ID: 1034844413

View in Genome Browser
Species Human (GRCh38)
Location 7:154431149-154431171
Sequence CAGCTGTTCTCAGGGCACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 298}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034844413_1034844422 13 Left 1034844413 7:154431149-154431171 CCGTGGTGCCCTGAGAACAGCTG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1034844422 7:154431185-154431207 CTGGGAGCCACAGGCCACCAGGG 0: 1
1: 0
2: 2
3: 44
4: 506
1034844413_1034844426 26 Left 1034844413 7:154431149-154431171 CCGTGGTGCCCTGAGAACAGCTG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1034844426 7:154431198-154431220 GCCACCAGGGGGAAGCGCCAAGG 0: 1
1: 0
2: 0
3: 32
4: 170
1034844413_1034844423 14 Left 1034844413 7:154431149-154431171 CCGTGGTGCCCTGAGAACAGCTG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1034844423 7:154431186-154431208 TGGGAGCCACAGGCCACCAGGGG No data
1034844413_1034844424 15 Left 1034844413 7:154431149-154431171 CCGTGGTGCCCTGAGAACAGCTG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1034844424 7:154431187-154431209 GGGAGCCACAGGCCACCAGGGGG No data
1034844413_1034844418 -5 Left 1034844413 7:154431149-154431171 CCGTGGTGCCCTGAGAACAGCTG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1034844418 7:154431167-154431189 AGCTGCCAAGGATGCTCGCTGGG No data
1034844413_1034844421 12 Left 1034844413 7:154431149-154431171 CCGTGGTGCCCTGAGAACAGCTG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1034844421 7:154431184-154431206 GCTGGGAGCCACAGGCCACCAGG No data
1034844413_1034844417 -6 Left 1034844413 7:154431149-154431171 CCGTGGTGCCCTGAGAACAGCTG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1034844417 7:154431166-154431188 CAGCTGCCAAGGATGCTCGCTGG No data
1034844413_1034844420 4 Left 1034844413 7:154431149-154431171 CCGTGGTGCCCTGAGAACAGCTG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1034844420 7:154431176-154431198 GGATGCTCGCTGGGAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034844413 Original CRISPR CAGCTGTTCTCAGGGCACCA CGG (reversed) Intronic
900186556 1:1335803-1335825 CAGCTGTGCCCAGGCCCCCAGGG - Exonic
900267094 1:1763106-1763128 GAGCAGCCCTCAGGGCACCACGG - Intronic
900417113 1:2540351-2540373 CAGCTGCTCCTAGGGCACCTGGG + Intergenic
900465782 1:2824839-2824861 CAGGTGTTCTGAGGTCACCTGGG + Intergenic
902518431 1:17002256-17002278 CCCCAGTTCTCAGGGCACCCCGG + Intronic
902744731 1:18466164-18466186 AAACTGTTCTCAGGGCTACAGGG - Intergenic
902988247 1:20168873-20168895 CAGCTGCCCTCAGGCCACCTGGG - Intronic
903009630 1:20320507-20320529 CAGCAGTTCTCAGAGCTCAATGG - Intronic
904503467 1:30931233-30931255 CAGCTCATCTCAGGGGCCCAAGG + Intergenic
904714712 1:32458785-32458807 CAGCAGTTTTCAGGGAACAAGGG + Intergenic
905499000 1:38420951-38420973 ATGATGTCCTCAGGGCACCAGGG - Intergenic
906030440 1:42715940-42715962 CAGCTGTGGTCTGGGCACCCAGG + Intergenic
906326460 1:44849186-44849208 CAGGGGTTCTAAGGGCTCCATGG + Intergenic
912488907 1:110050430-110050452 CAGCTGTCCTTTTGGCACCAGGG + Intronic
912576167 1:110674627-110674649 CAGGTGGTCCCCGGGCACCACGG + Exonic
913632647 1:120724419-120724441 CAGCGGTTGGCGGGGCACCACGG - Intergenic
914265240 1:146032967-146032989 CAGCTGTTTTCACTGGACCAAGG - Intergenic
915484491 1:156210747-156210769 CAGCTCTTCTCAGGGTCTCAGGG - Exonic
916296907 1:163229257-163229279 CATCTCTTCACAGGGCAGCAGGG + Intronic
916489954 1:165293189-165293211 CAGATGTCCTCAGGGAAGCAAGG + Intronic
918474698 1:184911439-184911461 CAGCAGAGCTCTGGGCACCAGGG + Intronic
919729364 1:200902939-200902961 CACCTGTACTGAGGGCTCCAAGG - Intronic
920340171 1:205270710-205270732 CAGATGCTCTCTGGGTACCAGGG - Intronic
920517831 1:206599681-206599703 CAGCTGGCCCCAGGGCACCTGGG - Intronic
920704264 1:208240334-208240356 CAGCTGGTCTCAAGGCACGAGGG - Intronic
920869049 1:209778144-209778166 CTGCTGTACTCTGGTCACCAGGG - Exonic
921118901 1:212119608-212119630 CAGCAGCTCACAGGGCACAAGGG + Intergenic
922705273 1:227787255-227787277 CAGCTAGTCTGAGGGAACCAGGG + Intergenic
922717708 1:227885923-227885945 CAGCTGGCCTCGGGCCACCATGG - Intergenic
922931997 1:229397126-229397148 AAGCTGTTTTAAGGGGACCAAGG - Intergenic
924513777 1:244749763-244749785 CAGATGCTCTCAGGCCACCCAGG + Intergenic
924685720 1:246287911-246287933 CAGCTGTGCTCATGGAAGCAAGG - Intronic
1063077220 10:2729399-2729421 CAGCTGTAGCCAGGGCCCCATGG + Intergenic
1064928650 10:20598730-20598752 CAGCTGTCGTCTGGGCAGCAAGG + Intergenic
1064998752 10:21318592-21318614 CGGCTTTTGTCGGGGCACCACGG - Intergenic
1067985654 10:51140879-51140901 CAGCAGTTCTCAGGACTTCAGGG - Intronic
1068046545 10:51893416-51893438 AAGCTGCTGTCAGGGCACAATGG + Intronic
1069641577 10:69959348-69959370 CAGTTGTGCTAAGGGCACCCAGG + Intronic
1069828499 10:71268706-71268728 AGGCTGTTCTTAGAGCACCAAGG - Intronic
1070630933 10:78084175-78084197 CCTATGTTCACAGGGCACCAGGG - Intergenic
1070664537 10:78333822-78333844 CAGCTGGGCTCAGGGCACTTAGG + Intergenic
1070965000 10:80524492-80524514 AGGTTTTTCTCAGGGCACCAGGG - Exonic
1071126304 10:82339392-82339414 CACCTCTTCACAGGGCAGCAGGG + Intronic
1074751545 10:116591857-116591879 CCGATCTTCTCAGGGCTCCAGGG - Exonic
1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG + Intergenic
1075443638 10:122498892-122498914 CTGGAGTTCTCAGGGGACCAGGG - Intronic
1075721155 10:124588222-124588244 CAGCTGGACCCAGGGCACCTTGG - Intronic
1076026765 10:127122118-127122140 CAGCAGATCACAGGTCACCAGGG + Intronic
1076196807 10:128524602-128524624 CAGCTGTTGTCAGGGAAACCAGG + Intergenic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1077474277 11:2778991-2779013 TTGCTGGTCTCAGGGCCCCACGG - Intronic
1084582302 11:70031737-70031759 CAGGTGTTGACCGGGCACCAGGG + Intergenic
1084771392 11:71344824-71344846 CTGCTGTTCACAGGCCACCCTGG - Intergenic
1084773097 11:71357059-71357081 CAACTGCCCTCAGGCCACCATGG + Intergenic
1085701005 11:78746264-78746286 CAGGTGGTGTCACGGCACCATGG - Intronic
1085815617 11:79734150-79734172 CAGCTCTTCTCAGGGCTCCCAGG + Intergenic
1086830039 11:91550905-91550927 CAGCTGTCTTCAGGGCATAAGGG + Intergenic
1087023203 11:93623805-93623827 CAGCTGGATTCAGGGCACAAAGG - Intergenic
1089195716 11:116693012-116693034 CAGCTGGTCTGAGGGCACCTCGG + Intergenic
1090542430 11:127722770-127722792 CAGCTCTCTTCAGGTCACCAAGG - Intergenic
1091996386 12:4997418-4997440 CAGCTCTTCACTGGGCCCCAGGG - Intergenic
1092743807 12:11654550-11654572 CAGCTGGTCTGAGGGCACGGGGG + Intronic
1096524181 12:52200861-52200883 CATCTGTTTGCAGGGCCCCAAGG - Intergenic
1101434253 12:104651614-104651636 CAGTTCTTCTCAAGGCACAAAGG - Intronic
1103941055 12:124501459-124501481 CAGCTGTCATCAGGGCCCCACGG + Intronic
1104094755 12:125546947-125546969 CACCTCTTCACAGGGCAGCAGGG + Intronic
1104970961 12:132530514-132530536 CAGCTGGTCTGAGGTCCCCAGGG + Intronic
1107401930 13:40077703-40077725 CAGCTGTGGTCAGGGGAGCAAGG - Intergenic
1108821724 13:54358831-54358853 CACATGTTCTCAGGGCTCCCTGG + Intergenic
1109051698 13:57491531-57491553 CAGCTCTTCTCTGGGCACTGAGG - Intergenic
1113411362 13:110093226-110093248 ATGCTATTCTCAGGTCACCAGGG - Intergenic
1113664932 13:112134895-112134917 CAGCTGTGCTCAGGGCTTAAGGG - Intergenic
1116657594 14:47672818-47672840 CAGCTGTTCAGAGGGCACCGGGG + Intronic
1117292074 14:54344116-54344138 CAGATGTCCACACGGCACCAAGG + Intergenic
1119173050 14:72549275-72549297 CAGCTGAGCTCTGGGCAACAGGG + Intronic
1121117855 14:91356242-91356264 CCTCTGCTCTCAGAGCACCATGG + Intronic
1121649875 14:95550150-95550172 CAGTTCTTCTCAGGGCTGCAGGG - Intergenic
1122616564 14:103022037-103022059 CAGCTGTACACTGGGCACCTTGG - Intronic
1123203670 14:106691980-106692002 AGGCTGTTCTCAGGGTAACAGGG - Intergenic
1123759463 15:23421329-23421351 CAGCTGTTTTCAGAGCAGCAAGG - Intergenic
1124371796 15:29108308-29108330 CAGCTGTCCCCCGGTCACCACGG + Exonic
1125606172 15:40941227-40941249 CAGCTGTCCTCAGGTCACCGTGG - Intergenic
1127660597 15:61096832-61096854 AAGCTGATCTGAGGGCACGATGG - Intronic
1128757753 15:70195019-70195041 CAGCAGCTCTCAGGGAAGCAGGG - Intergenic
1128998274 15:72312793-72312815 CAGCTGTGCTCAGGACCCAATGG + Intronic
1130154130 15:81334891-81334913 CAGCTGTCCTCAGCGCACTCGGG - Exonic
1130873863 15:87995166-87995188 CAGGTGCTCTCTGGGCTCCATGG - Intronic
1132047839 15:98579632-98579654 CACCTGCTCTCAGGGCAGCCTGG + Intergenic
1132061181 15:98693518-98693540 CCGCTGTGCCCAGTGCACCAGGG - Intronic
1132265168 15:100463826-100463848 CATCGGTTCTGATGGCACCATGG - Intronic
1132517202 16:371353-371375 AAGCTCTTCTCAGGGACCCAAGG + Exonic
1134001711 16:10788008-10788030 CACATGTTCTCAGGACCCCATGG - Intronic
1134456885 16:14401557-14401579 CAGTTGTTTTCAGAGCAGCAAGG + Intergenic
1135669169 16:24360469-24360491 CAGCTGTTGTTTGAGCACCAGGG - Intronic
1136115413 16:28091413-28091435 CAGCTGCTCTGGGGACACCAAGG - Intergenic
1136286550 16:29247531-29247553 TAGCTGTTCTCAGTGAGCCATGG + Intergenic
1136776491 16:32874484-32874506 CAGCTGTGCTCTGAGCACAAGGG - Intergenic
1136894124 16:33987028-33987050 CAGCTGTGCTCTGAGCACAAGGG + Intergenic
1137519481 16:49179874-49179896 CAGCCCATCTCAGTGCACCAGGG - Intergenic
1137572302 16:49574813-49574835 CAGCTGTTCTGAGGGCAGCAGGG - Intronic
1138688619 16:58748198-58748220 AAGCTGTTCTGTGGTCACCAGGG + Intergenic
1139595963 16:67958473-67958495 AGGCTGATCTCAGGGCAGCAGGG - Intronic
1139974139 16:70795613-70795635 CACCTGTTCACAGAGCTCCAGGG + Intronic
1140716335 16:77728765-77728787 CAGCTCTTTGCTGGGCACCAGGG - Intronic
1141489312 16:84361229-84361251 CAGCGGTTGTCAGGGGTCCAGGG + Intergenic
1142202249 16:88766804-88766826 CAGCTGCTCTCAGAGCCACAGGG + Intronic
1203078906 16_KI270728v1_random:1136593-1136615 CAGCTGTGCTCTGAGCACAAGGG - Intergenic
1142800642 17:2343228-2343250 CATCTGTTCTCAGCTCACGAAGG - Intronic
1142964275 17:3571241-3571263 CACCTGTCCTCAGCGCCCCAGGG - Intronic
1143028447 17:3954225-3954247 CAGCTGGTCCCAGGGGAGCAGGG - Intronic
1144841041 17:18185933-18185955 CAGCTGTTCTCAGAGCAGCTTGG + Intronic
1145123568 17:20281916-20281938 GACCTGTTCTCAGGACGCCAAGG + Intronic
1145761121 17:27425923-27425945 CAGAGGTACTCAGGGCCCCATGG - Intergenic
1145788605 17:27610209-27610231 CACTTGGCCTCAGGGCACCAGGG - Intronic
1146161169 17:30560081-30560103 CAGAGGTGCTCAGGGCCCCATGG - Intronic
1147274444 17:39303584-39303606 CCGCTGTGCTCAGGTCTCCAGGG - Exonic
1148114921 17:45169917-45169939 TAGCTGTTCTCAGGGCGCACAGG - Exonic
1148234614 17:45960291-45960313 CTGCTGTTCTCAGTCCTCCAGGG - Intronic
1148345197 17:46898449-46898471 CAGCTGTTCTCTGCCCACCCTGG + Intergenic
1148677319 17:49452805-49452827 CAGCTGTCCTGAGGCCACCAAGG - Intronic
1148844057 17:50518356-50518378 CAGCTGCTTTCAGGGCCCCCTGG + Intronic
1149145102 17:53480868-53480890 CACCTCTTCACAGGGCACCAGGG - Intergenic
1150813973 17:68378344-68378366 CCCCTGTTCTCAGGGCCCCCAGG + Intronic
1151201614 17:72471948-72471970 AAGCTGCTGTCTGGGCACCATGG - Intergenic
1151457242 17:74233292-74233314 CACCAGTCCTCAGGGCTCCAGGG + Intronic
1151790772 17:76304454-76304476 CAGCTCTTCCCAGGTGACCATGG + Exonic
1152332631 17:79681974-79681996 CACCTGTTGTCTGGGCACGAGGG - Intergenic
1152938437 17:83153670-83153692 CAGCTGTAACCCGGGCACCAGGG - Intergenic
1153087938 18:1309788-1309810 GAGCTGTTCACAGGGCATGAAGG - Intergenic
1153424956 18:4952835-4952857 CTGCTGTTGGCAGGGCACCATGG + Intergenic
1155457559 18:26035031-26035053 CAGCAGTACCCAGGGCAGCAAGG - Exonic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157550313 18:48576673-48576695 ATCCTGTACTCAGGGCACCATGG - Intronic
1157679205 18:49590636-49590658 CAGTTGTTCCCAGTGCTCCAGGG - Exonic
1159810052 18:73007538-73007560 AAAGTGTTCTCAGGTCACCACGG + Intergenic
1159938309 18:74386174-74386196 CAGCTGGTGCCAGCGCACCAAGG - Intergenic
1160394668 18:78562972-78562994 CATTTGTTCTCAGGGCAGCGAGG + Intergenic
1160443916 18:78912996-78913018 CAGCTGTTCTCAGGCCTTCCAGG + Intergenic
1160662324 19:306840-306862 CAGCTCCCCTCAGGGCACCCCGG - Intronic
1160857619 19:1224472-1224494 CTGCCCGTCTCAGGGCACCAGGG - Intronic
1160906245 19:1453012-1453034 CAGCTGCTCGTAGGGCGCCACGG - Exonic
1160915895 19:1496360-1496382 CCGCTGTTCCTAAGGCACCACGG + Exonic
1162467047 19:10848632-10848654 CTGCCGTTCTCAGGGCATCGAGG + Intronic
1162502238 19:11060458-11060480 CAGGCGGTCCCAGGGCACCAGGG + Intronic
1162738944 19:12762978-12763000 TGGCTGTGCTCTGGGCACCAAGG - Intergenic
1163597957 19:18231465-18231487 GAGCTGTTCTCAGGTGACCCAGG - Intronic
1165902465 19:39175146-39175168 CAGCTGTGCTCCGGGCCCCTGGG + Intronic
1166703784 19:44897072-44897094 CATATCTTCTCAGGGCACGAGGG + Intronic
1167051376 19:47080971-47080993 CAGTTGTACTTAGGGCAACATGG - Intronic
1168134041 19:54338591-54338613 CATCTGGTGTCAGGGCACCCTGG - Exonic
927639228 2:24836303-24836325 CATCTGCTCTAATGGCACCAGGG + Intronic
927675433 2:25102475-25102497 CACCTCTTCACATGGCACCAGGG + Intronic
929568156 2:43003117-43003139 CAACTGTTCTCAGGGCTCTAGGG + Intergenic
930157482 2:48120325-48120347 CAGCTGTAATCAGTCCACCATGG + Intergenic
933864999 2:86508262-86508284 CCTCTGTTCTCAAGGCAGCATGG + Intronic
934756389 2:96827602-96827624 CAGCTGCTCACAGGCCACCCGGG + Intronic
935078751 2:99771474-99771496 CTGCTCTTGTCAGGACACCAGGG - Intronic
937069915 2:119055281-119055303 CAGCTATTTTCAGGGAACAAGGG - Intergenic
941142556 2:161803533-161803555 CAGCAGTTGTCAGGGCTTCAGGG - Intronic
941524959 2:166596261-166596283 CACCTCTTCACAGGGCAGCAGGG + Intergenic
945122988 2:206477412-206477434 CAGCTGTTCTCAGTCCTTCAGGG + Intronic
947307943 2:228767822-228767844 CAGTTGTTTTAAGGGCACCATGG + Intergenic
947729044 2:232418167-232418189 CAGCTGATGACAGGGGACCATGG - Intergenic
948142743 2:235685839-235685861 AAGCTGTGCTCAGGCCACCTCGG - Intronic
948299572 2:236892407-236892429 CAGCTGTTCTCTGTACACAACGG - Intergenic
948465830 2:238151176-238151198 AAGCTGCGCTCAGGCCACCAGGG + Exonic
948833474 2:240612510-240612532 CAGCTGTGCTCTGGGCTCTAGGG + Intronic
1169200492 20:3706847-3706869 CAGCCCTTCTCAGTGCCCCAGGG + Intronic
1169604598 20:7302500-7302522 CAGCTGTTCCCATGGTACCTGGG + Intergenic
1171370008 20:24656436-24656458 CTGCTTTCCTCAGGGCACCACGG - Intronic
1174543336 20:51306771-51306793 CAGCTGTTCTCTGTGCACTTGGG - Intergenic
1175160030 20:57001541-57001563 CAGCAGGTCTGAGGGCACCTGGG - Intergenic
1175160037 20:57001580-57001602 CAGCAGGTCTGAGGGCACCTGGG - Intergenic
1175986976 20:62768897-62768919 CAGTTTTTATCAGAGCACCATGG + Intergenic
1177212551 21:18088278-18088300 CAGCTCATATCAGGGCAGCAGGG + Intronic
1177218917 21:18165534-18165556 CTGCTCTGCTCAGGGCAGCAGGG + Intronic
1179804088 21:43826194-43826216 CAGCTGCTCCCAGGGCAGGATGG - Intergenic
1180839207 22:18950995-18951017 GAGCTGCTCACAGGGCACCCGGG - Intergenic
1182090885 22:27594112-27594134 CATCTGTTCTGAGGCCAGCATGG - Intergenic
1182550809 22:31099960-31099982 CAGGGGTTCTCAGGGCAACTGGG - Intronic
1182675179 22:32033758-32033780 CAGCTGTTTTCAGGGTACAATGG - Intergenic
1183543999 22:38446062-38446084 CATCTGTTATCAGGGCAGGAGGG - Intronic
1184234472 22:43175543-43175565 CCCCTGTCCTCTGGGCACCAAGG - Intronic
1184345689 22:43911264-43911286 CACCTGTTCTCAAGACAGCATGG - Intergenic
1184678864 22:46058959-46058981 CAGGTGGGCTCAGGGCATCAGGG + Intronic
1185125344 22:49007397-49007419 CAGCTGTCCTCTGGGCTGCAAGG - Intergenic
949213583 3:1536784-1536806 CAGCTATTTTCAGGGAACAAGGG + Intergenic
949517605 3:4821416-4821438 GAGCTGCTCTCAGGGCAGCTGGG - Intronic
949935682 3:9113801-9113823 CACCTCTTCACAGGGCAGCAGGG - Intronic
950138686 3:10600741-10600763 CAACTGTCCTGAGGGCACCTGGG + Intronic
950187499 3:10954056-10954078 CAGCTGCTCTCAGCACAGCATGG + Intergenic
950232390 3:11287431-11287453 CAGCCGCTCTCAGGCCCCCATGG - Intronic
950725668 3:14915260-14915282 TAGCTCTTCTCAGGACTCCAAGG - Intronic
950931889 3:16798010-16798032 CAGCTATGCTCAGGGCAGCCTGG - Intergenic
953024784 3:39138500-39138522 GAGGGGTTCTCAGGTCACCAGGG + Intronic
953875441 3:46664061-46664083 CTGCTGTACTCAGAACACCAGGG - Intergenic
960438551 3:117657783-117657805 CTGCTGTTTACAGGGAACCAAGG + Intergenic
961119880 3:124364817-124364839 CAGCTGTCCTCAGAGAAGCACGG - Intronic
961510167 3:127395970-127395992 TAGATGTTCTCAGGGCAGCTGGG - Intergenic
962317152 3:134366033-134366055 CAGCTCAGCTCAGGGCCCCATGG + Intronic
963224710 3:142850671-142850693 AAGCTGTTCTGGTGGCACCATGG + Intronic
964751679 3:160059466-160059488 CAGCTGTTACCACGACACCAGGG + Intergenic
965720360 3:171654823-171654845 CGGCTGTTCTGAGGTCAGCATGG + Intronic
967200529 3:187068851-187068873 CAGCTGTTTTCAGGGGAATAGGG + Intronic
969106238 4:4808982-4809004 CAGCTGGGCTCAGGGCAGCTGGG + Intergenic
969517581 4:7656251-7656273 CAGCAGGTATCAGGGCACCTGGG - Intronic
969596174 4:8150427-8150449 CGTCTGTCCTCAGGGCACGATGG - Intronic
971431220 4:26569820-26569842 CTCCTGTTTTCAGGGCACCGGGG - Intergenic
971440255 4:26677815-26677837 CACCTCTTCACAGGGCAGCAGGG - Intronic
972897169 4:43637895-43637917 CAGCAGTTTTCAGGGAACAAGGG + Intergenic
973796726 4:54434736-54434758 CAACAGTTCTCAGGGCACGGGGG + Intergenic
975863498 4:78702559-78702581 CAGGTGGTCTCAGGGCAGGATGG + Intergenic
978033732 4:103969672-103969694 CAGCAGTTCTATGGGCACCCTGG - Intergenic
978978170 4:114906820-114906842 CAGCTCTTCTGAAGGGACCATGG + Intronic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
983527070 4:168770339-168770361 CAGCTATTCTCAGGGCAGAGGGG - Intronic
984398419 4:179229549-179229571 AAGCTATTCTTAGGGCACCCAGG + Intergenic
984682227 4:182623706-182623728 CTGCTGTGCTCAGAGCATCATGG - Intronic
985487408 5:159168-159190 CACCTGCTCTCAGTGCACCTGGG - Intronic
985695182 5:1336068-1336090 CAGCCGCTCTCAGGGCAACCTGG - Intronic
986199711 5:5569982-5570004 CAGCTGTGCTTGGGGCCCCAGGG - Intergenic
992200641 5:74380554-74380576 CAGCAGTACTCAGGTCCCCAGGG - Intergenic
992752289 5:79872510-79872532 CAGCTCTCCTCAGGGGACCTGGG + Intergenic
993066503 5:83105352-83105374 CATCTTTTCTCAGGACCCCAGGG + Intronic
994043870 5:95286008-95286030 CAGCTGTGAACAGGGCATCAGGG + Intergenic
994368632 5:98945050-98945072 CAGCTGTTCCCATGGACCCAGGG + Intergenic
994975386 5:106797738-106797760 CAGATGTTCACCTGGCACCATGG + Intergenic
995487079 5:112650174-112650196 CTACGGTGCTCAGGGCACCAGGG - Intergenic
998557638 5:143141035-143141057 CAGGTGTGCCCAGGGCACCCGGG - Intronic
999269831 5:150290247-150290269 CAGCTGTTGCCAGGGCAACGGGG - Intronic
1001414672 5:171536695-171536717 CACCTGTTATCACGGCACTATGG + Intergenic
1002539639 5:179897845-179897867 CAGCTCTTCTCAGTGCACTTTGG - Intronic
1007926171 6:45651462-45651484 CGTCTGCTCCCAGGGCACCATGG + Intronic
1008588007 6:52966452-52966474 CAGCTGTTCTGACCTCACCAAGG + Intergenic
1010565398 6:77405878-77405900 CAGCTGTTAGCAGGGTACAATGG - Intergenic
1012921412 6:105224203-105224225 CAGCTGTTCCCAAGGCAGCAGGG + Intergenic
1014231194 6:118904416-118904438 TACCTGTTGCCAGGGCACCAAGG - Intronic
1015078395 6:129192081-129192103 CAGGTGTTGTCATAGCACCAAGG + Intronic
1015872575 6:137792071-137792093 CAAGTGTCCTCATGGCACCAGGG + Intergenic
1019267135 7:124246-124268 CACCTGTCCTCAGGCCACCAAGG - Intergenic
1019429180 7:990908-990930 CAGCTGTTGTCAGGGCTCCCGGG + Intergenic
1019612181 7:1942145-1942167 CAGCTGTGCTGAGGGCATCCAGG - Intronic
1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG + Intronic
1022414457 7:30166211-30166233 CATCTGTTCCCAGGCAACCATGG - Intergenic
1022832071 7:34077739-34077761 CAGCTGATCTGATAGCACCAAGG - Intronic
1023175233 7:37429619-37429641 CAGGTGCTCTCAGGCCAGCAGGG + Intronic
1023824468 7:43999824-43999846 CAACTGATCTCCAGGCACCACGG - Intergenic
1023870057 7:44258512-44258534 CAGCTGGGATGAGGGCACCAAGG + Intronic
1024403333 7:48949622-48949644 CAGCAATTCTCAGGGAACAAGGG - Intergenic
1024534108 7:50415888-50415910 GAGCTGCTCCCAGGGCACTAGGG - Intergenic
1026088017 7:67278588-67278610 CAACTGATCTCCAGGCACCACGG - Intergenic
1026726225 7:72871685-72871707 CAACTGATCTCCAGGCACCACGG + Intergenic
1027117620 7:75493922-75493944 CAACTGATCTCCAGGCACCACGG - Intergenic
1027274183 7:76541563-76541585 CAACTGATCTCCAGGCACCACGG + Intergenic
1027327627 7:77060616-77060638 CAACTGATCTCCAGGCACCACGG + Intergenic
1028327921 7:89549761-89549783 GAGCAGTTCTCTGGGCACTAGGG + Intergenic
1028532498 7:91852765-91852787 CAGGTGTTTTCAGGGGGCCAAGG - Intronic
1029719880 7:102356127-102356149 CAACTGATCTCCAGGCACCACGG + Intergenic
1029752733 7:102553130-102553152 CAACTGATCTCCAGGCACCACGG - Exonic
1029770684 7:102652223-102652245 CAACTGATCTCCAGGCACCACGG - Exonic
1033310635 7:140259517-140259539 CAAGTGTTCTCCTGGCACCAGGG - Intergenic
1034391994 7:150794120-150794142 CAGCTGGTCCCAGGGCAGCCGGG - Intronic
1034541285 7:151759781-151759803 CAGCTGTTCTCAGGGCCAAGGGG + Intronic
1034844413 7:154431149-154431171 CAGCTGTTCTCAGGGCACCACGG - Intronic
1035440854 7:158898085-158898107 CATCTGCTCTCAGGTCACAATGG - Intronic
1035874537 8:3173374-3173396 CTACTGTTCTAAGTGCACCAAGG - Intronic
1036810137 8:11862266-11862288 TATCTGTTCCCAGGGCCCCAAGG - Intronic
1037107605 8:15128537-15128559 CAGTTGGTGTCAGAGCACCAAGG - Intronic
1037159369 8:15749580-15749602 TATCTGTTCTGAGGGCAGCAAGG + Intronic
1037795720 8:21992885-21992907 CAGTATTCCTCAGGGCACCAAGG + Intronic
1037865029 8:22436608-22436630 CAGCTATTCTCAGGGCATAAAGG - Intergenic
1038101843 8:24386888-24386910 CAGCTGCTCTCTGGCCACTAGGG - Intronic
1040388849 8:46932888-46932910 CAGCTGCTCACAGGACAACAGGG + Intergenic
1040440661 8:47438220-47438242 CAGCAGCTGTCAGGGCTCCATGG - Intronic
1040481459 8:47831446-47831468 CACCTGTCCTCGGGGCACCGTGG + Intronic
1041005409 8:53493022-53493044 CAGCTGCACTCAGGCCAGCAGGG - Intergenic
1041627537 8:60047826-60047848 CACCTGTTCACCTGGCACCATGG + Intergenic
1043371745 8:79602418-79602440 CAGCTGTGCTCATTGTACCAAGG + Intergenic
1044680749 8:94775141-94775163 CAGCTGATCTAGGGGCACAATGG - Intronic
1046731284 8:117728906-117728928 CAGATGTTCTCAGAGCACAGAGG - Intergenic
1046862362 8:119107704-119107726 AAGCTGTGCTCAGTGCACTAGGG - Intergenic
1046921478 8:119733954-119733976 CAGTGGTTCTCAGAACACCAGGG + Intronic
1047928284 8:129701994-129702016 CAGCTGTCCACAGAGCTCCAGGG - Intergenic
1049579346 8:143404375-143404397 CAGCTGTCCCCGGAGCACCAAGG - Intergenic
1049831755 8:144705264-144705286 ATTCTGTTCTCAGGGCCCCAAGG - Intergenic
1052320080 9:27158381-27158403 CATATGTTCTAAGGGCATCATGG + Intronic
1052669556 9:31538652-31538674 CAGCAGTAGCCAGGGCACCAGGG + Intergenic
1053618296 9:39792081-39792103 CAGCTGTACTCAGAGGACCGCGG + Intergenic
1054265859 9:62915348-62915370 CAGCTGTACTCAGAGGACCGCGG - Intergenic
1054963508 9:70996013-70996035 CAGCTGTTCTCAGTCCACTGGGG - Intronic
1055375901 9:75648165-75648187 CAGCTGCTGCCAGGGCCCCAGGG - Intergenic
1056447936 9:86684372-86684394 CAGCTGGCCTCAGGTCAGCATGG + Intergenic
1058949844 9:109893209-109893231 GAGCTGTTCCCAGGGCAGGAAGG - Intronic
1059285709 9:113169748-113169770 CACCTGCTCTGAGGGCACCATGG + Exonic
1060011067 9:120043250-120043272 CAGCTGTCTTCAGGACCCCAGGG + Intergenic
1060117406 9:120953244-120953266 CAGCTGTGGTCAGGTCCCCAGGG + Intronic
1060661629 9:125408271-125408293 CAGGTGTTTTTAGGGCACCCAGG + Intergenic
1060795090 9:126507797-126507819 CAGCTGTTCTATCTGCACCACGG - Intergenic
1061051993 9:128202335-128202357 CGGCTGGGCTCAGGGCCCCATGG + Intronic
1061331536 9:129897340-129897362 GAGCTGTTAACAGGGCAACAGGG + Intronic
1061401826 9:130372724-130372746 CCTCTGTTCTCAGGCCACCATGG + Intronic
1061901224 9:133673091-133673113 CAGCTGTCCTCAGCGGAGCAGGG - Intronic
1061961322 9:133990723-133990745 GATCTGTTCTCAGAGCCCCACGG - Intronic
1061971377 9:134047270-134047292 CAGCTCTTCCCAGGGCCGCACGG + Intronic
1062060393 9:134492384-134492406 CAGCAGTGCTCAGGGCCCCCGGG - Intergenic
1062286023 9:135772868-135772890 CAGCAGGTCGCAGGGCAGCAGGG - Exonic
1062345815 9:136114665-136114687 CAGGTGCTCAGAGGGCACCAAGG + Exonic
1203787859 EBV:137617-137639 CAGGTGGTCTTAGGGCGCCAGGG + Intergenic
1186679156 X:11854098-11854120 CACCTCTTCACAGGGCAGCAGGG + Intergenic
1187764495 X:22625275-22625297 CAGCTGTACCCAAGGCACAAGGG - Intergenic
1189420235 X:40850791-40850813 CAACTGTCCTCAGGGTGCCATGG - Intergenic
1190283139 X:48944499-48944521 CCACTGTTCTCAGGGCACCTAGG - Intronic
1191216131 X:57933968-57933990 CAGCTGCTCTAAGGTCCCCACGG - Intergenic
1191740639 X:64432945-64432967 CACCTGGACTCAGGTCACCAGGG + Intergenic
1194403615 X:93467818-93467840 CAGGGGTTCTCAGGGATCCAAGG - Intergenic
1196271803 X:113720721-113720743 CAGCTATTTTCAGGGAACAAGGG - Intergenic
1196757556 X:119171234-119171256 AAGTTAGTCTCAGGGCACCAAGG + Intergenic
1198230095 X:134680912-134680934 CAGTTGTTCTCTGGGCACTTGGG - Intronic
1199503958 X:148540643-148540665 CAGTTGGTCTCAGGCCACTAGGG + Intronic
1199996107 X:153027915-153027937 CAGCTGTACTAAGGGCACGTGGG - Intergenic
1200917995 Y:8588336-8588358 GCCCTATTCTCAGGGCACCAGGG + Intergenic
1200937538 Y:8751449-8751471 GAGCTAGTCTCAGTGCACCATGG - Intergenic
1200937662 Y:8752362-8752384 GAGCTAGTCTCAGTGCACCATGG + Intergenic