 15:91770844-91770866 ACATATTAATTTGGTTGGGGTGG + Intergenic
1132435179 15:101794668-101794690 ATATATATATATGAGTTTGGAGG - Intergenic
1133632724 16:7636999-7637021 ACATATGAATTTGAGTGGAGAGG + Intronic
1134037874 16:11045530-11045552 ACATATGAATTTGGGTGGTGGGG + Intronic
1134259940 16:12643009-12643031 ATATATGAATTTGGGCTGGGGGG + Intergenic
1135282370 16:21163695-21163717 ACAAATAAATTTCAGTGAGGAGG + Intronic
1137271677 16:46906481-46906503 ACATATAAATCCGAGGAGGGTGG + Intronic
1137466340 16:48713272-48713294 ACATATGAATTTGAGGGGGATGG - Intergenic
1137759604 16:50929519-50929541 ACAAATAAATTTTAGTGAGGAGG - Intergenic
1137761390 16:50943474-50943496 AAAAATAAATTTGGGGTGGGTGG - Intergenic
1138398701 16:56728799-56728821 ACATATAAATTTGAAGGGGGAGG - Intronic
1138886676 16:61088428-61088450 AAATAAAAATCTGAGTTGGAAGG + Intergenic
1139082347 16:63538386-63538408 GCATATAATTTTTAGTTTGGTGG - Intergenic
1139091130 16:63649223-63649245 ATATATAAATATTAGTTAGGAGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1144002000 17:11063855-11063877 ACATATGAATTTGAGGGAGGGGG + Intergenic
1144929963 17:18851179-18851201 CCCGATAAAGTTGAGTTGGGGGG + Intronic
1145375634 17:22345061-22345083 ACATACAAAAATGAGTTGGGCGG - Intergenic
1149932665 17:60771106-60771128 AAATACAAATTTCAGTTTGGGGG - Intronic
1150251615 17:63708036-63708058 AAATATAAAAATTAGTTGGGCGG - Intronic
1150478155 17:65489347-65489369 ACATATGAATTTGGGGTGGGGGG + Intergenic
1150879613 17:69009133-69009155 ACTTATAAATTTAAGTTGCAGGG + Intronic
1151106915 17:71625851-71625873 ACATGTAAATTTGTGAGGGGTGG - Intergenic
1152932002 17:83114755-83114777 CCTAAGAAATTTGAGTTGGGTGG + Intergenic
1155086570 18:22464545-22464567 ACAGATAGATTAGAGTGGGGAGG - Intergenic
1155229747 18:23760982-23761004 ACCTATGAATTTGGGGTGGGGGG + Intronic
1155885427 18:31202228-31202250 ATATATAAAGTTCAGTTGAGAGG + Intergenic
1156985226 18:43342918-43342940 ACAAATAAATATTAGTTAGGTGG + Intergenic
1158274646 18:55754310-55754332 ACATATAAATTTGGGTGGGGAGG - Intergenic
1158870582 18:61683782-61683804 ACATATGAATTTGGGGTCGGGGG - Intergenic
1159583922 18:70264819-70264841 AGATATAAATAAGATTTGGGAGG + Intergenic
1159712774 18:71783661-71783683 AAAAATAAATTTTACTTGGGAGG - Intronic
1159957957 18:74533130-74533152 ACATATAAATTTTGGTGGGAAGG - Intergenic
1160110300 18:76022720-76022742 ATAAATAAATGTGACTTGGGTGG - Intergenic
1162302471 19:9851676-9851698 CCAAATAAATGTGAGTTGGGGGG + Intergenic
1164236369 19:23339500-23339522 TCGTATAATTTTGATTTGGGGGG - Intronic
1164546767 19:29172349-29172371 ACATATAAATTGGCGGTGAGGGG - Intergenic
1165240014 19:34458829-34458851 ACATAACAATTGGGGTTGGGAGG - Exonic
925247467 2:2396896-2396918 CCATAAAAATTTGATGTGGGGGG + Intergenic
926863920 2:17338850-17338872 GCATAAAAATTGGAGTTAGGAGG + Intergenic
927527958 2:23765112-23765134 GCATATAAATTTCACTAGGGTGG + Intronic
928130590 2:28646388-28646410 ATTTACAAATTTGTGTTGGGTGG - Intergenic
928560305 2:32476687-32476709 ACATATACATTTTATTTGTGAGG - Intronic
930953152 2:57169239-57169261 AAATATAAATATGAGGTGGATGG + Intergenic
931110439 2:59104953-59104975 ACATATGAATTTGAGGTGAGAGG + Intergenic
931146604 2:59526523-59526545 ACATATGAATTTGTGTGTGGGGG - Intergenic
931227982 2:60350530-60350552 ACAACTAAATGTGAATTGGGTGG - Intergenic
931437851 2:62264534-62264556 ACATGTGAATTTGGGGTGGGGGG - Intergenic
931580138 2:63763119-63763141 CCATACTTATTTGAGTTGGGGGG + Intronic
931847445 2:66219158-66219180 ACATAAAAATATGAGTGGGTAGG - Intergenic
933544336 2:83691491-83691513 ACATATAAATTTGGGGGGAGAGG + Intergenic
933800601 2:85957389-85957411 ACAAATATTTTTGAGTTAGGGGG + Intergenic
935251989 2:101271147-101271169 ACAAATACATTTTAGTAGGGAGG + Intergenic
935384995 2:102490608-102490630 ACATATAAATTTGGAGAGGGGGG + Intronic
935668602 2:105536058-105536080 ACATATGAATTGGAGTGGTGCGG - Intergenic
936753109 2:115670254-115670276 ACATATAAATTTGGATGGAGAGG + Intronic
936819422 2:116500689-116500711 AAATACAAATCTGAGTTGGTGGG + Intergenic
937444458 2:121945728-121945750 ACATATGAATCGGAGTGGGGGGG - Intergenic
937454196 2:122027236-122027258 ATTTATGAATTTGTGTTGGGCGG + Intergenic
937512959 2:122618850-122618872 ACATATGAATTTGGGTGAGGGGG + Intergenic
937795257 2:126010182-126010204 AAAAATAAATTTAAATTGGGAGG + Intergenic
938020979 2:127905616-127905638 ACATGTGAATTTGGGTGGGGAGG + Intergenic
938111150 2:128566058-128566080 AAATATAACTTTTATTTGGGAGG + Intergenic
938941058 2:136170016-136170038 AACAATGAATTTGAGTTGGGTGG - Intergenic
939520020 2:143218067-143218089 ACATATTCATGTGAGTTGGCTGG - Intronic
940372536 2:152918957-152918979 ACATATAAATTTGGGGTGGGGGG - Intergenic
945050019 2:205814917-205814939 GCATATAAATTATAGTGGGGTGG - Intergenic
945138767 2:206660909-206660931 ATATATAAATTTGGGGTAGGAGG - Intronic
945411043 2:209507153-209507175 ACATATGAATTTGGGGTGGTGGG + Intronic
945937633 2:215919118-215919140 ACAGATAAATCTTAGTTGTGGGG - Intergenic
947368865 2:229424725-229424747 ACATATGAATTTGGGGTGGAGGG + Intronic
948140202 2:235667361-235667383 ACATTTACATTTGATTTGTGTGG + Intronic
948383826 2:237569133-237569155 ACATATAAATTTGCAGTGGCGGG + Intergenic
1168866882 20:1094432-1094454 TGATATAAATGTGAATTGGGTGG - Intergenic
1168867255 20:1097990-1098012 ACATATGAATTTGGCATGGGTGG + Intergenic
1169097631 20:2917112-2917134 AAATACAAAATTTAGTTGGGCGG - Intronic
1170596589 20:17810453-17810475 AGATAAACATTTGATTTGGGAGG - Intergenic
1172588058 20:36098698-36098720 AGACATAAATTTGGGTTGGGAGG + Intronic
1173470778 20:43321820-43321842 ACATATGAATTTGAGGAGGTTGG + Intergenic
1174713525 20:52732152-52732174 ACATAGAATTTAGAGTTGGGTGG + Intergenic
1175705423 20:61173018-61173040 ACATATATATATGGGGTGGGTGG + Intergenic
1176698920 21:10019112-10019134 AAATTTAAATTTGGGGTGGGAGG - Intergenic
1176778554 21:13164971-13164993 ACATATGAATTTGGGTGGGGGGG + Intergenic
1176898733 21:14415194-14415216 ACATAAAAATTGGTCTTGGGTGG + Intergenic
1177187296 21:17811965-17811987 ACACATAAATTTTGGTTGTGAGG - Intronic
1177809780 21:25913952-25913974 ATATACAAATTTGAGTGGGAGGG - Intronic
1178003416 21:28190163-28190185 ACATATAAATTTGATGGGGGTGG + Intergenic
1178354058 21:31895869-31895891 ACATATGAATTTGTGGTTGGGGG - Intronic
1180164732 21:46018871-46018893 ACATACAAATTTGAGAGAGGAGG + Intergenic
1181078596 22:20398368-20398390 ACATAAGAATTTGAGGTGAGGGG + Intronic
1181388668 22:22563199-22563221 ACATATGAATTTGTGGTGGGGGG + Intronic
1181623928 22:24109505-24109527 ACATATAAACTTGTTTTGGCTGG - Intronic
1182242532 22:28927558-28927580 ACATATTAATTTGTTTTGGAGGG - Intronic
1184006047 22:41709975-41709997 ACATATAAATTTGCCGGGGGTGG - Intronic
949542629 3:5045712-5045734 ACATATGAATTTGAGATTGGAGG - Intergenic
951462282 3:22964066-22964088 GAATATAAATTTCAGATGGGTGG + Intergenic
955671531 3:61407926-61407948 ACATATAAATTGGTGGGGGGTGG + Intergenic
956568835 3:70671287-70671309 ACAAATAAACTGGAGATGGGAGG + Intergenic
957008456 3:74977289-74977311 ACCTATAAATTTGGATTGGAGGG + Intergenic
957597931 3:82291540-82291562 ACATATAAATTGGGGGTGTGAGG - Intergenic
957783268 3:84848112-84848134 ACATATAAATTTGGAGGGGGAGG - Intergenic
957882726 3:86241430-86241452 TCATATAGATTTGAGTTAGAAGG + Intergenic
958104208 3:89052286-89052308 AAACAAAATTTTGAGTTGGGGGG - Intergenic
958118441 3:89253384-89253406 ACATGTAACTTTGAGGTGGGAGG - Intronic
959418826 3:106109511-106109533 ACATATGAATTTGGGGTGAGGGG - Intergenic
960827030 3:121798729-121798751 ACATATGTATTTGATTTTGGAGG + Intronic
961101191 3:124200581-124200603 ACATATAAATTTGGGGCAGGGGG + Intronic
962351805 3:134661808-134661830 ACATATGAATTTGAGGGGGGGGG - Intronic
962447098 3:135475942-135475964 ATATATACATTTGAGTCGGTGGG - Intergenic
962569598 3:136699497-136699519 ACTTGTAAATCTGAGGTGGGAGG - Intronic
963907223 3:150782656-150782678 ACATATAAATTTAAATTTAGCGG - Intergenic
964229863 3:154453186-154453208 CATTATAAAATTGAGTTGGGTGG + Intergenic
964492422 3:157250865-157250887 ACATATAAATTTGGGAAGGGGGG + Intergenic
964518575 3:157539757-157539779 ACATACAAATTTGGTTTGTGTGG + Intergenic
965752589 3:171991596-171991618 ACAAAAAAATTTGAGTTGCCTGG - Intergenic
966449858 3:180045977-180045999 AGATAAGGATTTGAGTTGGGGGG + Intergenic
967431820 3:189394283-189394305 AAATAAAAATTTGAGATGAGGGG + Intergenic
967733233 3:192925683-192925705 AAATATAAATTTGGGTTGCACGG - Intergenic
967762609 3:193242064-193242086 ATTTACAAATTTGTGTTGGGCGG - Intronic
969152468 4:5181167-5181189 ACATATGAATTTGAGGCAGGGGG - Intronic
970036822 4:11745824-11745846 ACAAAAAAGTTTGTGTTGGGAGG + Intergenic
970186563 4:13460607-13460629 ACATATAAATTGGGGGTGGTGGG + Intronic
970189010 4:13492569-13492591 AAATACAATATTGAGTTGGGCGG + Intergenic
970245556 4:14058357-14058379 ATATAAATATTTGAGTTGGTGGG + Intergenic
970461442 4:16278402-16278424 CCATAACATTTTGAGTTGGGAGG + Intergenic
971964849 4:33539927-33539949 ATATATAAAATTGAGGTTGGTGG + Intergenic
972174664 4:36388736-36388758 ATATATAGATTTGGGGTGGGAGG + Intergenic
972346534 4:38197082-38197104 ACTTAGAAAGTTGAGGTGGGAGG - Intergenic
973663322 4:53131128-53131150 ACATATAAATTTCATTTTGTTGG - Intronic
974413090 4:61567334-61567356 ACATATAAAATTGGGGAGGGTGG - Intronic
974549845 4:63357359-63357381 ACATATAGATTTGATTCGGTGGG - Intergenic
975834948 4:78413076-78413098 CCATATGACTGTGAGTTGGGTGG + Exonic
976021335 4:80631867-80631889 ACATATGAATTTGGTTGGGGGGG - Intronic
976305160 4:83552756-83552778 ACATATCAATTTGGGAAGGGGGG - Intronic
976323243 4:83740445-83740467 ACATTTAAAGTTGAGGTCGGGGG - Intergenic
976493070 4:85693909-85693931 CCATAAACATTTGAGTTGGGAGG - Intronic
976816982 4:89160312-89160334 ACATATAAATTTGGGGAGGTGGG - Intergenic
977702003 4:100031892-100031914 ACCTATATATTTCAATTGGGAGG - Intergenic
978135496 4:105253398-105253420 ACATAAATATTTCATTTGGGGGG + Intronic
978527813 4:109683196-109683218 AAAAATAACTTTGATTTGGGGGG + Intronic
978714713 4:111827624-111827646 ACAGATATATTGGAGATGGGTGG - Intergenic
979019635 4:115479862-115479884 AAATATAAATTTGTGTTATGTGG + Intergenic
979120680 4:116896450-116896472 ACATATGAATTTGAGTGAGGGGG - Intergenic
979773994 4:124564303-124564325 ACATAAATATTTGAATTGGAAGG + Intergenic
980229066 4:130024634-130024656 AGAGATAAATTTGACCTGGGAGG - Intergenic
980263631 4:130487323-130487345 ACATATAAATTTGGGGCAGGGGG - Intergenic
980450596 4:132965478-132965500 ACATATAAATTTGGGGGAGGAGG - Intergenic
980934628 4:139214439-139214461 ACATATGAATTTGTGAGGGGTGG + Intergenic
981074506 4:140577800-140577822 ACATATGAATTTGGGGGGGGTGG + Intergenic
982450747 4:155549621-155549643 ACATATAAATTGGAGGTGGAGGG + Intergenic
982796504 4:159652295-159652317 ATATATAAATTTGAGTCAGATGG + Intergenic
983491629 4:168396920-168396942 ACATATGAATTTGTTTTGAGGGG - Intronic
983494985 4:168433124-168433146 AAATATAAATTTAAGATGAGAGG + Intronic
983530493 4:168805190-168805212 ACTCAAAAATTTGAGATGGGAGG + Intronic
984047804 4:174823279-174823301 ACATATGAATTTGAGGCGGGTGG + Intronic
984237673 4:177180472-177180494 ACATACAAATATGACCTGGGTGG + Intergenic
984733622 4:183090666-183090688 ACATATAAATTGCAGGGGGGTGG - Intergenic
987164584 5:15182465-15182487 ACATAAAAGTTTGAGTTAAGAGG + Intergenic
988851913 5:35188916-35188938 ACGTATGAATTTGGGGTGGGAGG - Intronic
989295968 5:39826976-39826998 ACATGTAAATCTGAGTTGTATGG - Intergenic
990086415 5:51983566-51983588 ACATATAAATTAGGGAGGGGGGG + Intergenic
990339040 5:54804201-54804223 GCAGTTAAAATTGAGTTGGGAGG + Intergenic
992758283 5:79929720-79929742 AAATTTACATTTCAGTTGGGGGG + Intergenic
993065290 5:83090544-83090566 CTATAAAAATTTGAATTGGGAGG - Intronic
993533171 5:89048421-89048443 ACATATTAATTTTAATGGGGGGG + Intergenic
993953160 5:94200179-94200201 ACACAGACATTTGAGTTGGCAGG - Intronic
994178724 5:96740632-96740654 ACATATAGATCTGGGGTGGGAGG + Intronic
995006656 5:107204915-107204937 TCAAATAAATTAGAGTTGGCAGG - Intergenic
997132689 5:131293094-131293116 ACATATGAATTTGAGGGGTGGGG - Intronic
997650758 5:135517517-135517539 ACATACAAATTGGGGTTGGGGGG - Intergenic
998676202 5:144410905-144410927 ACATATGAATTTGAGAGGGTAGG - Intronic
998816642 5:146021238-146021260 AAATATAAATTTGAACTGGGAGG - Intronic
999146599 5:149400064-149400086 ACATAGAAATTTGGGGAGGGGGG - Intronic
1000713951 5:164616708-164616730 ACATATAAAATTTAATTTGGGGG + Intergenic
1001186656 5:169580336-169580358 ACATATGAATATGGGGTGGGGGG + Intergenic
1001254710 5:170174721-170174743 AAGTATAAATTTGAGTTGCAGGG + Intergenic
1001838523 5:174853108-174853130 ACATATGAATTTGAGGAGAGGGG + Intergenic
1001901938 5:175438577-175438599 ACATATCAATTTGCTTTGGGGGG + Intergenic
1002295234 5:178227066-178227088 ACACATAAATTGGGGGTGGGGGG - Intronic
1002920434 6:1566129-1566151 ACAAATCACTTTGAGTTGGTAGG + Intergenic
1003254634 6:4464193-4464215 ACATATGAATTTGGTTTGGTGGG - Intergenic
1003857426 6:10290590-10290612 ACATATAAATTTGGTGAGGGTGG - Intergenic
1004038631 6:11951226-11951248 ACCTATGAATTTGAGTTGGGGGG + Intergenic
1004346848 6:14856886-14856908 ACATATGAATTTGACGGGGGGGG + Intergenic
1004351018 6:14890493-14890515 ACATATGAATTTGTGGAGGGAGG + Intergenic
1005008413 6:21312934-21312956 ACATATGAATTTGTGGTTGGGGG - Intergenic
1005079252 6:21940387-21940409 ATATATGTTTTTGAGTTGGGCGG + Intergenic
1005190528 6:23216575-23216597 ACATATGGATTTGGGGTGGGGGG + Intergenic
1005208790 6:23435885-23435907 ACATAAAAATTAAAGTTGAGAGG + Intergenic
1005667094 6:28068769-28068791 ATATATATATTAGAGTTGTGAGG + Intergenic
1006485419 6:34336285-34336307 ATATACACATTTGAGTGGGGTGG + Intronic
1007695711 6:43733247-43733269 ACATTTAAATTGGATTTGGGAGG - Intergenic
1007716620 6:43859842-43859864 ACATGAAAATATGAATTGGGGGG + Intergenic
1007985614 6:46204557-46204579 ACATATGAATTTGGGGTTGGAGG + Intergenic
1008082244 6:47206654-47206676 ACCAATAAATTTGAGTGGAGAGG + Intergenic
1009964323 6:70562755-70562777 ATATATATATTTGAGTTGGGGGG - Intergenic
1010395423 6:75386808-75386830 AAATACAGATTTGAGTTTGGAGG - Intronic
1010564551 6:77393617-77393639 ACAAATAAATTTGAGTTAATAGG + Intergenic
1010647471 6:78408580-78408602 ACATATGAAATTGGCTTGGGGGG - Intergenic
1011571173 6:88737497-88737519 ACATATGAATTTGGGGAGGGGGG - Intronic
1011648855 6:89486960-89486982 ACATATGAATTTGGGGTTGGGGG + Intronic
1011951934 6:92977724-92977746 ACAAATAAATATGACATGGGTGG + Intergenic
1012573778 6:100764812-100764834 ACATATAAATTGTGTTTGGGGGG + Intronic
1013055607 6:106579855-106579877 ACTTAAAAGTTTGAGGTGGGAGG - Intronic
1013443895 6:110201330-110201352 ACATATAGATTTGAGTGAGAGGG + Intronic
1014042423 6:116844325-116844347 ACATGTATATTTCTGTTGGGAGG - Intergenic
1014156941 6:118121989-118122011 ATATATAACTTTGAAATGGGGGG - Intronic
1014394076 6:120902564-120902586 ACATGGGAGTTTGAGTTGGGAGG - Intergenic
1015074776 6:129142515-129142537 ACATATGAATTTTAGTAGGGGGG + Intronic
1015412146 6:132905815-132905837 ACATATATAATTGATTTGTGGGG + Intergenic
1016286398 6:142478128-142478150 ACATATGAATTTGGTTGGGGCGG - Intergenic
1016489764 6:144585515-144585537 ACAGATAAATTTTATTTGTGTGG + Intronic
1016825587 6:148385747-148385769 ACATAGAAATTTGTGTAGGGTGG + Intronic
1017695272 6:157008640-157008662 AAATGTGACTTTGAGTTGGGTGG + Intronic
1020456681 7:8381430-8381452 ACATATCAACTTGAATTGGCAGG - Intergenic
1020468321 7:8506615-8506637 GCAAATAAATTTGATTTGAGTGG + Intronic
1020809688 7:12835674-12835696 ACATATAAATTTCATTTGTAAGG + Intergenic
1021010638 7:15460330-15460352 AAAAATAAATGTGAGGTGGGTGG - Intronic
1021030333 7:15724919-15724941 AGATATTAATTTGGGTTTGGGGG + Intergenic
1021211327 7:17856681-17856703 ACATGTGAAACTGAGTTGGGAGG + Intronic
1021281564 7:18725727-18725749 ATATATAATTATGATTTGGGGGG - Intronic
1021600659 7:22360013-22360035 TCATATACATTTTAGTTGTGGGG - Intergenic
1021893894 7:25215127-25215149 ACATATAAACTTGGGGTGGTAGG - Intergenic
1022539929 7:31126007-31126029 ACATACGAATTTGGGTGGGGAGG - Intergenic
1024067542 7:45753536-45753558 ACATATATATTAAAATTGGGGGG + Intergenic
1024212313 7:47216457-47216479 ACATATGAATTTGGCTTGGCAGG + Intergenic
1024755707 7:52528099-52528121 ACATTTATATTTGTGATGGGGGG + Intergenic
1026962731 7:74419331-74419353 ACACAAAAATTTCAGTTAGGAGG - Intergenic
1027162213 7:75811180-75811202 ACATAAAAGTTTGAGTAGGCTGG + Intergenic
1027363561 7:77433842-77433864 ACACATAAATGTGAGTGGTGTGG + Intergenic
1027748421 7:82108504-82108526 ACATATAAATTGGGGATGGAGGG + Intronic
1028375810 7:90145735-90145757 ACATATATATTTCAGTTGAAAGG - Intergenic
1028978042 7:96935893-96935915 ACATATGAATTTGAGGGAGGAGG - Intergenic
1029809862 7:103036331-103036353 AAAAAAAAATCTGAGTTGGGAGG - Intronic
1029824461 7:103174502-103174524 ACATATATATTTCAGTTGAAAGG + Intergenic
1030311198 7:108071100-108071122 ACATTTAAATGTGAGTTGAGAGG - Intronic
1030318366 7:108139369-108139391 ACATATGAATTTGGGGTGGAGGG + Intergenic
1031667392 7:124501642-124501664 ACATATAAATATTAGGTGGAGGG + Intergenic
1031684578 7:124717338-124717360 ACAGATAAATTTGTGTTATGGGG - Intergenic
1032945971 7:136853153-136853175 ACATTTAAATTTTAGTGGGGAGG - Intergenic
1033079674 7:138283484-138283506 ACATATATAGCTGAGATGGGAGG + Intergenic
1034537548 7:151735181-151735203 ACATCTAATTTTGAGTGGGCAGG + Intronic
1034842145 7:154408833-154408855 ACATATAAATTTGAGTTGGGGGG - Intronic
1035093031 7:156330369-156330391 ACAAAGAATTTTGAGTTGAGGGG - Intergenic
1037332427 8:17756639-17756661 ACATATGAATTGGAGAGGGGTGG - Intronic
1037349740 8:17939091-17939113 ACACAGGAATTTTAGTTGGGTGG + Intronic
1037462718 8:19129058-19129080 AGATCAAAATTTGGGTTGGGAGG + Intergenic
1037610664 8:20473594-20473616 ACAAATGAATTTGGGGTGGGGGG - Intergenic
1038881441 8:31618044-31618066 ACATATAACTCTGAGTGGGAAGG + Intergenic
1039294140 8:36130910-36130932 ACATACAAATTTGGGGTTGGAGG - Intergenic
1039348393 8:36733711-36733733 ACATATGAATTTGGGTTTGGGGG - Intergenic
1039641751 8:39230409-39230431 ACTAATAAAATTGAGTTGGTTGG + Intronic
1040851952 8:51909980-51910002 ACAAATGAATTTGGGTGGGGAGG + Intergenic
1041008617 8:53519807-53519829 ACATTTGAATTTGAGTGGAGTGG - Intergenic
1041361191 8:57055937-57055959 AAGAAGAAATTTGAGTTGGGGGG + Intergenic
1042182782 8:66108541-66108563 ACAAATAAATTGGGGTGGGGAGG + Intergenic
1042613380 8:70622192-70622214 ACATATAAGTCTGAGTGTGGTGG - Intronic
1042735517 8:71983636-71983658 ACATATGAATTGGGGGTGGGGGG - Intronic
1043312489 8:78877477-78877499 TTATATAAATTTGAGAGGGGTGG - Intergenic
1044195519 8:89372547-89372569 ACATATAAATTTGGGAGTGGGGG + Intergenic
1045450185 8:102316926-102316948 ATATATAAATATGAGGGGGGAGG + Intronic
1045558135 8:103234771-103234793 ACATATGAATTTGAATTTGGCGG - Intergenic
1046519216 8:115302927-115302949 ACATATAAATTTGGGGTGGGGGG - Intergenic
1047649627 8:126905805-126905827 TCAAATAAATATGAGTTGTGCGG + Intergenic
1048117745 8:131544439-131544461 ACATATGAATTGGAGTTTGAGGG - Intergenic
1048583170 8:135747475-135747497 AGATATGCATTTGTGTTGGGAGG + Intergenic
1048811949 8:138296455-138296477 CCATGTAAGATTGAGTTGGGGGG - Intronic
1048978409 8:139688915-139688937 ACATATGAATTTGGGGTGAGGGG - Intronic
1050911893 9:11081959-11081981 ATATATTAATATGGGTTGGGGGG + Intergenic
1050962291 9:11750084-11750106 ACATATAAATTTGTGAGGAGAGG - Intergenic
1051021974 9:12555742-12555764 ATGTAAAAATTTGAGTTTGGGGG + Intergenic
1051325936 9:15968694-15968716 AAATATAAAAATCAGTTGGGCGG - Intronic
1052221763 9:26032497-26032519 ACATATAAATTTGGGAGGGAGGG + Intergenic
1053636024 9:40005306-40005328 AAATTTAAATTTGGGGTGGGAGG - Intergenic
1053769960 9:41459341-41459363 AAATTTAAATTTGGGGTGGGAGG + Intergenic
1054316901 9:63602406-63602428 AAATTTAAATTTGGGGTGGGAGG - Intergenic
1054548635 9:66370821-66370843 AAATTTAAATTTGGGGTGGGAGG + Intergenic
1055072379 9:72179996-72180018 ACATATTAAATTGGGGTGGGAGG + Intronic
1056035917 9:82605317-82605339 ACATATACATATGACTTGGCTGG - Intergenic
1056210491 9:84360506-84360528 AGATAAAAATGTGAGTTGGCAGG + Intergenic
1056476230 9:86953813-86953835 ACATATACGTTTGTGTTTGGGGG - Intergenic
1057126681 9:92621204-92621226 ACATATAAATTTGGGGGGGTGGG + Intronic
1057351644 9:94303657-94303679 ACATATGAATTTGGGTGGGGAGG + Intergenic
1058882376 9:109296954-109296976 ACATATTAATTTGGGGTGGGGGG - Intronic
1059999010 9:119941674-119941696 ACATATGAATTTGTGTGGGAGGG - Intergenic
1187659714 X:21529096-21529118 ACATATATGTTTGATTTGGATGG + Intronic
1187742257 X:22368588-22368610 ACTTTTAAATTTTAGTTGAGTGG - Intergenic
1188061549 X:25607001-25607023 ACATGGACATTTGAGTTGGCAGG - Intergenic
1188138832 X:26523519-26523541 ACAAATAAGTTTTGGTTGGGTGG + Intergenic
1188379468 X:29473366-29473388 ATATATAAATTTGAGAGGGATGG + Intronic
1191060466 X:56290401-56290423 ACAGATAAATTTGAGTAAGAAGG + Intergenic
1192867317 X:75148509-75148531 ACATATAAATTTGTGGGGGTGGG - Intronic
1193256964 X:79360241-79360263 ACATATAAATATGTGTAGGTGGG + Intergenic
1193392650 X:80947541-80947563 ACTTATAAATCTTAGTTTGGTGG + Intergenic
1194106211 X:89770430-89770452 ACATATTAATTGGGGTGGGGGGG - Intergenic
1194199392 X:90936108-90936130 ACTTTTAAAGTTGATTTGGGGGG + Intergenic
1194310947 X:92305613-92305635 AAGTATGAATTTGGGTTGGGGGG + Intronic
1194674126 X:96773249-96773271 ACATACAAATTTGGGGAGGGCGG - Intronic
1194751916 X:97694509-97694531 ACATATTAGTTTGGGTTGGGGGG - Intergenic
1194773410 X:97932640-97932662 ACATATAAACTGGAGCTGAGAGG - Intergenic
1195918217 X:109956698-109956720 ACATATGAATTTGGGGTTGGAGG - Intergenic
1196228575 X:113194485-113194507 ACATATAAATTGGGGCTGGGGGG - Intergenic
1196969796 X:121096397-121096419 ACATATAAATTTGATGAGGTTGG - Intergenic
1200304865 X:155014015-155014037 ACATATGAATTTGGGGTGGGGGG + Intronic
1200458167 Y:3418288-3418310 ACATATTAATTGGGGTGGGGGGG - Intergenic
1200545382 Y:4512527-4512549 ACTTTTAAAGTTGATTTGGGAGG + Intergenic
1200619222 Y:5419888-5419910 AAGTATGAATTTGGGTTGGGGGG + Intronic
1201602018 Y:15741411-15741433 ACATATACATTTGTGGTGGCCGG + Intergenic
1201615401 Y:15891567-15891589 ACAGGTAAACTTGTGTTGGGGGG - Intergenic