ID: 1034844271

View in Genome Browser
Species Human (GRCh38)
Location 7:154430024-154430046
Sequence CTGAGAACTGGGAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 1, 2: 4, 3: 82, 4: 647}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034844271_1034844280 8 Left 1034844271 7:154430024-154430046 CCATCCACCCTCCCAGTTCTCAG 0: 1
1: 1
2: 4
3: 82
4: 647
Right 1034844280 7:154430055-154430077 GGTGAGAAGCTCCTCTTCTAGGG No data
1034844271_1034844281 9 Left 1034844271 7:154430024-154430046 CCATCCACCCTCCCAGTTCTCAG 0: 1
1: 1
2: 4
3: 82
4: 647
Right 1034844281 7:154430056-154430078 GTGAGAAGCTCCTCTTCTAGGGG No data
1034844271_1034844279 7 Left 1034844271 7:154430024-154430046 CCATCCACCCTCCCAGTTCTCAG 0: 1
1: 1
2: 4
3: 82
4: 647
Right 1034844279 7:154430054-154430076 AGGTGAGAAGCTCCTCTTCTAGG 0: 1
1: 0
2: 7
3: 58
4: 1991
1034844271_1034844284 29 Left 1034844271 7:154430024-154430046 CCATCCACCCTCCCAGTTCTCAG 0: 1
1: 1
2: 4
3: 82
4: 647
Right 1034844284 7:154430076-154430098 GGGCCGCTGTCAGAATCTCAGGG No data
1034844271_1034844283 28 Left 1034844271 7:154430024-154430046 CCATCCACCCTCCCAGTTCTCAG 0: 1
1: 1
2: 4
3: 82
4: 647
Right 1034844283 7:154430075-154430097 GGGGCCGCTGTCAGAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034844271 Original CRISPR CTGAGAACTGGGAGGGTGGA TGG (reversed) Intronic
900516506 1:3084762-3084784 CCGAGAACAGTGAGGCTGGAAGG - Intronic
900747953 1:4373973-4373995 TGGATAACTGGGTGGGTGGATGG - Intergenic
900781747 1:4623200-4623222 CTCGGAACAGGGCGGGTGGAAGG - Intergenic
901220171 1:7579193-7579215 AGGAGGACTGTGAGGGTGGAGGG - Intronic
901312025 1:8276699-8276721 CTGAGAACCAGGAGGGCGGGTGG - Intergenic
901393412 1:8963203-8963225 CAGAGGACTGGGAGGCTGGGAGG - Intronic
901520975 1:9784745-9784767 CTGAGAACTTGGAGCATGCAAGG - Intronic
901632934 1:10656729-10656751 CCGAGAACCTGGAGGGAGGAGGG + Exonic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902003021 1:13209255-13209277 GTAGGAACTGAGAGGGTGGAAGG - Intergenic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
902237845 1:15068988-15069010 CTGAGAACTGCTGGGGTAGATGG - Intronic
902373415 1:16018890-16018912 CACACAGCTGGGAGGGTGGAGGG + Intronic
903305172 1:22408196-22408218 CTGAGAATAGAGGGGGTGGAGGG + Intergenic
903556812 1:24199887-24199909 CCGAGAAGTGGGAGGGGGGAGGG + Intergenic
903745548 1:25584420-25584442 GAGAGAAATGGCAGGGTGGAAGG - Intergenic
903767668 1:25745075-25745097 CAGAAAACTGTGAAGGTGGAGGG - Intronic
904078790 1:27858959-27858981 CAGAGAAATGGGAGGGCGGCTGG - Intergenic
904575154 1:31500794-31500816 CTCAGAAGGGGGAGGCTGGAGGG - Intergenic
905105104 1:35559260-35559282 CTGAAAATTGGGAGGTGGGAAGG + Intronic
905362790 1:37431871-37431893 CTTAGATGTGGGAGGGTGGGTGG - Intergenic
906735975 1:48128574-48128596 CTGAGAAATTGGAGGGAGCAAGG + Intergenic
906856283 1:49308727-49308749 ATGAGAAAAGGCAGGGTGGAAGG + Intronic
907440126 1:54473863-54473885 TTGGGCACTGGGAGGGTGGCAGG - Intergenic
907653857 1:56322364-56322386 CTGAGAACTAGGAGAGTGAATGG + Intergenic
907660677 1:56390000-56390022 GAGAAAACAGGGAGGGTGGAGGG + Intergenic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
910206267 1:84751729-84751751 CTGAGGGGTGGGAGGGTGGGAGG + Intergenic
910240319 1:85079517-85079539 TTGAGAAGTTGGAGGGAGGATGG + Intronic
910537047 1:88310279-88310301 CTGTGAACTGGGATGGTTAATGG - Intergenic
912279886 1:108302000-108302022 CTGAGATCTGAGAGTGTGGATGG + Intergenic
912288340 1:108392357-108392379 CTGAGATCTGAGAGTGTGGATGG - Intronic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912442793 1:109712111-109712133 CTGGGGACTGGGAGGCGGGAGGG + Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913030110 1:114892918-114892940 CTTAGAACTCAGAGGGTGGGTGG + Intronic
913085786 1:115435307-115435329 CTGAGATGTGGGAGGGTAAACGG + Intergenic
914331490 1:146674795-146674817 CTGAGATCTGGGAGAGTTGGGGG + Intergenic
915351894 1:155232183-155232205 CTGAGACCTGGGGGTATGGATGG + Intergenic
915367563 1:155324342-155324364 CCGAGGATTGGGAGGCTGGAAGG - Intronic
915555197 1:156657364-156657386 CGGAGAGCAGGGAGGTTGGAGGG - Intronic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916027715 1:160848995-160849017 CTTAGAACTGGTGTGGTGGAGGG + Intronic
916902777 1:169247633-169247655 CTCAGAAGAGGGAGGGTTGAGGG - Intronic
917814456 1:178693459-178693481 CTGAGCACTGGGTGTGTGGAAGG - Intergenic
918725612 1:187918104-187918126 CTCAGAATGGGGAGGGTAGAAGG + Intergenic
918916064 1:190639427-190639449 ATGTGCACTTGGAGGGTGGAGGG + Intergenic
921155948 1:212438955-212438977 CTGAGAAGGTGGAGGGTGGGTGG - Intronic
921155951 1:212438962-212438984 ATGACAACTGAGAAGGTGGAGGG - Intronic
921397927 1:214688694-214688716 CTGAGAACCAGGAGAGTTGATGG + Intergenic
922257886 1:223908724-223908746 ATCAGAGCTGGGGGGGTGGAGGG + Intergenic
922791154 1:228311817-228311839 CTGAGAAGTGGGTGGGAGGGAGG + Intronic
922927952 1:229366146-229366168 CTCAGAACGGGGAGAGTGGGAGG - Intergenic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923956952 1:239032941-239032963 CTGAAAATGGGGTGGGTGGAAGG + Intergenic
924451512 1:244182921-244182943 CTGAGAAATAGGAGTGAGGATGG + Intergenic
924703801 1:246481504-246481526 CTGAGAACCAGGAGGATTGATGG - Intronic
1064453508 10:15465450-15465472 CTGAGAACTGGGAAGAAGCAGGG - Intergenic
1065780461 10:29162054-29162076 CAGAGAAGGGGGAGGGTGGAGGG - Intergenic
1066226235 10:33386395-33386417 ATGAGAACTGAGAGTGGGGAGGG - Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1067302788 10:45027782-45027804 CTGACAAATTGGAGGTTGGAAGG - Intergenic
1068405619 10:56585144-56585166 CTGAGAAGGGGGAGAGTGGGAGG - Intergenic
1068456305 10:57258094-57258116 CTAAGGACTGGGAGGGCTGACGG + Intergenic
1069917054 10:71793661-71793683 CTGGGAGCTGGGAGGGAGGTGGG - Intronic
1070086512 10:73243154-73243176 GTGACATTTGGGAGGGTGGAGGG - Exonic
1070103496 10:73411291-73411313 CTCAGAAAGGGGAGGGTGAAAGG + Intronic
1070911836 10:80125721-80125743 CTCAGAACGGGGAGGATGGGTGG + Intergenic
1071755154 10:88529139-88529161 CTGAGGAGTGGGAGGAGGGATGG - Intronic
1072726396 10:97816668-97816690 GTGAGAAATGGGATGGTGGCTGG + Intergenic
1073147789 10:101291996-101292018 GTGAGGACGGGGAGGGGGGAAGG - Intergenic
1073217018 10:101842082-101842104 TTGAGACCTGGGAAGGGGGAGGG - Intronic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1073790467 10:106934906-106934928 CTCAGAAAAGGGAGGGCGGAAGG + Intronic
1073991704 10:109268815-109268837 CTGAGGAGTGGGAGGATGGTAGG + Intergenic
1074212029 10:111344047-111344069 CTGAGAACTGGGAGAGGTGTTGG + Intergenic
1074397102 10:113107246-113107268 CTGGGTACTGGGTGGGTGGGTGG + Intronic
1075270718 10:121047782-121047804 CTGAGAACTGGGGGAGCTGATGG + Intergenic
1075380845 10:122017370-122017392 CTGAGGACTGGCAGGGAGGGAGG - Intronic
1075423381 10:122322994-122323016 TTGAGGACTGGGAGGGTAAAGGG - Intronic
1075686177 10:124366868-124366890 CTGGGAGCTGGGATGGTGGTGGG - Intergenic
1075799900 10:125147097-125147119 CAGGGACCTGGGAGGGTGAAGGG + Intronic
1076239622 10:128894636-128894658 CTGAGTCCTGGGAGTGTGGCTGG - Intergenic
1076296716 10:129391533-129391555 GTGAGAACGGGCAGGGTGGGTGG + Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076438131 10:130460194-130460216 GAGAGGACTGGGAGTGTGGAAGG - Intergenic
1076624203 10:131811541-131811563 CTCAGAACTGGGAGGGATGTCGG - Intergenic
1076934101 10:133555958-133555980 GTGAGACCAGGGAAGGTGGATGG - Intronic
1077274547 11:1697840-1697862 CTGGGAACTGGGAAGGTGTTGGG - Intergenic
1077299986 11:1842319-1842341 CTGGGCACGGGGAGCGTGGAGGG + Intergenic
1077306064 11:1869149-1869171 CTGAGACCCGGGAGGCTTGAGGG + Intronic
1077310298 11:1885716-1885738 GTGAGTACTGGGTGGATGGAGGG - Intronic
1077472209 11:2769384-2769406 CTGTGAGTTGGGAGGATGGAGGG + Intronic
1077498475 11:2898089-2898111 CTGAGAAATGGGACTGTGGCTGG - Intronic
1077789636 11:5424511-5424533 CTGTGTACTGGGAGGATGGAGGG - Intronic
1078433775 11:11308036-11308058 ATGAGAACTGGGAGGATTGGAGG - Intronic
1079015077 11:16861993-16862015 CTGAGAAGAGGGGGTGTGGAGGG - Intronic
1079949673 11:26785397-26785419 ATGAGATGTGGGAGGGTTGAGGG + Intergenic
1080049736 11:27847297-27847319 CAGAGAACTGGGAGGAGGAAGGG + Intergenic
1080673805 11:34405838-34405860 TGGAGAGATGGGAGGGTGGAGGG - Intergenic
1080673833 11:34405967-34405989 TGGAGAAATGGGAGGGTAGAGGG - Intergenic
1080696439 11:34606733-34606755 CTTAGAAATTTGAGGGTGGAAGG - Intergenic
1080809560 11:35689796-35689818 CTGAGGACTGGGCAGGGGGAAGG - Intronic
1081626441 11:44658808-44658830 CTGAGCAGAGGGAGGGAGGAGGG + Intergenic
1082114191 11:48309941-48309963 CTGAGAACTTGGATGGAGGTGGG - Intergenic
1083132665 11:60640307-60640329 CTCAGAAGCGGGAGGGTGGAGGG + Intergenic
1083152088 11:60798209-60798231 TCAAGAACAGGGAGGGTGGAGGG + Intronic
1083303336 11:61750098-61750120 CTGAGAACTGACAGGGAGGCTGG + Intergenic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1083961532 11:66017405-66017427 CTGACAAATGGGTGGGTGGAGGG - Intronic
1083964876 11:66037287-66037309 ATGAGATCTGGGCGGGTGGGGGG - Intergenic
1083988883 11:66234419-66234441 ATGAAAACTGGCAGAGTGGAGGG - Intronic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1085045039 11:73347773-73347795 CTGACAGCTGGGAAGGTGGGTGG + Intronic
1085460214 11:76689004-76689026 CTGAGGCCTGGGAGGGGGCAAGG + Intergenic
1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG + Intronic
1085690183 11:78658161-78658183 CTGAGCACAGGGCGGGTGCAAGG - Exonic
1086106821 11:83156574-83156596 CTGGGAACTGGGAAGTGGGAGGG - Intergenic
1087542773 11:99542322-99542344 CAGAGACTTGGGAGGGTGTAAGG - Intronic
1087846319 11:102977557-102977579 AGGAAAACTGGGAGAGTGGAGGG - Intergenic
1087934017 11:104010797-104010819 TTCAGAACTGTGAGGGTGAAGGG + Intronic
1088390446 11:109308545-109308567 CTGAGAACTGGCAGAGATGAAGG + Intergenic
1089126203 11:116178226-116178248 CTGAGAACTAGGAGGGCTGATGG - Intergenic
1089194874 11:116688356-116688378 CTAAGTATTGGGAGGGTGAAGGG - Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090076707 11:123584366-123584388 CTGAGAAATGGGAGGGGGAATGG + Intronic
1090202574 11:124866723-124866745 CTGAGACCGGGAAGGGTAGAGGG + Intronic
1090406484 11:126478833-126478855 GTGAGTAGTGGGAGGGAGGAGGG + Intronic
1090410829 11:126508523-126508545 ATGAGCCCTGGGATGGTGGAAGG + Intronic
1090851924 11:130578462-130578484 ATGGGAACTGGGATGGTGGAAGG - Intergenic
1091006143 11:131955684-131955706 CGGGGCACTGGGAGGGTGGGAGG - Intronic
1091197903 11:133747449-133747471 GTGAGAAATGGGAGGGAGAAAGG - Intergenic
1091409932 12:232695-232717 CTGAGAAATGGGAGAAGGGAAGG + Intronic
1091791341 12:3273858-3273880 CTGAGATCGGGGAGGGAGCAAGG - Intronic
1091949409 12:4580544-4580566 CAAAGAACTGGGAGGGAGGGAGG - Intronic
1092611163 12:10174567-10174589 TGGAGAACTGGGAGAGTTGATGG - Intronic
1093004156 12:14034037-14034059 CTGAAAACTGGTAGGGTTGTCGG - Intergenic
1093456647 12:19371458-19371480 CTCAGAAGGGAGAGGGTGGAAGG - Intronic
1093542871 12:20308595-20308617 ATGAGAACTAGGCAGGTGGAGGG - Intergenic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1095729181 12:45487553-45487575 CTGAGAACTTGGAGGGTTGATGG + Intergenic
1095921092 12:47532317-47532339 CTGTGAACCAGGTGGGTGGATGG + Intergenic
1095971701 12:47905781-47905803 CTGAGACCTGGAATTGTGGATGG + Intronic
1095989946 12:48027689-48027711 CTGAGACCTTGGAGAGTGGTGGG + Intergenic
1097204005 12:57304555-57304577 TGGAGAACTGGGAAGGTGGATGG + Intronic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099355122 12:81624819-81624841 CTCAGAAGGGGGAGGGTGGAGGG + Intronic
1099642397 12:85308576-85308598 CTGAGAACTGCGAGGTGAGATGG - Intergenic
1099938037 12:89151394-89151416 CTCAGAATGGGGAGGGTGGAAGG + Intergenic
1100473233 12:94912588-94912610 CTGAGAACTGGGGAGGCCGATGG - Intronic
1100797560 12:98198378-98198400 CTGAGATTTTGGAGGATGGAGGG - Intergenic
1101524956 12:105520137-105520159 CTGAGAACTTAGAGGGTAGGAGG + Intergenic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1101629684 12:106480878-106480900 TTGAAAGCTGGGAGGGGGGATGG + Intronic
1102486418 12:113260753-113260775 CTGAGAAGAGGGAGGGTGGCAGG - Intronic
1103220508 12:119240463-119240485 CTGAGAACCAGGAGGGCTGATGG - Intergenic
1103413062 12:120726150-120726172 CTGGGAACTGGGCTGGTGGCTGG - Intronic
1103503433 12:121423313-121423335 CTTCGGACTGGGAGGGTGGCTGG + Intronic
1104298167 12:127537952-127537974 CTCAGAACTGGAGGGGTGGGGGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104963891 12:132500573-132500595 CTATGGACTGGGTGGGTGGAGGG - Intronic
1105070686 12:133232612-133232634 CTGAGACCTGGGAGGCATGAAGG - Intronic
1105946966 13:25198385-25198407 GGGAGAACTGGGTGGGTGGGAGG + Intergenic
1105962640 13:25356039-25356061 ATGAGAACGGGGAGGGCTGAAGG - Intergenic
1106100339 13:26689858-26689880 CTGAGCTCTGGGAGGCAGGAAGG + Intergenic
1107612522 13:42130572-42130594 GGGAGGACTGGGAGTGTGGATGG - Intronic
1107989589 13:45806562-45806584 ATGAGAGTGGGGAGGGTGGAAGG + Intronic
1108008027 13:45972436-45972458 CTCAGAAGGGGGAGGGTGGAAGG + Intronic
1110781454 13:79470552-79470574 ATGTGAATTTGGAGGGTGGAGGG - Intergenic
1112185628 13:97125459-97125481 CTGAGAACTGGGGGTGGGGTGGG - Intergenic
1112655652 13:101450029-101450051 CTGAAAACTGGGAAAATGGAAGG + Intergenic
1113485671 13:110650721-110650743 GTGTGAACTGGGAGATTGGAAGG - Intronic
1113541017 13:111109558-111109580 CAGAGGACAGGAAGGGTGGAGGG + Intergenic
1113559611 13:111267689-111267711 TTGGCAACAGGGAGGGTGGATGG + Intronic
1113743256 13:112725353-112725375 CTGAGAGCAGAGAGAGTGGAGGG - Intronic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1114235707 14:20821821-20821843 CTGACAACTTGGTGGGTGGGGGG + Intergenic
1115156355 14:30343998-30344020 CTGAGAGGTGGGAGGATGGGAGG - Intergenic
1116371373 14:44137482-44137504 CTGAGAACTAGGAGAGTTGATGG + Intergenic
1118163151 14:63311015-63311037 CTGAGACCTGGTAGGGAGGGAGG - Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118509282 14:66452986-66453008 CTGAGAAGTGGGAGGAGGGCAGG - Intergenic
1118641862 14:67799833-67799855 GTGACAATTGGGAGGGCGGAGGG + Intronic
1119571323 14:75676015-75676037 CTGAGAACCAGGAGTGTCGAGGG + Intronic
1120706588 14:87752233-87752255 CTGAGAACAGGGAGAGCTGATGG + Intergenic
1121505404 14:94473227-94473249 CTCAGAACTGGGGTGGTGGCTGG + Intronic
1121602700 14:95217905-95217927 CAGAGAACTGGGATGAGGGAAGG + Intronic
1121615519 14:95311216-95311238 CTGAGAACTGGGGCGGCGGGTGG - Intronic
1121778356 14:96605889-96605911 TTGAGAAGTGGCTGGGTGGACGG - Intergenic
1121895247 14:97640655-97640677 CAGAGAGGTGGGAGGATGGAGGG + Intergenic
1122594309 14:102878835-102878857 CCCAGAACTGGGAGGGTGAGAGG + Intronic
1122689656 14:103526192-103526214 CGGCGCTCTGGGAGGGTGGAAGG - Intergenic
1124980448 15:34565013-34565035 CTGAGAGCCGGGTGGGTGGCAGG + Intronic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125501526 15:40242716-40242738 CTGAGCTCTGGTGGGGTGGAGGG - Intronic
1126873621 15:53014569-53014591 CTGGGACCTGGAAGGGTGAAAGG - Intergenic
1127394143 15:58530032-58530054 CAGAGAACTGGAAGTGTAGATGG + Intronic
1127449524 15:59103270-59103292 CTCAGAAGAGGGAGGGTGGAAGG - Intergenic
1127637919 15:60888908-60888930 CCGAGGAGTGGGAGGGTGGGTGG + Intronic
1127664073 15:61127805-61127827 CGGAGAACTGGACGGGTGAATGG - Intronic
1127903367 15:63357819-63357841 CTGAGAGCAGGGAGAGTGGGAGG - Intronic
1128086726 15:64891781-64891803 GTGGGAACTGGGAGGGAGCAGGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128536496 15:68494664-68494686 CTGAGAACTGGGGGAGCTGATGG + Intergenic
1128756000 15:70184443-70184465 CTGAGAACTAGGAGTGTCAAGGG + Intergenic
1129107430 15:73319413-73319435 CTCAGAAGTGGGAGGGTGGCTGG - Intergenic
1130004766 15:80084482-80084504 CCAAGAAGTGGGAGGGAGGAGGG + Intronic
1130016146 15:80187925-80187947 GTGAGGACTGGGAGGATGGAAGG + Intergenic
1130066579 15:80609680-80609702 CTGCGAAATGGGAGGTGGGAGGG + Intergenic
1130332751 15:82934490-82934512 CGGGGAACTGGGAGGATGGGTGG - Intronic
1130597750 15:85258682-85258704 CTGAGCACTGGGGGGGAGCAGGG + Intergenic
1131267223 15:90923662-90923684 CTCAGAACTGTGAGGCTGGCCGG - Intergenic
1131846584 15:96495352-96495374 CAGAGAAGGAGGAGGGTGGAAGG + Intergenic
1132000359 15:98173145-98173167 CTGAAGACTGGGGGGGTGGGGGG + Intergenic
1132148027 15:99440027-99440049 TTCAGACCTGAGAGGGTGGAAGG + Intergenic
1132394787 15:101464665-101464687 CAGGGAAATGGGAGGCTGGAGGG + Intronic
1132409985 15:101569355-101569377 CTGGGAGCGGGCAGGGTGGAAGG + Intergenic
1132655415 16:1039934-1039956 GTGAGAACTGAGAGTGAGGAAGG - Intergenic
1133052238 16:3123878-3123900 CTGAGAGGTAGGAGGCTGGAGGG + Intergenic
1133191726 16:4138779-4138801 CTGAGATCTCGGATGGTGGGCGG - Intergenic
1133286188 16:4691953-4691975 TTGAAGACTGTGAGGGTGGAGGG + Intergenic
1133733405 16:8595466-8595488 CTGGGAACTGGGAAAGGGGAAGG - Intergenic
1134793270 16:17010679-17010701 CTGAGCACTGGAAGTGTGGCTGG + Intergenic
1135169250 16:20168737-20168759 CTGAGGACTGGGAGAAGGGAGGG - Intergenic
1135171417 16:20187275-20187297 CTTAGGGCTGAGAGGGTGGAGGG - Intergenic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135948587 16:26889837-26889859 CTCAGAAAGAGGAGGGTGGAAGG - Intergenic
1136052350 16:27660846-27660868 CTTAGATCTGGGATGGGGGAAGG - Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1138020034 16:53470464-53470486 CTGAGCACTGAGGGGCTGGATGG - Exonic
1138544045 16:57705790-57705812 AGGAGAAATGGGAGGATGGATGG - Intronic
1138544228 16:57706434-57706456 AGGAGAAATGGGAGGATGGATGG - Intronic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1139311984 16:66035128-66035150 CTGAGAGCTGGAACAGTGGAGGG + Intergenic
1140002064 16:71036105-71036127 CTGAGATCTGGGAGAGTTGGGGG - Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140741319 16:77943991-77944013 GTTAGAAATGGGAGGTTGGAGGG - Intronic
1141105388 16:81229232-81229254 GTTTGCACTGGGAGGGTGGAAGG - Intergenic
1141133865 16:81453221-81453243 GTCAGAAATGGTAGGGTGGACGG + Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142363281 16:89637165-89637187 CTGGGGGCTGTGAGGGTGGACGG + Intronic
1142708200 17:1709655-1709677 CTAAGAACTGGGAGAGGGGCGGG - Intronic
1142906400 17:3045308-3045330 CTAAGAAGTGGGAGGGTGAGAGG - Intergenic
1143122467 17:4617438-4617460 CTGAGACCTGGGATGGCAGAGGG - Intergenic
1143341399 17:6214066-6214088 CTGAGAGGTAGGAGGGTGGGGGG + Intergenic
1143595635 17:7912055-7912077 ATGAGCCCTGGGAGGGAGGAAGG + Exonic
1143623793 17:8096530-8096552 CTGAGAACAGGGAGGATGGAAGG + Exonic
1143771497 17:9171828-9171850 CAGAGCACTGGAAGGCTGGAAGG + Intronic
1144084842 17:11799221-11799243 CAGATAAGTGGGAGGGTGGCAGG - Intronic
1145017054 17:19406108-19406130 CAGAGATCTGACAGGGTGGATGG + Intergenic
1145235957 17:21208614-21208636 CTCAGAACTGGGAAGGTGATTGG - Intronic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1146097661 17:29947408-29947430 CTCAGAAGTGGGAGGGTGGAAGG + Intronic
1146721110 17:35124134-35124156 CCAAGACCTGGGAGGCTGGATGG + Intronic
1146839081 17:36137082-36137104 CTGACAACAGGGTGGGTGGTTGG + Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1149272561 17:54996221-54996243 CAGAGAAGTGGCAGGGTGGATGG + Intronic
1149350202 17:55779008-55779030 CTAGGAAGTGGGAGGTTGGAAGG - Intronic
1150191602 17:63246477-63246499 CTGGGAACTGGGAGAGGGAATGG - Intronic
1150239641 17:63621834-63621856 CCGAGAACCCGGAGGGCGGAAGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1151620299 17:75240914-75240936 CTGAGGCCTGGGGTGGTGGAGGG + Exonic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151873427 17:76851842-76851864 CTGAGATCTGGGATGATGGATGG + Intergenic
1152045285 17:77930975-77930997 CTGAGAACTGGGGGAGAGGAAGG + Intergenic
1152756871 17:82090661-82090683 AGGAGACCTGGGAGGGTCGATGG - Intronic
1152850637 17:82632626-82632648 CACAGAAGTGGGTGGGTGGATGG - Intronic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1153539561 18:6139622-6139644 CTGAGAGCTGGGAGGGGAGAAGG - Intronic
1153679657 18:7488579-7488601 CTGAGGAATGGGAGGGCGCATGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154027000 18:10717338-10717360 TTGAGGACTGGCACGGTGGAGGG + Intronic
1154473490 18:14726867-14726889 CAGAGACCTAGGAGGGTGGGAGG - Intergenic
1155160503 18:23191532-23191554 TTGGGAACTGTGGGGGTGGAAGG + Intronic
1155337116 18:24775987-24776009 CTGAGAACTGGGAGTGTCAATGG + Intergenic
1155763255 18:29592192-29592214 TTGAGAGGTGGGAGGGTGGTAGG + Intergenic
1155780848 18:29832804-29832826 CTGAGAGTTGGGAGGATGAACGG + Intergenic
1156105683 18:33657337-33657359 CTGAGAATTGGGAGGCTGGCAGG + Intronic
1156120242 18:33834292-33834314 CTGAGATCCAGGAGGTTGGAGGG - Intergenic
1156562792 18:38147612-38147634 CTCAGCACTGAGAGAGTGGAGGG - Intergenic
1157297939 18:46459499-46459521 CAGAGAATTGGGAGGGGGGAGGG - Exonic
1157300846 18:46477957-46477979 CAGAGAGGTGGGAGAGTGGAGGG + Intronic
1157349436 18:46871433-46871455 CTCAGAACAGGGAGGGAGGGAGG + Intronic
1157449975 18:47778770-47778792 CCTAGGGCTGGGAGGGTGGAGGG + Intergenic
1157507256 18:48236969-48236991 CTGAGAAATGGGAGGGGAAAGGG + Intronic
1157556300 18:48615271-48615293 CTGAGAGCTGTGGAGGTGGACGG + Intronic
1157595019 18:48859182-48859204 ATGAGGACAGGGAGAGTGGAAGG - Intronic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1157990247 18:52487118-52487140 CTGTGGACTGGGAGGGTTGGTGG + Intronic
1160040481 18:75340394-75340416 ATGTGAACTGGGAGGATGGACGG + Intergenic
1160226514 18:77016278-77016300 CTGAGAAGTGGAAGGGGGGAGGG - Exonic
1160409838 18:78667946-78667968 GGGAGAGGTGGGAGGGTGGATGG - Intergenic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160717665 19:583687-583709 CTGGGAACTTGGAAGGTGGCTGG + Intergenic
1160813539 19:1024932-1024954 CTGAGCACTGGAAGTGTGGCTGG - Intergenic
1161046102 19:2135880-2135902 GTGGTAACTGGGAGGGAGGAGGG - Intronic
1161214149 19:3084973-3084995 CTGAGGACAGGCAGGGTGCAAGG - Intergenic
1161899219 19:7105310-7105332 CAGACAAATGGGTGGGTGGATGG + Intergenic
1162393212 19:10402274-10402296 GTGAGCACTGAGAGGGTGGTGGG + Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164479800 19:28602612-28602634 CTGAGGAGTGGGAGGGAGGTGGG - Intergenic
1164530558 19:29045138-29045160 CTGAGAACTAGGAGAGCAGATGG - Intergenic
1165127838 19:33613254-33613276 CTGAGGACAGGGACGGGGGACGG + Intergenic
1165213138 19:34251375-34251397 CTTAAAACTGGGAGGGAGGCCGG + Intergenic
1165991318 19:39816280-39816302 CTGAGAACCTGGAGCCTGGAGGG + Intergenic
1166602115 19:44105667-44105689 CTCAAAATGGGGAGGGTGGAAGG - Intronic
1166706547 19:44911195-44911217 CTGAGAACTGAGGGGGTGGGAGG - Intergenic
1166827946 19:45621112-45621134 AGGAGAACTGGGAGTGGGGAGGG + Intronic
1166840706 19:45695404-45695426 GAGAGAGGTGGGAGGGTGGACGG - Intronic
1166987923 19:46673239-46673261 TGGAGAACTGGGGAGGTGGAGGG + Intergenic
1167077797 19:47259828-47259850 ATGAGAACAGAGAGGGTGGCAGG + Intronic
1167092082 19:47351447-47351469 CTGAGAAGTGGGGGGTTGAAGGG + Intronic
1167221831 19:48204300-48204322 CTGGGAACTGGAGGGATGGAGGG + Intronic
1168146008 19:54420497-54420519 CTGGGAACCGGGAGGGTGTCAGG + Intronic
1168158758 19:54493851-54493873 AAGAGAACTGGGAGGGGAGAAGG + Intergenic
1168352823 19:55686337-55686359 CTCAGGACTGGGAGGGAGGCTGG + Intronic
1168707476 19:58478159-58478181 CTGAATCCTGGGTGGGTGGAAGG - Exonic
925186933 2:1854240-1854262 CTGCTAACTTGGAGGGTGGCGGG + Intronic
925296478 2:2780594-2780616 GTGAAACCTGGGAGGGTGTAGGG - Intergenic
925455861 2:4016087-4016109 CTGAGAACTGGGGGAGTGGATGG + Intergenic
925745042 2:7036754-7036776 CTGAGATCTGGTAAGGTGAATGG - Intronic
926026399 2:9548918-9548940 AAGAGAAGTGGGAGAGTGGAAGG - Intronic
926083171 2:10004980-10005002 CTGAGAACTGGGTGGGGAGTGGG - Intergenic
926142315 2:10375013-10375035 CAGAGAGCTGGGAGCCTGGAGGG + Intronic
926789439 2:16555449-16555471 CTGAGCACTGAGTGGATGGAAGG - Intronic
926804882 2:16699047-16699069 CTCAGAAGTGGGAGGGTAGGAGG + Intergenic
926906945 2:17814834-17814856 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927469942 2:23366165-23366187 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927885473 2:26715677-26715699 CTGAGGGCCGGGAGGGTGTAGGG + Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928293045 2:30056805-30056827 CAAAGAACTGGTAGGGAGGATGG + Intergenic
928944552 2:36760871-36760893 CTGAGAACTGGGATGGGGTGAGG + Intronic
929712596 2:44279963-44279985 CTGAGCACTTGCAGGGTGGCTGG - Intronic
930153388 2:48080394-48080416 CTAAGAACTGGGTGAGTTGATGG + Intergenic
930575062 2:53136480-53136502 ATGGGAAGTGGGAGGATGGAAGG + Intergenic
932126091 2:69146735-69146757 ATGAGAGCTGGCAGGGTGCAAGG - Intronic
932286908 2:70542188-70542210 CTAAGAACTGGGAGAGGGAAGGG + Intronic
933264533 2:80168203-80168225 CTGAGAGCTGTGAGGCTGGAGGG - Intronic
933599747 2:84317402-84317424 CTGGGAACTAGGATGGTTGATGG - Intergenic
934151298 2:89150113-89150135 CTTATAATTGGGAGGGAGGAGGG + Intergenic
934215960 2:90031797-90031819 CTTATAATTGGGAGGGAGGAGGG - Intergenic
935328073 2:101955894-101955916 CTGAGAACCAGGAGCATGGAGGG + Intergenic
936080415 2:109429098-109429120 CTGAGAGGTGGGAGGGAGGCAGG + Intronic
936287679 2:111193345-111193367 CCCAGAGCTGGGAGGGTGGGTGG + Intergenic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
938220786 2:129565634-129565656 CTGGGAACAGGGAGTGTGGAGGG - Intergenic
938315016 2:130319157-130319179 CTGAGAACTGGGCGGGGGGTGGG - Intergenic
939009774 2:136832342-136832364 CTGAGAACCAGGGGGGTGGATGG + Intronic
939106170 2:137951159-137951181 CTCAGAAGTGGAAGGGTGGGAGG - Intergenic
941371502 2:164671139-164671161 CTGAGAATTGGGAGTGATGAAGG - Intronic
942114104 2:172711337-172711359 ATGTAAACTGTGAGGGTGGAAGG - Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
943330083 2:186548703-186548725 CTGAGAACCAGGAGAGTTGATGG - Intergenic
943608459 2:190004123-190004145 CTTAGAATGGGGAGGGGGGAGGG + Intronic
944364350 2:198899087-198899109 CCCAGAAATGGGTGGGTGGATGG + Intergenic
944512158 2:200475450-200475472 CGGACAACTGGGAGCGAGGAGGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946896375 2:224328394-224328416 TTGAGAAATGGGAGTGTGGGAGG - Intergenic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948371072 2:237489283-237489305 CAGAGAACTGGGAGAGCAGAGGG + Intronic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948920949 2:241065684-241065706 GCAAGAACTAGGAGGGTGGACGG - Intronic
1168979883 20:1995427-1995449 CTAGGAACTTGGAGGGTAGATGG - Intergenic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169219915 20:3816168-3816190 CTGAGAACAGTGAGGCAGGAAGG - Intergenic
1169248301 20:4041445-4041467 CCGAGGAGTGGGAGGCTGGAAGG - Intergenic
1169416578 20:5422352-5422374 CTCAGAAGCTGGAGGGTGGAAGG + Intergenic
1169474351 20:5917524-5917546 CTGAGAACTGGAAGGGTTTCAGG + Intronic
1169474796 20:5921625-5921647 CTGAGAACATGTTGGGTGGATGG + Intronic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169743121 20:8916621-8916643 CTGAGAAATGGGGTAGTGGATGG - Intronic
1169906849 20:10613190-10613212 GTGACAGTTGGGAGGGTGGAGGG - Intronic
1169969108 20:11249416-11249438 CTGAGAATTCAGTGGGTGGAGGG - Intergenic
1169998139 20:11582615-11582637 CTGACAACTGAGAGGGAAGAAGG - Intergenic
1170232116 20:14060587-14060609 TTGAGACCTGGGATGGAGGATGG + Intronic
1170266900 20:14477080-14477102 CAGAGAATTGGGAGGCGGGAAGG + Intronic
1170832056 20:19851176-19851198 CTGGGAACTGGGGTGATGGAGGG + Intergenic
1170840187 20:19918998-19919020 CTGAAGGCTGGGAGGCTGGAAGG + Intronic
1170876059 20:20251354-20251376 CCCACAACTGGGAGGGTGGGAGG - Intronic
1171429156 20:25069611-25069633 CTGAGGAGTGGGAGAGGGGATGG + Intergenic
1171948166 20:31396872-31396894 CTCAGAACTGGGAGAGGAGATGG - Intergenic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172114074 20:32563303-32563325 TAGAGAACAGGGAGGGTGAAGGG + Intronic
1172534726 20:35664573-35664595 CTGAGATCTGAGAGGATGCAAGG - Intronic
1172620432 20:36315320-36315342 CTGAGACCTGAGAGTGAGGAGGG + Intronic
1172876973 20:38170317-38170339 CTGAGAGCCAGGTGGGTGGAGGG - Intergenic
1172936878 20:38626795-38626817 CTGAGAACTGGGGGCGGGGTGGG - Intronic
1173417395 20:42869108-42869130 CAGAGAACTGCCAGGGTGGGTGG + Intronic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173857213 20:46258204-46258226 AAGAGAACTGGGAGGAGGGAAGG + Intronic
1173972762 20:47165397-47165419 CTGGGAAGTGGGGGAGTGGAAGG - Intronic
1174078588 20:47955216-47955238 GTGAGAGCTGGGAGTCTGGATGG + Intergenic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1174565728 20:51463217-51463239 CTGGGAAGTGGGAGAGTGGAGGG + Intronic
1174750730 20:53108956-53108978 CTGAGTTCTTGGAGGGTAGAGGG - Intronic
1175334618 20:58187199-58187221 CTGGGCTCTGGGAGAGTGGAAGG + Intergenic
1175655839 20:60769707-60769729 ATGAGAAATGAGAGAGTGGAGGG - Intergenic
1176663959 21:9667012-9667034 CTGAGAACCTGGAGGGCTGATGG + Intergenic
1176800992 21:13430998-13431020 CAGAGACCTAGGAGGGTGGGAGG + Intergenic
1177960119 21:27653827-27653849 TTTAGAACTTGGAGGGTGGTAGG + Intergenic
1178423576 21:32461111-32461133 CTGAGAACTGCAGGGATGGAGGG + Intronic
1179167487 21:38946042-38946064 CTGAGGACTGGGCTCGTGGACGG - Intergenic
1179440960 21:41393883-41393905 TTTAGAACTGGGTGGGCGGATGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180587666 22:16907206-16907228 CTTACAACAGGGAGGGAGGAAGG + Intergenic
1180898302 22:19353293-19353315 GTGAGGCCTGGGAGGATGGAGGG + Intronic
1181459410 22:23077519-23077541 CTTGGAATTGGGAGGCTGGATGG + Intronic
1182059891 22:27389269-27389291 GGGAGACCTGGGAGTGTGGAGGG - Intergenic
1182320899 22:29478227-29478249 CTTAGAACTAGGGGGCTGGAAGG + Intergenic
1182473064 22:30560560-30560582 CTGAGAAGTGGGAGGCTGACAGG - Intronic
1182650529 22:31847757-31847779 ATGAGAACTGGGAGGGGCCAGGG - Intronic
1182842783 22:33405308-33405330 CTGACAGGTGGGAGGCTGGAAGG - Intronic
1182939290 22:34259431-34259453 CTGATACCTGGGAAGGTGGGTGG - Intergenic
1183383959 22:37504339-37504361 CTGAGGACTGGGATGGTGCTGGG - Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1183516944 22:38272440-38272462 CAGTGACCTGGGAGGGTGGTCGG - Intronic
1183726030 22:39590152-39590174 CTGGGAACTGGCAGGTTTGAGGG + Intronic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1184088979 22:42282684-42282706 CAGAGACCTGGGAGGGAGGCCGG + Intronic
1184277683 22:43419521-43419543 CTGAGAAGTGGGAGTGGGGCTGG + Intronic
1184834217 22:47011395-47011417 CTGAGAACTGGGAGATTAGAAGG + Intronic
1184835769 22:47020032-47020054 CTGAGACATGGGTGGGGGGATGG - Intronic
1185402089 22:50624474-50624496 CAGAGGCCTGGGAGGGTGGAGGG + Intronic
1185406848 22:50657091-50657113 TTGAGAACTGGGGAGGTGGCCGG - Intergenic
949585347 3:5431608-5431630 CTGAGAACTGGGGGAGCTGATGG - Intergenic
949801751 3:7911823-7911845 CTGAGAACTTGGAGGGTGAGGGG - Intergenic
949855637 3:8458555-8458577 CCAAGAGCTGGGTGGGTGGATGG + Intergenic
950181363 3:10915679-10915701 CTGAGGACTGGAGGGGAGGAGGG + Intronic
950185032 3:10939596-10939618 GAGAGAACTGAGAGGGAGGATGG - Exonic
950200068 3:11036419-11036441 CTGAGGACTGGGAGGTGGCAGGG + Intronic
950327942 3:12130375-12130397 CTGAGAACTGGGAGAGCCAATGG + Intronic
950464830 3:13147313-13147335 CTCAGAAGAGGGAGGGTGGGAGG - Intergenic
951804691 3:26631396-26631418 CTGATAACTGGGAAGTGGGAAGG - Intronic
952083995 3:29795704-29795726 CTGTAAACTGGGAGGAAGGAGGG + Intronic
952304092 3:32130130-32130152 CTGCGAACAGGGAGAGTGGGAGG + Intronic
952588971 3:34928304-34928326 CATAGAAGTGGGAGGGTGGGAGG + Intergenic
952618083 3:35299889-35299911 CTCAGAAACGGGAGGGTGGTGGG - Intergenic
953072961 3:39541425-39541447 CTGAGAACCGGAAGAGTTGATGG + Intergenic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953460214 3:43076111-43076133 GTGGGGACTGGGAGGGTGCAGGG + Intergenic
953551832 3:43909011-43909033 CTCAGGGCTGGGAGGGTGTAGGG + Intergenic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
954148737 3:48647179-48647201 GGGAGATGTGGGAGGGTGGAGGG + Intronic
954148745 3:48647200-48647222 GGGAGATGTGGGAGGGTGGAGGG + Intronic
954148756 3:48647228-48647250 GGGAGATGTGGGAGGGTGGAGGG + Intronic
954148803 3:48647355-48647377 GGGAGATGTGGGAGGGTGGAGGG + Intronic
954148832 3:48647433-48647455 GGGAGATGTGGGAGGGTGGAGGG + Intronic
954148843 3:48647461-48647483 GGGAGATGTGGGAGGGTGGAGGG + Intronic
954148884 3:48647564-48647586 GGGAGATGTGGGAGGGTGGAGGG + Intronic
954148915 3:48647642-48647664 GGGAGATGTGGGAGGGTGGAGGG + Intronic
954688215 3:52382099-52382121 ATCAGAGCTGGGAGGATGGAAGG + Intronic
954847136 3:53569264-53569286 GTGAGAACTTGCAGTGTGGAAGG - Intronic
955396005 3:58557945-58557967 CAGATAAGGGGGAGGGTGGAGGG + Intergenic
956273331 3:67470972-67470994 CTGTTAACTGGGAGGGTGATGGG + Intronic
957639071 3:82826940-82826962 CTGAGAACTGGGGGAGCTGATGG + Intergenic
957989746 3:87613430-87613452 CTCAGAACTGGAAGGGAGGGAGG - Intergenic
958192758 3:90204594-90204616 CTGTGAACTGGGCGGTTGGATGG - Intergenic
958832094 3:99101571-99101593 CTGAGAACAAGGAGAGTTGAAGG + Intergenic
959298460 3:104568922-104568944 CTAAGAACTGGGGGGGGGGGGGG - Intergenic
959430672 3:106251422-106251444 CTGAGAACTTGGGGGTAGGAAGG + Intergenic
960126678 3:114006150-114006172 ATGAAAACTGGGAGAGTGGCCGG + Intronic
960569430 3:119171166-119171188 CTGAGAACTGGGGTCCTGGAGGG + Intronic
960967810 3:123117024-123117046 AAGAGAGCTGGGAGGGGGGATGG + Intronic
961411678 3:126726804-126726826 CTGAGGACTGGGTGTGTGGAGGG + Intronic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961581603 3:127887857-127887879 CTGAGAACCAGGAGGGCAGATGG + Intergenic
961654988 3:128436199-128436221 CTGAAGACTGGAAGGGTGGAAGG + Intergenic
961826482 3:129601817-129601839 CTGAGGGCTTGGAGGGTGGCAGG - Intronic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962315552 3:134357360-134357382 CTGACAACTGGCAGGGCAGAGGG + Exonic
962366557 3:134789854-134789876 CAGAGAATTGGGATGGTGGTTGG - Intronic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
962946899 3:140180178-140180200 CTGCCAACTGGCAGGGAGGAGGG - Intronic
962969059 3:140382080-140382102 TAGAGAGATGGGAGGGTGGAGGG - Intronic
963297196 3:143558845-143558867 ATGAGATCTGGGAGGGGGCAGGG + Intronic
964297971 3:155254602-155254624 CTGAGAACTGAGAGTGTGGGTGG - Intergenic
964304733 3:155327634-155327656 TTGAGAGCTTGGAGAGTGGAGGG - Intergenic
964683724 3:159370810-159370832 CTGAAAACTGGGGAGGTGGGAGG - Intronic
964858756 3:161176629-161176651 GTGAGAACAGTGATGGTGGATGG + Intronic
965448082 3:168800896-168800918 CTGAGAGGTGGGAGGGTTGCTGG - Intergenic
966882098 3:184356290-184356312 CTGAGGATTGGGAGTGGGGAGGG - Intronic
967598252 3:191353399-191353421 TTGAGAAATGGGAGGGTGAAAGG + Intronic
967821647 3:193844229-193844251 CTGAGCTCTGGGAGTGGGGAGGG + Intergenic
967871787 3:194235874-194235896 CTGATATTTGGGAGGCTGGATGG + Intergenic
967957519 3:194888734-194888756 CTGAGCACTGGGAGGGCACAGGG - Intergenic
967981310 3:195066801-195066823 CTGTGCACTGGGGGGTTGGAAGG + Intergenic
968594721 4:1476458-1476480 ATGATAAATGGGTGGGTGGATGG + Intergenic
968813045 4:2808770-2808792 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813062 4:2808819-2808841 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813079 4:2808868-2808890 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813096 4:2808917-2808939 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813113 4:2808966-2808988 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813130 4:2809015-2809037 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813147 4:2809064-2809086 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813164 4:2809113-2809135 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813181 4:2809162-2809184 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813198 4:2809211-2809233 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
969445975 4:7244942-7244964 CTGAGAAGTGGGCAGTTGGAAGG + Intronic
969856827 4:10006712-10006734 CTGGGAACTTGGATGTTGGAAGG + Intronic
971784440 4:31082769-31082791 CTCAGAAGAGGGAGGGTGGGAGG + Intronic
972670335 4:41209075-41209097 ATGAGAGCTGGGAGAGAGGAAGG - Intronic
974468715 4:62291807-62291829 GTGAGAACTGGAAGGGTGAGGGG - Intergenic
974686553 4:65239102-65239124 CTAAGAACCAGGAGGGTTGATGG + Intergenic
974847764 4:67371617-67371639 CTGAGAACTGGGAGCACTGAAGG + Intergenic
975437443 4:74369300-74369322 CTCAGAAGGGGAAGGGTGGAAGG - Intronic
975531115 4:75400317-75400339 CTGAGAACAGGGAAAGTGGTGGG - Intergenic
975742556 4:77443608-77443630 CTGAGAACTGGGGGTGGGGTGGG - Intergenic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
977707633 4:100088991-100089013 CTCAGAACGGGAAGGGTGGGAGG - Intergenic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
979137294 4:117125577-117125599 CTGAGGTCTGGGGGAGTGGATGG - Intergenic
979238036 4:118423735-118423757 ATCAGAGCTGGGGGGGTGGAGGG - Intergenic
979446054 4:120813399-120813421 TAGAGAAGTGGGAGAGTGGATGG - Intronic
979967003 4:127087354-127087376 ATGAGATTTGGGAGGGTGCAGGG + Intergenic
980437473 4:132796575-132796597 CTGAGAGATGGCAGAGTGGAAGG + Intergenic
980963803 4:139501426-139501448 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
981033778 4:140151314-140151336 CGGAGAACTGGGAGGAGGGAAGG + Intronic
981242493 4:142493842-142493864 ATGAGAACTGGGAGGGACCAGGG + Intronic
981747916 4:148068837-148068859 CTGAAAACTGAGTTGGTGGAAGG + Intronic
982933398 4:161437766-161437788 GTGAGAAGTGAGATGGTGGATGG + Intronic
985051359 4:185995518-185995540 CTGAGAACCAGGAGAGCGGATGG + Intergenic
985070439 4:186162452-186162474 CTGAGATCCCGGAGGTTGGAGGG - Intronic
985291002 4:188387700-188387722 CAGAGAACTGAGAGACTGGAAGG + Intergenic
985365477 4:189227183-189227205 TTGAAAACTGGGTGGGTGGAGGG - Intergenic
985409415 4:189667692-189667714 CTGAGAACCTGGAGGGCTGATGG + Intergenic
986207015 5:5634451-5634473 CTGAGAGCTGGGAAGGAGGTTGG - Intergenic
986273984 5:6257560-6257582 CTCAGAGCTGGGAGGCTGGCGGG - Intergenic
986687501 5:10287481-10287503 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
986752579 5:10802181-10802203 GTGAGAGATGGGAGGGAGGAGGG - Intergenic
987744197 5:21948690-21948712 GTGAGATCTGGGAGGGTCCAGGG + Intronic
987872506 5:23638992-23639014 CTGAGACCTGGATGGATGGATGG + Intergenic
988719930 5:33867453-33867475 CTCAGAAGTGGGAGGTTGGAAGG + Intronic
988737588 5:34038271-34038293 GTGAGCACAGGGAGGATGGAAGG + Intronic
989995050 5:50819386-50819408 CTGAGACCTTGTAGGGAGGAGGG - Intronic
990285709 5:54298831-54298853 AAGAGAACTGAGAGGTTGGAAGG - Intronic
990449106 5:55918801-55918823 CTGAGTCCTGGGTGGGTGGTGGG - Intronic
990535354 5:56716238-56716260 CTGAGCACTGGGAGGATTGGAGG - Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991348805 5:65699378-65699400 CTCAGAAGTGGGAGGATGGGAGG + Intronic
992413648 5:76532470-76532492 CTGAGGATTGGGTGGGTGGGGGG + Intronic
992877218 5:81068827-81068849 CTGAGGCCTGGGAGGGAGGGAGG - Intronic
994107889 5:95966609-95966631 CTTTGAACTGGAAGGGAGGAGGG - Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995095124 5:108226855-108226877 CTGAGAACTGGGAGAGCCAATGG - Intronic
995165878 5:109041065-109041087 CAGAAAACTGGGAGTGTGAATGG + Intronic
995548237 5:113253911-113253933 CAGAAAACTGGGTGAGTGGAAGG + Intronic
995562300 5:113395901-113395923 CTGGGAAATGGGAGAGGGGAAGG + Intronic
996633161 5:125661611-125661633 ATGAGAACAGGGAGGGAGAAAGG - Intergenic
997832194 5:137159487-137159509 CTCAGAAGTGGGAGGCTGGCGGG - Intronic
998463597 5:142326071-142326093 CCGAGAACTGGCCAGGTGGATGG + Intronic
998911778 5:146967752-146967774 CTGCAAACCGGGAGGGAGGAGGG - Intronic
998921990 5:147079679-147079701 CAGAGGCCTGGGAGGGTGGTAGG + Intronic
999154773 5:149450427-149450449 CTGACAGCTGGGAGGGTGGCTGG - Intergenic
999449997 5:151670796-151670818 CTGGGCACTGGGAGTGGGGAGGG + Intronic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000204887 5:159049404-159049426 CAGAGAAGTAGGATGGTGGAGGG + Intronic
1000285929 5:159826236-159826258 CTGAGAAATGGGAGACTGGAGGG - Intergenic
1001214915 5:169846848-169846870 CTCAGAAGGGGGAGGGTGGAAGG - Intronic
1001355918 5:171022625-171022647 CTGGGACCAGGGAGGCTGGAAGG - Intronic
1002093584 5:176818135-176818157 CTGAGAAGTGGGTGGGCGCAGGG + Intronic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1002495316 5:179607673-179607695 CAGGGCACTGGGAGGGTGGGTGG - Intronic
1002637220 5:180614420-180614442 CTGAGAGCTGGGAGGGAGAGGGG - Intronic
1002759967 6:193784-193806 CTGAGAGCTCTGGGGGTGGAAGG + Intergenic
1003347051 6:5279685-5279707 CTGAGAACCAGGAGAGTGGATGG + Intronic
1003749884 6:9043338-9043360 CTCAGAAAGGGGAGAGTGGAAGG - Intergenic
1004170674 6:13293330-13293352 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
1004436550 6:15600701-15600723 CTGAGAACTGAGCAGGTGGTAGG + Intronic
1004468758 6:15909508-15909530 CTGAGCACCTGGAGGGAGGAAGG + Intergenic
1004947997 6:20636670-20636692 CTGAGAGGTGGGATGGGGGAGGG + Intronic
1005140090 6:22621866-22621888 CTGAGAATGAGGTGGGTGGAGGG - Intergenic
1005399098 6:25413192-25413214 CTTAGAGCTGGGAGTTTGGAAGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006395065 6:33781872-33781894 CCGAGAGCAGGGAGGGTGCAGGG + Intronic
1006682774 6:35809059-35809081 CTGGGAACAGGGAGGGGGCAGGG + Intronic
1006939167 6:37740259-37740281 CTGAGAACTGTGAGGAAGAAAGG - Intergenic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1007832471 6:44649017-44649039 CCCTGGACTGGGAGGGTGGAAGG - Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008018474 6:46548288-46548310 GTGAGAGCTGGGAGGGTAGAAGG - Intergenic
1008027252 6:46652726-46652748 CTGAAAACTGGGACAGAGGAAGG - Exonic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1010116845 6:72322844-72322866 CTGGAAATTGTGAGGGTGGAAGG + Intronic
1010506062 6:76661083-76661105 CTAAGAACTGGTAGAGTGGCTGG + Intergenic
1012648800 6:101724830-101724852 CTGAGAAATAGGAGGTTTGAGGG + Intronic
1013288572 6:108700361-108700383 ATGAGAACTGGAAGTGGGGATGG + Intergenic
1013675619 6:112458451-112458473 CTGGGAACTGGGATGATGGCAGG - Intergenic
1015449419 6:133348077-133348099 CTGAGAGCTTGAAGGATGGAAGG - Intronic
1015790193 6:136957944-136957966 CCTGGAACTGGGTGGGTGGATGG - Intergenic
1016033288 6:139359648-139359670 CTCAGAACAGGAAAGGTGGAAGG + Intergenic
1016093160 6:140003542-140003564 CTGAGAACCAGGAGAGTGGATGG - Intergenic
1016103925 6:140138534-140138556 CTGAAACCTGGGAAGGTGAAAGG - Intergenic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1016789738 6:148055515-148055537 GGGTGAACTGGGAGGGAGGAGGG - Intergenic
1016830317 6:148427183-148427205 ATGAGAACAGGGAGGGTGAGAGG + Intronic
1017125615 6:151061515-151061537 CTGAGAACTTGGATTGTGGGAGG - Intronic
1017836211 6:158180588-158180610 TTGAGACTTGGGAGGGTGTATGG + Intronic
1017915151 6:158825875-158825897 CTGAGAACAGGGAGGCTAGGAGG - Intergenic
1018266572 6:162030590-162030612 CTTAGAACAGGGAGTGTGCAGGG - Intronic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019289803 7:244943-244965 CTGAGAACAGCGTGGGAGGACGG + Intronic
1019410048 7:902653-902675 ATGAGAACAGGGAAAGTGGAGGG + Intronic
1019815380 7:3196119-3196141 CTGAGTGCTGGAAGGGAGGATGG - Intergenic
1019882965 7:3879576-3879598 CTGAGTACCGGGAGCGTGGCTGG - Intronic
1020055751 7:5116802-5116824 GATAGAACTGGGAGGGTGGGTGG + Intergenic
1020440851 7:8215136-8215158 CGGAGTAGTGGGAGGGTGTAGGG - Intronic
1022085425 7:27062897-27062919 CTGGGATCTGGGAGGCTGCATGG - Intergenic
1022166219 7:27765472-27765494 CTGAGGACTGGGAGTGGGGGTGG - Intronic
1022477385 7:30720382-30720404 GTGAGACCTGGGAGGGAGTAGGG + Intronic
1022504927 7:30903901-30903923 GTGAGGCCTGGAAGGGTGGAAGG - Intergenic
1023094541 7:36646955-36646977 ATATGAACTTGGAGGGTGGAGGG + Intronic
1023802746 7:43849178-43849200 CTGACAGCTGGGAAGGAGGAGGG + Intergenic
1023965470 7:44961443-44961465 CTGAGCACTGAGGGGGTTGAGGG + Intergenic
1026166862 7:67917909-67917931 CTGAAAGGTGGGAGGGTGGGTGG - Intergenic
1026185107 7:68076336-68076358 CTGAGAACCGGGGGAGTTGATGG - Intergenic
1026428976 7:70325102-70325124 GAGAGAAGTGGGAGGCTGGAAGG + Intronic
1026668624 7:72366632-72366654 CTCAGAAGTGGGAGGATGGAAGG - Intronic
1026845669 7:73697707-73697729 CTGGGAGCTGGCAGGGTGGGTGG + Intronic
1027522680 7:79229946-79229968 CTGAAGACTGTGAGGGTGGGGGG - Intronic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1029998295 7:105031354-105031376 CTGAGGATTGGGGGGGTGGTGGG + Intronic
1030248524 7:107413435-107413457 CTAAGAGCTGGGAGGGAGAAAGG + Intronic
1030294350 7:107906588-107906610 CTAGGAAATGGAAGGGTGGAAGG - Intronic
1031327792 7:120423317-120423339 CAGAACACTGGGAGGGTTGAAGG + Intronic
1031406806 7:121396197-121396219 CTGAGCGCTGGGAGGCCGGAAGG - Exonic
1034516568 7:151585522-151585544 CTGAGAACAGGGAGGGAGAATGG - Intronic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1034974822 7:155441937-155441959 CAGAGCCCTGGGAGGGGGGAGGG - Intergenic
1035741143 8:1929665-1929687 GAGAGAAGTGGGAGGGTGGGAGG - Intronic
1038140015 8:24834158-24834180 CTGAGAACCAGGACTGTGGATGG - Intergenic
1039141265 8:34391226-34391248 TTGAGAACTAGGAGAGTAGATGG - Intergenic
1039270447 8:35874724-35874746 CTCAGAAGGGGGAGGATGGAAGG - Intergenic
1039888594 8:41669714-41669736 CTGAGAGGTGGGCGGGTGCAGGG - Intronic
1039948800 8:42152438-42152460 CTGGGAACTGAGATTGTGGAGGG + Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1040719856 8:50306044-50306066 CTCAGAAGGGGGAGGGTGGGAGG - Intronic
1041024011 8:53665899-53665921 TGGGGAAGTGGGAGGGTGGAGGG - Intergenic
1041798415 8:61771808-61771830 CTGAGAACCGGCATGGGGGATGG - Intergenic
1041993271 8:64021253-64021275 CTGAGAACTAGGATTTTGGAAGG - Intergenic
1042109835 8:65368858-65368880 CAGAGAACAGGGAGGGGGGAGGG + Intergenic
1042179068 8:66066716-66066738 CTCAGAAGGGGGAGGGTAGAAGG + Intronic
1042391567 8:68241726-68241748 CAGAAAGATGGGAGGGTGGAAGG - Intergenic
1043033212 8:75165049-75165071 CCAAGAACTGGGAGGATGGGAGG - Intergenic
1043314549 8:78904048-78904070 ATGAGGAGTGGGAGAGTGGAGGG - Intergenic
1043367598 8:79553282-79553304 CTCAGAAGGGGAAGGGTGGAAGG + Intergenic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1044599956 8:93993623-93993645 CTGTGAGCTGGGAGGCTCGATGG - Intergenic
1046975838 8:120276352-120276374 CTCAGAGTGGGGAGGGTGGAAGG + Intronic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047327087 8:123850231-123850253 CTGAGAAAGGGAAGGGTTGAGGG - Intergenic
1047408450 8:124604797-124604819 CTGAGAAGTGGGAGATTGGCTGG - Intronic
1047724911 8:127676024-127676046 TTGAGAATAGGTAGGGTGGAGGG - Intergenic
1047889188 8:129288465-129288487 CTCAGAAGAGGGAGGGTGGGAGG + Intergenic
1047933340 8:129751694-129751716 CTGAGAACATGGAGGATGAATGG - Intronic
1048192652 8:132304143-132304165 CTGAAAGGTGGGAGGGTGGAAGG + Intronic
1048440900 8:134458373-134458395 GTGGGAGCTGGGAGGCTGGAGGG + Intergenic
1048750529 8:137668616-137668638 CTGGGAACTGAGAAGGTTGAAGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049583301 8:143422263-143422285 CTGAGGACTGGGTGGGAGGGAGG + Intronic
1050008263 9:1157778-1157800 GTGAGAACTGGGAAGTAGGAAGG + Intergenic
1050195409 9:3078030-3078052 CTCAAAACGGGGAAGGTGGAAGG - Intergenic
1050272182 9:3958101-3958123 CAGGGAACTGAGAGAGTGGAAGG - Intronic
1051973406 9:22919213-22919235 CAGAGCACTGGAAGGGTGAAGGG + Intergenic
1053416728 9:37951629-37951651 CTGAGCTCAGGGAGGGTGGATGG - Intronic
1053484751 9:38443266-38443288 AGGAGAAGTGGGAGGGAGGAGGG + Intergenic
1053590636 9:39510998-39511020 CTGAGAACGGGGAGGTAGAAGGG - Intergenic
1053848496 9:42266387-42266409 CTGAGAACAGGGAGGTAGAAGGG - Intergenic
1054575668 9:66854291-66854313 CTGAGAACGGGGAGGTAGAAGGG + Intergenic
1054974085 9:71121797-71121819 CTGAGAACTGGTACGGGGGGAGG + Intronic
1055986858 9:82061872-82061894 GTGAGGACTGTGGGGGTGGAGGG - Intergenic
1055987251 9:82063882-82063904 CTGGAAGGTGGGAGGGTGGAGGG - Intergenic
1056466596 9:86861831-86861853 CTGAGAATTTGTAGGGTGGGAGG + Intergenic
1056694810 9:88838709-88838731 CTGACAACTCGGATGATGGAAGG - Intergenic
1057249886 9:93492658-93492680 CTGCGAAGTGGGGTGGTGGAGGG + Intronic
1057319445 9:93998971-93998993 CTGAGAACCAGGAGAGTTGATGG + Intergenic
1057357257 9:94341934-94341956 CTGAGAACTGGGGGGATATATGG + Intergenic
1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG + Intergenic
1057650495 9:96915692-96915714 CTGAGAACTGGGGGGATATATGG - Intronic
1057704982 9:97389729-97389751 GAGGGAACTGAGAGGGTGGAAGG - Intergenic
1058459304 9:105168114-105168136 CTGAGAACTAGGAGAGTCAATGG + Intergenic
1058971365 9:110086158-110086180 CTGAGAAGTGGGAGGGTGTGGGG + Intronic
1059431874 9:114255292-114255314 CTGACCACTGGGAGGGAGGCCGG - Intronic
1059725182 9:117001529-117001551 CAGAGCACTGGGAGAGTGGCAGG - Intronic
1059735159 9:117093125-117093147 CTGAAACATGGGAGAGTGGACGG - Intronic
1060970499 9:127734963-127734985 CGCAGACTTGGGAGGGTGGAGGG - Intronic
1061247488 9:129408188-129408210 CTGAGACCTGGGTGGAGGGAGGG - Intergenic
1061487808 9:130929111-130929133 GTGTGAACTGGGAGGGGGTATGG + Intronic
1061613294 9:131762723-131762745 CTGGGAACTGGGTGGGTCGTGGG + Intergenic
1062214212 9:135380370-135380392 CTGAGAACCGGGGAAGTGGATGG + Intergenic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062688210 9:137827314-137827336 CTGAGAAGTGAGAGGGTGCAGGG - Intronic
1203662141 Un_KI270753v1:54740-54762 CTGAGAACCTGGAGGGCTGATGG - Intergenic
1185546931 X:953520-953542 CAGATAGATGGGAGGGTGGATGG - Intergenic
1185563039 X:1075285-1075307 CTGAGACCTGGAAGGGCTGAGGG - Intergenic
1185583364 X:1227375-1227397 CTGAGGAATGGGTGGATGGATGG + Intergenic
1185762811 X:2701279-2701301 CCATGGACTGGGAGGGTGGATGG - Intronic
1185985976 X:4834119-4834141 CTCAGAAGCGGGAGGGTGGGAGG + Intergenic
1186507427 X:10104171-10104193 CTGAGAACTGGGGGTGGGGTGGG + Intronic
1186791828 X:13007218-13007240 AGAAGAAATGGGAGGGTGGAGGG + Intergenic
1186812893 X:13207628-13207650 CTGGAAAGTGGGGGGGTGGATGG - Intergenic
1187371460 X:18711310-18711332 CAGAAAGCTGGGAGGGTGGGAGG + Intronic
1187556701 X:20358677-20358699 CTAAGAACTGGGAGTGCTGAGGG + Intergenic
1188111238 X:26197933-26197955 CTGAGGACCGTGAGGATGGAAGG + Intergenic
1189700584 X:43714237-43714259 ATGGGGACTGGAAGGGTGGATGG + Intronic
1190065353 X:47237436-47237458 CAGAGAGGTGGGAGGATGGAGGG - Intronic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1192058409 X:67797538-67797560 CTAAGAAGGGGGAGGGTGCAAGG + Intergenic
1192884443 X:75321987-75322009 CTGAGAAGGGGTAGGGTGGAAGG - Intergenic
1193081530 X:77411590-77411612 CTCAGAGCTGGCAGGCTGGAAGG + Intergenic
1193201162 X:78692698-78692720 CTTAGACCTGGTAGGGTGGAAGG + Intergenic
1193321478 X:80127302-80127324 CTGAGAACTGGGACAATGCAAGG - Intergenic
1193440455 X:81534812-81534834 CAGAGCACTGAGAGGGTGCAGGG - Intergenic
1193470941 X:81902564-81902586 CTCAGAAGGGGGAGGGTGGAAGG - Intergenic
1194089906 X:89572924-89572946 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1194630845 X:96281328-96281350 CTCAGAACTGAGAGGATGGGAGG + Intergenic
1195766606 X:108302996-108303018 CTGCAAATTGGGGGGGTGGAGGG - Intronic
1197571317 X:128154163-128154185 CTCAGAAGTAGGAGGGTGGGAGG + Intergenic
1198134422 X:133733280-133733302 CTCAGAAGGGGGAGGGTGAAAGG + Intronic
1198545613 X:137689612-137689634 CTGAGATCTGGAAGACTGGAAGG - Intergenic
1198676446 X:139136347-139136369 CTCAGAACGGGGAGGGTGGGGGG - Intronic
1199242276 X:145561187-145561209 CTTAGAAGGGGAAGGGTGGAAGG + Intergenic
1199425498 X:147696478-147696500 CTAAGAGGTGGAAGGGTGGAAGG + Intergenic
1199778161 X:151033845-151033867 CAGAGAACTCTGAGGGTGAATGG + Intergenic
1200153147 X:153961275-153961297 CGGAGAACCGGGAGGAGGGAAGG + Intronic
1200254460 X:154572493-154572515 TTGAGAACTGGCAGGGAGAATGG + Intergenic
1200263309 X:154631915-154631937 TTGAGAACTGGCAGGGAGAATGG - Intergenic
1200310701 X:155074007-155074029 CTGATAACTTGGTGGGAGGAGGG - Intronic
1200442557 Y:3228978-3229000 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1200766296 Y:7083499-7083521 GAGAGACCAGGGAGGGTGGAGGG - Intronic