ID: 1034843035

View in Genome Browser
Species Human (GRCh38)
Location 7:154417461-154417483
Sequence CCGTAAGCCCCAGCCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034843029_1034843035 23 Left 1034843029 7:154417415-154417437 CCTGAGACTTTCTAAACGGAAGT 0: 1
1: 0
2: 1
3: 15
4: 106
Right 1034843035 7:154417461-154417483 CCGTAAGCCCCAGCCTGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 137
1034843031_1034843035 0 Left 1034843031 7:154417438-154417460 CCTATCTGTAGCTCAGGCCATTC 0: 1
1: 0
2: 0
3: 21
4: 257
Right 1034843035 7:154417461-154417483 CCGTAAGCCCCAGCCTGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034843035 Original CRISPR CCGTAAGCCCCAGCCTGTGA AGG Intronic
900408403 1:2502364-2502386 CCGGAAGCCCCAGCCCAGGAGGG + Exonic
901252546 1:7791483-7791505 TCGTAGGCCTCAGCCTGTGATGG + Intronic
906411889 1:45584908-45584930 CCGTGAGCCCCTGCCTGTGGTGG + Intronic
908301092 1:62761621-62761643 CCGTCAGCCCCGGGCAGTGAGGG + Intergenic
909435023 1:75631067-75631089 CCTTAAGTACCAGCCTCTGATGG - Intergenic
917396571 1:174600752-174600774 CACTAAACACCAGCCTGTGAAGG - Intronic
918730371 1:187985794-187985816 CTGTAAGTCTCAGCCTCTGAGGG + Intergenic
919822690 1:201482942-201482964 CGGAAAGCCCCAGCCTAAGAGGG - Intergenic
922417069 1:225431473-225431495 CCGCAGGCCCCAGGCAGTGAGGG + Intergenic
923623232 1:235594640-235594662 CCGCAAGCCCCGGGCAGTGAGGG - Intronic
1063309307 10:4937636-4937658 CCGCAAGCCCCGGGCAGTGAGGG - Intronic
1063322183 10:5060895-5060917 CCGCAAGCCCCAGGCAGTGAGGG - Intronic
1068211324 10:53924289-53924311 CCGTGGGCCCCAGGCAGTGAGGG + Intronic
1070999141 10:80814295-80814317 CCACAAGCCCCAGGCAGTGAGGG + Intergenic
1075686490 10:124368216-124368238 GCGGGAGCCCCAGCCTGTGTCGG + Intergenic
1076600533 10:131654451-131654473 CCCTCAGCCCCAGCCTGGCATGG + Intergenic
1079725191 11:23871840-23871862 CCGTAAGCATCAATCTGTGAAGG - Intergenic
1080281479 11:30562422-30562444 CCGTAGGAGGCAGCCTGTGATGG - Intronic
1083634852 11:64115065-64115087 CCTGAAGTCCCAGCCTGGGAGGG - Intronic
1085818802 11:79770525-79770547 CCTTTGCCCCCAGCCTGTGATGG - Intergenic
1092894872 12:13001418-13001440 CCGAAAGCCGGAGCCTGTGGCGG + Intergenic
1093346262 12:18040362-18040384 CCGCCAGCCCCAGGCAGTGAGGG + Intergenic
1096665159 12:53159662-53159684 TCGTACCCCCCAGCCTGCGAGGG - Exonic
1098310898 12:69148097-69148119 CCGTATCACCCAGCCTGTGAGGG - Intergenic
1103541427 12:121669166-121669188 TCAGAAGCCCCAGCATGTGAAGG + Intronic
1105861577 13:24419792-24419814 CCTGGAGCCCCAGCCTGTCAGGG - Intergenic
1105918312 13:24938087-24938109 CCTGGAGCCCCAGCCTGTCAGGG + Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107804536 13:44141753-44141775 CCGGATTCCACAGCCTGTGAGGG + Intergenic
1108450975 13:50562513-50562535 CAGTGAGCCCCAGCCTCTGAGGG - Intronic
1109152131 13:58859112-58859134 CCGCCAGCCCCAGGCAGTGAAGG - Intergenic
1114319664 14:21536800-21536822 CCCTAAGTCCAAGCCTGTGTGGG - Intronic
1119027777 14:71167645-71167667 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1119303678 14:73590688-73590710 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
1128061523 15:64738616-64738638 CCTTCAGCCCCTGCCTGTGCTGG - Intergenic
1128496359 15:68200690-68200712 CCCTGAGCCCCAGCCTGGGAGGG - Intronic
1128674734 15:69600231-69600253 CAGTGAACCCCAGCCTGTGCTGG + Intergenic
1129196933 15:73973859-73973881 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1131472833 15:92711271-92711293 CCACAAGCCCCAGGCAGTGAAGG - Intronic
1132620718 16:867072-867094 CGGTTAGCCACAGCCTGTCATGG + Intronic
1132655401 16:1039864-1039886 CCGCAAGGTCCAGCCTGCGAGGG - Intergenic
1138212227 16:55173291-55173313 CCACAAGCCCCAACCTGTGAAGG + Intergenic
1143475816 17:7203457-7203479 CCGGAAGCCCCCGGCTGAGAAGG - Exonic
1144168362 17:12634330-12634352 CCCTAATCCCCATCCTGTCAGGG - Intergenic
1144785248 17:17827776-17827798 CCTTCAGCCCCAGCCTGTGGGGG + Intronic
1147134820 17:38428636-38428658 CCGTGCGCCCCAGGCTGTGCAGG - Intronic
1148023371 17:44568324-44568346 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1151517358 17:74605136-74605158 CCTGAAGCACCAGGCTGTGATGG - Intergenic
1152872603 17:82765502-82765524 CCCCAAGCCCCACCCTGAGACGG - Intronic
1153985816 18:10350138-10350160 CTGTAAGCTCTCGCCTGTGAAGG + Intergenic
927211603 2:20642318-20642340 CCAGAATGCCCAGCCTGTGAAGG + Intronic
928701548 2:33903770-33903792 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
929138029 2:38643313-38643335 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
931986265 2:67745214-67745236 CCCTCAGCCTCAGCCTGTGATGG - Intergenic
937230848 2:120397327-120397349 CCATGGCCCCCAGCCTGTGAGGG + Intergenic
940112653 2:150171280-150171302 CCGGAAGCCCCGGGCAGTGAGGG - Intergenic
946157783 2:217818276-217818298 CGGGGAGCCCCAGCCTGTGTCGG - Exonic
1170230877 20:14045036-14045058 CCGCAAGCCCCAGGCAGTGAAGG - Intronic
1171307632 20:24119793-24119815 CTAGAAGGCCCAGCCTGTGATGG - Intergenic
1172632748 20:36390223-36390245 CCATCAGACCCAGCCTGAGAAGG + Intronic
1172869916 20:38129602-38129624 CCGTGAGCCCCAGCAAGTGTGGG + Exonic
1173339592 20:42141452-42141474 GCATGGGCCCCAGCCTGTGAGGG - Intronic
1174162889 20:48564317-48564339 CTGCAAGCCCCAGGCAGTGAGGG - Intergenic
1176344835 21:5733726-5733748 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
1176351649 21:5854310-5854332 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
1176499992 21:7590729-7590751 CCGCCAGCCCCAGGCAGTGAGGG + Intergenic
1176539156 21:8131796-8131818 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
1176558107 21:8314841-8314863 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG + Exonic
1180181997 21:46122157-46122179 CCGTGAGTCACAGCCTGGGATGG + Exonic
1180995860 22:19964850-19964872 CCTTAAGCATCAGTCTGTGAAGG - Intronic
1181166248 22:20984780-20984802 CCGTCATGCCCAGCCTGTGCTGG - Intronic
1182087858 22:27573801-27573823 CCCAAGGCCCCAGCCTGAGAAGG - Intergenic
1184437226 22:44486578-44486600 TCATCTGCCCCAGCCTGTGAAGG - Intergenic
1184951710 22:47847751-47847773 CCTAAGGCTCCAGCCTGTGAAGG + Intergenic
1185060084 22:48602156-48602178 CCTCAAGCCCCAGGCAGTGAAGG + Intronic
949194234 3:1286361-1286383 CAGTAGGCCCCAGTGTGTGATGG + Intronic
950418550 3:12882997-12883019 CCGCAAGCCCCGGACAGTGAGGG + Intergenic
951734791 3:25851871-25851893 CCACAAGCCCCGGCCAGTGAGGG + Intergenic
953142422 3:40241162-40241184 CCATAATCCCCAGCCTCAGAGGG + Intronic
953182854 3:40612825-40612847 CCGTAAGCCCCATCCTCTCATGG + Intergenic
955827431 3:62963126-62963148 CAAAAAGCCCCAGCCTGTGGGGG - Intergenic
960868597 3:122227430-122227452 CCGCAAGCCCCGGGCAGTGAGGG - Intronic
963494049 3:146037848-146037870 GCCTAAGCCTCAGCCTGTGTAGG + Intergenic
967979934 3:195059687-195059709 CCAGGAGCCCCAGCCTGAGAAGG + Intergenic
968232585 3:197012402-197012424 CCGTATGCCCCACACAGTGAGGG - Intronic
968412810 4:404211-404233 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
968455960 4:699958-699980 CCGTGGGCCCCAGCCAGAGAAGG + Intergenic
970273930 4:14376961-14376983 CCGAGAGCCCCAGATTGTGAGGG + Intergenic
973169631 4:47124343-47124365 CCATTAGCCCCAGCATGAGAAGG + Intronic
975533621 4:75426179-75426201 CTGTAAGCCCAAGCCTAGGATGG + Intergenic
978837463 4:113169579-113169601 CCATAAGCCAGAGACTGTGACGG + Intronic
979452851 4:120892949-120892971 CACTAAGCCCCATCCAGTGAAGG + Intronic
982647667 4:158044278-158044300 CAGCAAGCCCCAGGCAGTGAGGG + Intergenic
984865206 4:184275077-184275099 CCCTGTGCCCCAGTCTGTGAGGG + Intergenic
986349869 5:6867396-6867418 GTGTAAGCCCCTCCCTGTGAGGG - Intergenic
990243250 5:53837079-53837101 CCGCAAGCCCCAGGCAGTGAGGG + Intergenic
990596979 5:57321980-57322002 CCATGAGCCCCTGCCTGTGGTGG - Intergenic
993803553 5:92375142-92375164 CCACAAGCCCCAGGCAGTGAGGG - Intergenic
993964003 5:94337727-94337749 TCTTATGCCCCAGCCTGTCATGG - Intronic
994647759 5:102491599-102491621 CCGCAGGCCCCAGGCAGTGAGGG - Intronic
995112379 5:108442291-108442313 CCGCAAGCCCCGGGCAGTGAAGG - Intergenic
997297010 5:132774776-132774798 TCGCAAGCCCCAGGATGTGATGG - Intronic
1000902495 5:166927199-166927221 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
1002060709 5:176624166-176624188 CTGTCAGCCCCAGGCTGTGATGG - Intronic
1003178478 6:3771745-3771767 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1004196592 6:13511286-13511308 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
1004905427 6:20233324-20233346 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1006434138 6:34017433-34017455 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
1006803599 6:36774796-36774818 CACCAAGCCCCAGCCTGTGCAGG + Intronic
1008292987 6:49740798-49740820 CTGTAAGACCCATCCTGTGTGGG + Intronic
1009615501 6:65999617-65999639 CCGCAAGCCCCAGGCGGCGAGGG - Intergenic
1015146739 6:129995686-129995708 CAGGAAACCCCACCCTGTGAGGG - Intergenic
1016104738 6:140148373-140148395 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
1017298042 6:152821983-152822005 CCCTAAGCCCCATCCTGAGCTGG - Intergenic
1018729582 6:166638565-166638587 CGGTAAGCAGGAGCCTGTGATGG + Intronic
1018928329 6:168222531-168222553 GGGTAAGCCCCAGCCTGAGGGGG - Intergenic
1019475531 7:1242402-1242424 CCGTCAGGCGCAGCCTGTGGGGG - Intergenic
1020257133 7:6508623-6508645 GGGTAAGCCTCAGGCTGTGAGGG + Intronic
1022174146 7:27857264-27857286 CCGCAAGCCCCAGGCAGTGAGGG - Intronic
1026852694 7:73735069-73735091 CCCTAAGTCCCAGCCCTTGAGGG + Intergenic
1027778954 7:82499721-82499743 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1028058746 7:86282411-86282433 CCGTCGGCCCCAGGCAGTGAGGG - Intergenic
1028189212 7:87825663-87825685 CACTTAGCACCAGCCTGTGAAGG + Intronic
1031109967 7:117596254-117596276 CCGCGAGCCCCAGGCAGTGAGGG + Intronic
1032190450 7:129762524-129762546 CCGTAGGACCCAGCCAGTGCGGG + Intergenic
1032339639 7:131058872-131058894 CCGCCAGCCCCAGGCAGTGAGGG + Intergenic
1034843035 7:154417461-154417483 CCGTAAGCCCCAGCCTGTGAAGG + Intronic
1035294686 7:157860182-157860204 CCTGAGGCCCCAGCCTGTGGTGG + Intronic
1035343746 7:158183741-158183763 CTGTAAGCCCCACAGTGTGAGGG - Intronic
1035833907 8:2727943-2727965 CCGCAAGCCCCGGGCAGTGAAGG + Intergenic
1036557955 8:9876498-9876520 AGGTGAGCCCCAGCCTGGGATGG - Intergenic
1036751479 8:11446246-11446268 TCCTCAGCCCCAGCCTGTGGTGG + Intronic
1043731947 8:83694206-83694228 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
1045493114 8:102685587-102685609 CCCAAAGCCACAGCCTGTCAGGG + Intergenic
1048655417 8:136530662-136530684 CCGCCAGCCCCAGGCAGTGAGGG - Intergenic
1051493615 9:17694834-17694856 CTGTAAGCCCCCACTTGTGAAGG - Intronic
1053093604 9:35303971-35303993 CCATAATCCCCATCCTCTGATGG - Intronic
1053475241 9:38377684-38377706 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1056735933 9:89209510-89209532 CCGCAAGCCCCAGGCAATGAGGG + Intergenic
1057182963 9:93039786-93039808 CCACAAGCCCCAGCCTAAGAGGG + Intergenic
1058526091 9:105859112-105859134 ACCTGAGCCTCAGCCTGTGATGG + Intergenic
1058585376 9:106501548-106501570 CAGCAAGCCCCAGGCAGTGAGGG - Intergenic
1060197116 9:121631024-121631046 GGGTAGCCCCCAGCCTGTGAGGG - Intronic
1186293181 X:8121696-8121718 CCGCAAGCCCCTGGCAGTGAGGG + Intergenic
1190101808 X:47527809-47527831 CCCCAAGTACCAGCCTGTGACGG - Intergenic
1192251392 X:69416875-69416897 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1192497042 X:71623003-71623025 CCGCCAGCCCCAGGCTGTTAGGG + Intergenic
1194890490 X:99372289-99372311 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
1195460270 X:105115962-105115984 CCACAAGCCCCAGGCAGTGAGGG - Intronic
1200829077 Y:7673238-7673260 CCACAAGCCCCAGGCAGTGAGGG + Intergenic
1201430510 Y:13897345-13897367 CCACAAGCCCCAGGCAGTGAGGG + Intergenic
1201468333 Y:14309394-14309416 CCGCAAGCCCCAGGCAGTAAGGG + Intergenic
1201555278 Y:15260271-15260293 CCGCAAGCCCCAGGCAGTGAGGG + Intergenic
1201556313 Y:15267406-15267428 CCGCAAGCCCCAGCCAGTGAGGG + Intergenic
1201885774 Y:18880282-18880304 CCGCAAGCCCCAGGCAGTGAGGG + Intergenic