ID: 1034845441

View in Genome Browser
Species Human (GRCh38)
Location 7:154440257-154440279
Sequence ACTGCAGAGACTGCAGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 373}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034845441_1034845447 14 Left 1034845441 7:154440257-154440279 CCCACGCCTGCAGTCTCTGCAGT 0: 1
1: 0
2: 1
3: 28
4: 373
Right 1034845447 7:154440294-154440316 CGGCATTAATTCATACCTTGCGG No data
1034845441_1034845446 -6 Left 1034845441 7:154440257-154440279 CCCACGCCTGCAGTCTCTGCAGT 0: 1
1: 0
2: 1
3: 28
4: 373
Right 1034845446 7:154440274-154440296 TGCAGTTATTCACATGGAGGCGG No data
1034845441_1034845445 -9 Left 1034845441 7:154440257-154440279 CCCACGCCTGCAGTCTCTGCAGT 0: 1
1: 0
2: 1
3: 28
4: 373
Right 1034845445 7:154440271-154440293 CTCTGCAGTTATTCACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034845441 Original CRISPR ACTGCAGAGACTGCAGGCGT GGG (reversed) Intronic
900272230 1:1796906-1796928 ACGGCAGAGAGTGGAAGCGTAGG + Intronic
900361574 1:2291606-2291628 GCTGCAGAGACTGAGGGGGTGGG - Intronic
900462361 1:2807775-2807797 GCTGCTGGGACTGCAGGCCTGGG - Intergenic
900608087 1:3532674-3532696 ACTGCAGAGACAGAAAGCTTGGG + Intronic
900640853 1:3687473-3687495 ACTGCAGAGACTCCTCGGGTGGG - Intronic
901350409 1:8590493-8590515 ACTGCAGAGACTTCAGCTGAAGG + Intronic
901817613 1:11803713-11803735 GGGGCAGAGACTGCAGGGGTTGG + Intronic
903707417 1:25296507-25296529 ATTGCTGAGATTACAGGCGTGGG + Intronic
903719822 1:25396847-25396869 ATTGCTGAGATTACAGGCGTGGG - Intronic
906272236 1:44488577-44488599 AGTGCTGAGATTGCAGGCGTGGG + Intronic
906777933 1:48546950-48546972 CCTGCAGATAATGCAGGCGTGGG + Intronic
907052029 1:51336033-51336055 CTGGCAGAGACTGCAGGTGTTGG - Intronic
907072514 1:51549565-51549587 ACTGCTGGGATTACAGGCGTAGG - Intergenic
907470245 1:54669003-54669025 ACTGATGAGACCGCAGGGGTGGG + Intronic
907643714 1:56219442-56219464 AATGGAGAGACTTCAGGCTTTGG + Intergenic
908582433 1:65530132-65530154 ACTGCAGATAGTGCAGGTTTGGG - Intronic
908769458 1:67583010-67583032 ACTGCTGGGATTGCAGGTGTTGG + Intergenic
909197683 1:72648467-72648489 ACTTCTGAGCCTGCAGGGGTAGG - Intergenic
911870386 1:103089859-103089881 AGTGCTGAGATTACAGGCGTGGG - Intronic
913477913 1:119256634-119256656 ACTGCTGAGATTACAGGTGTAGG + Intergenic
914088723 1:144476766-144476788 AGTGCTGGGATTGCAGGCGTAGG + Intergenic
914309890 1:146457436-146457458 AGTGCTGGGATTGCAGGCGTAGG - Intergenic
914592220 1:149115696-149115718 AGTGCTGGGATTGCAGGCGTAGG + Intergenic
914751334 1:150537154-150537176 ACTGGAGAGCCTGCAGGTGAAGG + Intergenic
915562604 1:156696000-156696022 AGTGCTGAGATTACAGGCGTGGG + Intergenic
915835220 1:159171281-159171303 AGTGCAGCCACTGCAGGCCTGGG - Intergenic
916222766 1:162461149-162461171 AGTGCTGAGATTACAGGCGTGGG - Intergenic
919665062 1:200283670-200283692 ACCCCAGAAACTGCAGGCCTGGG - Intergenic
920924303 1:210327767-210327789 AGTGCTGAGATTACAGGCGTGGG + Intergenic
922345310 1:224691406-224691428 ACTGCAAAGTGGGCAGGCGTGGG + Intronic
922535073 1:226373571-226373593 ATGGCAGAGACTGCAGGCAGAGG - Intronic
922790070 1:228306397-228306419 GCTGCAGAGTCTGCAGGCGGAGG + Exonic
923377960 1:233385026-233385048 ACTGCAGAGATTTAAGGCCTGGG + Exonic
924404727 1:243730742-243730764 ACTGCAGAGCCTCAAGGAGTGGG - Intronic
1063071523 10:2671390-2671412 ACTGCAGACACTACAGATGTGGG + Intergenic
1064161114 10:12947410-12947432 AGTGCTGAGATTACAGGCGTGGG + Intronic
1064723280 10:18251510-18251532 AGTGCTGAGATTACAGGCGTGGG + Intronic
1066367715 10:34793037-34793059 GCAGCAGGGACTGCAGGTGTGGG + Intronic
1066601818 10:37116951-37116973 AGTGCTGAGATTACAGGCGTTGG + Intergenic
1067100490 10:43330671-43330693 AGTGCTGAAACTGCAGGTGTGGG - Intergenic
1068833366 10:61523366-61523388 ACTGCTGGGATTACAGGCGTGGG - Intergenic
1069460246 10:68588124-68588146 AGTGCTGAGATTACAGGCGTCGG + Intronic
1070595489 10:77830070-77830092 GCTGCTGAGACTGCAGGCCTTGG + Intronic
1072118015 10:92382292-92382314 AGTGCTGAGATTACAGGCGTGGG - Intergenic
1072960086 10:99921587-99921609 AGTGCTGAGACTACAGGCATGGG - Intronic
1073055899 10:100701257-100701279 TTTGCAGAGACTGCAGGGATGGG - Intergenic
1073958920 10:108903810-108903832 AGTGCTGAGATTACAGGCGTGGG - Intergenic
1074917605 10:117972347-117972369 GCTGCAGGGACTGCAGGCCCTGG + Intergenic
1075501763 10:122980859-122980881 ACTGCAGAGGGTGAATGCGTTGG + Intronic
1077840028 11:5964427-5964449 ACTGCAGGGATTACAGGCTTAGG - Intergenic
1078268750 11:9775222-9775244 ACAGCAGAGCCTGCGGGGGTAGG - Intergenic
1078339708 11:10489943-10489965 AGTGCTGAGATTACAGGCGTGGG + Intronic
1079710984 11:23681065-23681087 AGGGCAGAGGCTGCAGGCCTAGG + Intergenic
1080529630 11:33162205-33162227 ACTGCTGGGATTACAGGCGTGGG - Intronic
1083291249 11:61691506-61691528 TCTGCAGAGCCTGCAGCCTTTGG + Intronic
1083292876 11:61699585-61699607 CCAGCAGAGACTCCAGGCCTAGG + Intronic
1083969775 11:66067808-66067830 ACTGCAGAGGCTGCATCCTTGGG + Intronic
1084760635 11:71268428-71268450 CCTGGAGAGAGTGCAGACGTTGG + Intergenic
1084903931 11:72331503-72331525 ACTGCTGGGATTACAGGCGTGGG + Intronic
1085387640 11:76166145-76166167 AGTGCTGGGATTGCAGGCGTGGG + Intergenic
1085647309 11:78233873-78233895 AGTGCTGAGATTACAGGCGTGGG + Intronic
1086965609 11:93024676-93024698 ACTGAAGAAACTACAGGCCTTGG + Intergenic
1088357336 11:108957671-108957693 ACTGTAGAAACAGCAGGTGTTGG - Intergenic
1088417292 11:109603567-109603589 ACTGTAGAGTCTGCAGCCTTTGG - Intergenic
1088417785 11:109608472-109608494 ACTGCAGTGGCTGCAGCAGTTGG - Intergenic
1088670704 11:112137714-112137736 AGTGCTAAGATTGCAGGCGTGGG + Intronic
1089832543 11:121341323-121341345 AGTGCTGGGACTGCAGGCGTGGG - Intergenic
1090025001 11:123160012-123160034 ACTGCTGGGATTGCAGGCGTGGG - Intronic
1090252828 11:125263398-125263420 ACAGCAGGGACTGCTGGCGACGG + Intronic
1090529322 11:127574351-127574373 ACTGGAGAGTCTCCAGGCATCGG - Intergenic
1090716729 11:129437760-129437782 ACTGCTGAGATTACAGGTGTGGG - Intronic
1091904986 12:4178085-4178107 AGTGCTGAGATTACAGGCGTGGG - Intergenic
1093025151 12:14238981-14239003 AGTGCTGGGACTACAGGCGTGGG + Intergenic
1095592788 12:43922932-43922954 ACTGGAGAATCTGCAGGCATGGG + Intronic
1097273123 12:57791272-57791294 AGTGCTGAGATTACAGGCGTGGG + Intronic
1097668108 12:62504509-62504531 AGTGCTGAGATTACAGGCGTGGG + Intronic
1097743575 12:63273700-63273722 ACTGCTGGGATTACAGGCGTGGG + Intergenic
1098340965 12:69450829-69450851 AGTGCTGGGATTGCAGGCGTGGG - Intergenic
1098975403 12:76896717-76896739 GCTGCAGTGACTGCAGGCTTAGG + Intergenic
1099557494 12:84128466-84128488 ACTTCAGAGCCTGCAGGGGAAGG - Intergenic
1100271778 12:93032363-93032385 AGTGCAGGGATTACAGGCGTGGG + Intergenic
1100362995 12:93895047-93895069 ACTTCAGAGGCTGCAGGGCTTGG - Intergenic
1100510365 12:95265123-95265145 AGTGCTGAGATTACAGGCGTGGG + Intronic
1101880253 12:108621500-108621522 ACTGCAGGGACTGCAGCTATGGG - Intergenic
1101942848 12:109112928-109112950 ACTGCAGAGAAAGCAGCCGTGGG + Intergenic
1103418524 12:120761082-120761104 CCTGCACAGACCGCAGGAGTAGG + Intergenic
1104010368 12:124925941-124925963 AGTGCTGGGATTGCAGGCGTGGG + Intergenic
1106249808 13:27974907-27974929 AGTGCTGGGACTACAGGCGTGGG - Intergenic
1107535033 13:41321033-41321055 ACTGCTGGGATTACAGGCGTGGG - Intronic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1108388399 13:49923506-49923528 AATGCGGAGATTACAGGCGTTGG + Intronic
1108800865 13:54092887-54092909 AGTGCAGAGCCGGCAGGGGTGGG + Intergenic
1108821460 13:54355808-54355830 ACTACAGAGACTGCTGGAGAAGG + Intergenic
1109440104 13:62358350-62358372 AATGCAGTGACTGCAGGCTTAGG + Intergenic
1111514954 13:89318195-89318217 CCTGCTGGGACTACAGGCGTGGG - Intergenic
1113761848 13:112853612-112853634 TCTGCAGCGTCTGCAGGCTTTGG + Intronic
1115614678 14:35083475-35083497 AGTGCTGGGACTACAGGCGTGGG - Intronic
1115986426 14:39107075-39107097 AGTGCTGGGATTGCAGGCGTGGG + Intronic
1116902166 14:50371805-50371827 ACTTCTGAGCCTGCAGGGGTTGG - Intronic
1117476877 14:56104508-56104530 ACTGCTGGGATTGCAGGCATGGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118068444 14:62218051-62218073 AGTGCTGAGATTACAGGCGTGGG + Intergenic
1119085204 14:71732860-71732882 ACAGCAGAGAGGGCAGGCATGGG + Intronic
1120339005 14:83194873-83194895 ACTGCAGAGAATGAGGGGGTGGG - Intergenic
1121985657 14:98502854-98502876 ACTGGAGAGACAGCAGGGGCTGG + Intergenic
1122748912 14:103918622-103918644 AGTGCAGGGATTACAGGCGTGGG + Intronic
1122859260 14:104575209-104575231 AGTGGGGCGACTGCAGGCGTGGG - Intronic
1123506302 15:20943030-20943052 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123563528 15:21516734-21516756 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123599780 15:21954021-21954043 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1125789463 15:42352641-42352663 ACTGCATACGCTGCAGCCGTGGG + Exonic
1125918392 15:43509671-43509693 ACTGCTGGGATTACAGGCGTGGG + Intronic
1126618557 15:50613237-50613259 ACTGCTGGGATTACAGGCGTGGG - Intronic
1128595113 15:68938230-68938252 AGTGCTGAGATTACAGGCGTGGG + Intronic
1129286563 15:74529977-74529999 AGTGCTGAGATTACAGGCGTGGG + Intergenic
1130054158 15:80507886-80507908 ATTGGAGTGACTGCAGGCGACGG + Intronic
1130585946 15:85182424-85182446 AATGCTGTGACTACAGGCGTGGG - Intergenic
1132287922 15:100679199-100679221 ACTACAGAGGCAGCAGGCCTTGG + Intergenic
1202971886 15_KI270727v1_random:243871-243893 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1132538447 16:495517-495539 ACTGGGGAGACTGCAGGTGTCGG + Intronic
1133086335 16:3366459-3366481 AGTGCTGAGATTACAGGCGTGGG + Intronic
1133103005 16:3490450-3490472 GTAGCAGAGACTACAGGCGTGGG - Intergenic
1134204744 16:12228009-12228031 AGTGCTGAGATTACAGGCGTGGG - Intronic
1134681435 16:16128732-16128754 AGTGCTGGGATTGCAGGCGTGGG - Intronic
1135282863 16:21167740-21167762 AGTGCTGAGATTACAGGCGTGGG - Intronic
1135404780 16:22190351-22190373 CGTGCAGAGGCTGCAGGCCTAGG - Exonic
1136085118 16:27879338-27879360 AGTGCTGAGATTACAGGCGTGGG - Intronic
1137297704 16:47112180-47112202 AGTGCTGGGACTGCAGGCATGGG + Intronic
1137584827 16:49658182-49658204 ACTGCAGTGACTGCAGCTCTTGG + Intronic
1138393486 16:56686760-56686782 AGTGCTGGGACTACAGGCGTGGG + Intronic
1138497356 16:57416498-57416520 ACTGCAGTGAGTGCAGGGGAAGG - Intergenic
1138543727 16:57704297-57704319 ACTGCAGAGGCTGCAGAGGTGGG - Intronic
1139057718 16:63205875-63205897 AGTGCAGGGATTACAGGCGTGGG + Intergenic
1139440686 16:66965140-66965162 TCTGCAAAGGCTGCAGGTGTGGG + Intronic
1140055991 16:71526228-71526250 ACTGCTGAGACTCAAGGGGTGGG - Exonic
1140719040 16:77753860-77753882 AGTGCTGGGATTGCAGGCGTGGG + Intergenic
1141659224 16:85432866-85432888 GCTGCAGAGAGTGCCGGGGTAGG - Intergenic
1142556399 17:781183-781205 AGTGCTGAGATTACAGGCGTGGG + Intronic
1142564176 17:828664-828686 AGTGCTGAGATTACAGGCGTGGG + Intronic
1142841048 17:2630975-2630997 AGTGCTGGGATTGCAGGCGTGGG - Intronic
1144386234 17:14751393-14751415 ACTGCAGAGCTTGCAGGGATGGG - Intergenic
1145130007 17:20336494-20336516 AGTGCTGAGATTGCAGGTGTGGG - Intergenic
1145298816 17:21614778-21614800 ACTCCAGAGATTGCAGGAGAAGG - Intergenic
1145403625 17:22568314-22568336 CCTCCAGAGACTGCAGGAGAAGG + Intergenic
1146340705 17:32017538-32017560 ATTGCTGAGATTTCAGGCGTGGG - Intronic
1147303453 17:39547763-39547785 ACTGCAGAGAGAGGAGGCCTAGG - Intronic
1147619548 17:41856252-41856274 AGTGCTGAGATTACAGGCGTGGG + Intronic
1147620486 17:41863458-41863480 AGTGCTGAGATTACAGGCGTGGG + Intronic
1148175586 17:45561563-45561585 AGTGCTGAGACTACAGGTGTGGG - Intergenic
1148295788 17:46501437-46501459 AGTGCTGAGACTACAGGTGTGGG + Intergenic
1150011003 17:61503517-61503539 AGTGCTGGGATTGCAGGCGTGGG + Intergenic
1150192754 17:63260517-63260539 AGTGCTGGGACTACAGGCGTGGG - Intronic
1150920842 17:69480493-69480515 ACTGCAGAGAATGTAGCCTTTGG + Intronic
1151496476 17:74461112-74461134 AGTGCTGAGATTACAGGCGTGGG + Intergenic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1152271396 17:79327012-79327034 ACTGCAGAGCCAGGAGGCATGGG - Intronic
1153602034 18:6790101-6790123 AGTGCTGGGATTGCAGGCGTGGG + Intronic
1154107438 18:11534536-11534558 CCTGCAGAGACTGCAGGAGAAGG - Intergenic
1154172620 18:12062169-12062191 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1154218165 18:12431128-12431150 TCTGCAGAGACACCAGGGGTCGG - Exonic
1154485453 18:14868317-14868339 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1155057430 18:22197314-22197336 AGTGCAGGGATTGCAGGCGTGGG + Intronic
1156445399 18:37233054-37233076 CCTGCATAGACTGCAGTCCTTGG + Intergenic
1157835106 18:50894297-50894319 AGTGCTGAGATTACAGGCGTGGG - Intronic
1158586716 18:58745114-58745136 ACTGCTGAGACTGGAGGTGTGGG - Intronic
1158592323 18:58788335-58788357 ACTACTGAGATTACAGGCGTGGG + Intergenic
1158960533 18:62584307-62584329 CCTGCAGAGAATGCGGGCCTTGG + Intronic
1159106057 18:64002829-64002851 ACGGCGGCGACTGCAGGCGGCGG - Intronic
1160446715 18:78933875-78933897 ACAGCAGGGACTGCACGCGATGG - Intergenic
1161451991 19:4351365-4351387 AGTGCTGGGATTGCAGGCGTGGG + Intronic
1161854542 19:6755812-6755834 AATGCTGAGATTACAGGCGTCGG - Intronic
1162510724 19:11116598-11116620 ACTGCTGGGATTACAGGCGTGGG + Intronic
1162902594 19:13804204-13804226 AGTGCAGGGATTACAGGCGTGGG - Intronic
1163036471 19:14571996-14572018 TCTGCAGCGACTGCAGCCATGGG - Exonic
1163167431 19:15507984-15508006 GCTGCAGAGCCTCCAGGGGTGGG + Intergenic
1163579762 19:18131434-18131456 AGTGCTGAGATTACAGGCGTTGG - Intronic
1165111490 19:33504989-33505011 ACTGCAGAGTGTGCAGTCATGGG - Intronic
1165289931 19:34874817-34874839 GCTGCAGAGTCTGCAGGCCCTGG + Intergenic
1165861824 19:38913043-38913065 AGTGCTGGGACTACAGGCGTGGG + Intergenic
1166708959 19:44925079-44925101 AGTGCACAGATTACAGGCGTGGG + Intergenic
1166858877 19:45798094-45798116 AGTGCAGGGATTACAGGCGTGGG - Intronic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1167792945 19:51692149-51692171 TCTGCAGAGACTCCAGGCCCAGG - Intergenic
1167909720 19:52691558-52691580 AGTGCTGGGACTACAGGCGTGGG + Intergenic
1168028032 19:53657795-53657817 ACTGCAGAAATTGCAGGAGCAGG + Intergenic
1168234251 19:55051994-55052016 AGTGCTGGGATTGCAGGCGTGGG + Intronic
1168315433 19:55482887-55482909 GCCGCAGACACCGCAGGCGTGGG - Exonic
1168343461 19:55639316-55639338 ACAGCTGGGACTACAGGCGTGGG - Intronic
926678393 2:15645785-15645807 CCTGCTGGGACTACAGGCGTGGG - Intergenic
926694253 2:15760022-15760044 AGTGCTGGGATTGCAGGCGTGGG + Intergenic
927907911 2:26875278-26875300 ACGGCAGAGACAGCAGCCATTGG + Intronic
928098480 2:28420548-28420570 ACTGCAAAGACTGGATGGGTTGG - Intergenic
928146566 2:28783491-28783513 AGTGCTGAGATTACAGGCGTGGG - Intronic
929496941 2:42453044-42453066 AGTGCTGAGATTACAGGCGTGGG + Intronic
929766266 2:44846399-44846421 AGTGCTGAGATTACAGGCGTGGG - Intergenic
932037264 2:68258785-68258807 ACAGCTGGGACTACAGGCGTGGG - Intronic
933659978 2:84919443-84919465 AGTGCTGAGATTACAGGCGTGGG + Intergenic
933734037 2:85480772-85480794 AGTGCAGGGATTACAGGCGTGGG - Intergenic
934196602 2:89842198-89842220 ACTGGACAGACTGCAGGAATGGG + Intergenic
934687694 2:96333793-96333815 GCTGGAGAGGCTGCAGGGGTGGG + Intergenic
936265221 2:110999821-110999843 GCTTCAGAGACTGCAAGCATGGG + Intronic
936265487 2:111002132-111002154 GCTTCAGAGACTGCAAGCCTGGG + Intronic
937924856 2:127160091-127160113 AGTGCTGGGACTACAGGCGTGGG + Intergenic
938196680 2:129334779-129334801 CCTGCAGAGACGGCAGCCGAGGG + Intergenic
938300452 2:130207601-130207623 ACTGCTGAGATTACAGGCGTCGG - Intergenic
938456276 2:131466875-131466897 ACTGCTGAGATTACAGGCGTCGG + Intronic
939913153 2:148007085-148007107 GCTGCAGTGACTACAGGCTTAGG + Intronic
940960226 2:159776990-159777012 AGTGCTGAGATTACAGGCGTTGG - Intronic
941432257 2:165426880-165426902 ACTTCTGAGCCTGCAGGAGTGGG - Intergenic
941804260 2:169694532-169694554 GCTGCCGAGAGGGCAGGCGTGGG + Exonic
942155917 2:173127206-173127228 ACTGCAAAGTCTGCAGAAGTTGG + Intronic
943369314 2:186997866-186997888 ACTGCTGAGATTACAGGCATGGG - Intergenic
943583537 2:189712125-189712147 TCTACAGAGACAGCAGGCCTTGG - Intronic
943901963 2:193451008-193451030 ACTGAATAGAATGCAGGAGTGGG + Intergenic
945063126 2:205925729-205925751 ACTGAAGAGATTTCAGGCCTTGG + Intergenic
946262797 2:218509974-218509996 ACAGCAGCAACTGCAGGGGTAGG - Exonic
947830737 2:233139860-233139882 TCTGCAGAGACTCCAGGGATGGG - Exonic
947985303 2:234442457-234442479 ACAGCAGAGACTGCAGGCCCAGG - Intergenic
948745910 2:240094102-240094124 ACTACAGAGACTGTGGGCGTAGG + Intergenic
1168738668 20:168787-168809 ACTGGAGAAACTGTAGGCCTAGG - Intergenic
1169362008 20:4958285-4958307 AGTGCAGAAACTACAGGAGTAGG - Intronic
1169475509 20:5927895-5927917 AGTGCAGAGACTGCCAGCCTGGG - Intergenic
1169843525 20:9965462-9965484 AGTGCAGCGATTACAGGCGTGGG - Intergenic
1170912967 20:20593165-20593187 AGTGCTGGGATTGCAGGCGTGGG + Intronic
1171427705 20:25058695-25058717 GCTGCTGAGACTCCAGGGGTGGG - Intronic
1172068844 20:32241522-32241544 ACTGCTGGGATTACAGGCGTGGG - Intergenic
1172643541 20:36455917-36455939 ACTGTGGAGACTAGAGGCGTTGG - Intronic
1173990449 20:47298555-47298577 ACTGCAGCCACTGCCGGTGTTGG + Intronic
1174371099 20:50088519-50088541 AGTGCTGAGATTACAGGCGTGGG - Intronic
1174408618 20:50319527-50319549 AGTGCTGGGACTACAGGCGTGGG + Intergenic
1174817007 20:53695880-53695902 AGTGCTGAGATTACAGGCGTGGG + Intergenic
1175539001 20:59736561-59736583 ACTGCAGAGCCAGCATGCATGGG - Intronic
1176064490 20:63187608-63187630 ACTGGAGAGACTGCAGAGGCTGG - Intergenic
1176649545 21:9531837-9531859 ACTCCAGAGATTGCAGGAGAAGG - Intergenic
1176697509 21:9997680-9997702 ACAGCAGAGACTGTTGGCCTGGG - Intergenic
1176795883 21:13371160-13371182 CCTCCAGAGACTGCAGGAGAAGG + Intergenic
1177345984 21:19871884-19871906 AGTGCTGCGACTGCAGGCGTGGG - Intergenic
1178092225 21:29176441-29176463 AGTGCTGGGACTCCAGGCGTGGG + Intergenic
1178178602 21:30133055-30133077 ACTTCAGAGAGTGCAAGCCTTGG - Intergenic
1178832636 21:36069599-36069621 ACTGCAGGAACTGCAGTCTTTGG - Intronic
1180798303 22:18618723-18618745 ACTGCTGAGATTAGAGGCGTGGG - Intergenic
1181160651 22:20957766-20957788 ACTGCAGAGACTGGGGGCTGTGG + Intergenic
1181171339 22:21011836-21011858 ACTGTAGAGACTGCTGTGGTGGG + Intronic
1181178011 22:21048692-21048714 ACTGTAGAGACTGCTGTGGTGGG - Intronic
1181223415 22:21376542-21376564 ACTGCTGAGATTAGAGGCGTGGG + Intergenic
1181255325 22:21559080-21559102 ACTGCTGAGATTAGAGGCGTGGG - Intronic
1181587238 22:23859751-23859773 AGTGCAGGGATTGCAGGTGTGGG + Intronic
1181731288 22:24848779-24848801 ACAGCAGAGACTGCAAACATAGG - Intronic
1183962225 22:41418343-41418365 TCTGCAGAGACAGCAGGGCTTGG - Intergenic
1184847629 22:47098897-47098919 TCTGGAGAGCCTGCAGGCGTAGG + Intronic
1185182743 22:49372611-49372633 ACGGCAGAGACTGCAGCTGCGGG - Intergenic
1185186539 22:49404303-49404325 ACTGCAGAGTCTGGAGGCTGGGG - Intergenic
951471701 3:23063500-23063522 ACTGCAGATACTGCTGGAGCAGG - Intergenic
953749820 3:45600649-45600671 ACTGCTGACACTGCAGAGGTGGG + Intronic
954146732 3:48638129-48638151 ACAGGAGAGACTCCAGGAGTGGG - Exonic
954323347 3:49846914-49846936 AGTGCTGAGATTGCAGGCGTGGG - Intronic
954714961 3:52522374-52522396 ACTGCAGTGTCTGGAGGAGTCGG + Exonic
955177603 3:56632206-56632228 AGTGCTGAGATTACAGGCGTGGG - Intronic
955691983 3:61599892-61599914 AGTGCTGAGATTACAGGCGTGGG - Intronic
957580762 3:82069912-82069934 AGTGCTGAGATTACAGGCGTGGG - Intergenic
958091305 3:88880083-88880105 ACTACAGGGACTGCATGTGTAGG - Intergenic
960055102 3:113271352-113271374 AGTGCAGAGAGTGCAGGCCCAGG - Intronic
960392981 3:117102270-117102292 ACTGCAGAGACTGAAGTTGGAGG - Intronic
960687226 3:120306828-120306850 TCTGCAGAGACTGCGGGCCTCGG - Intergenic
961835913 3:129659357-129659379 AGTGCTGAGACTACAGGTGTGGG + Intronic
962535770 3:136327703-136327725 ACCGCAGAGATTGCAGTCATGGG + Exonic
964772920 3:160243466-160243488 AGTGCTGAGATTACAGGCGTGGG - Intronic
965586719 3:170325453-170325475 ACTGAAGAGATTACAGGCTTGGG + Intergenic
966181249 3:177190580-177190602 AGTGCAGAGATTACAGGCGTGGG + Intronic
966944314 3:184767024-184767046 ACTACAAAGACTGCAGGATTCGG + Intergenic
972289231 4:37676034-37676056 GCTGCAAAAACTGCAGGAGTTGG - Intronic
972494992 4:39626100-39626122 ACTGGAGCGACTGCATGCGAGGG + Intronic
972530099 4:39954074-39954096 AGTGCTGAGATTACAGGCGTGGG - Intronic
974039290 4:56844099-56844121 AGTGCTGAGATTACAGGCGTGGG - Intergenic
974179043 4:58360838-58360860 ACTTCTGAGACTGCAGGGGCAGG + Intergenic
975028660 4:69584729-69584751 AGTGCTGAGACCACAGGCGTGGG + Intergenic
975643516 4:76524319-76524341 ACTGGAGAGAGGGGAGGCGTAGG + Intronic
976757033 4:88509688-88509710 ACTGAAGAAACTGCAGGCTCTGG + Intergenic
976983405 4:91261025-91261047 AGTGCTGAGATTACAGGCGTGGG + Intronic
978028343 4:103906291-103906313 AGTGCTGAGATTACAGGCGTCGG + Intergenic
978413493 4:108450981-108451003 AGTGCTGAGATTACAGGCGTGGG + Intergenic
980075062 4:128286790-128286812 ACTTCAGAGACTGGAGGGTTGGG + Intronic
982532750 4:156567378-156567400 AGTGCTGAGATTACAGGCGTGGG - Intergenic
982942238 4:161573143-161573165 AATGCTGGGACTACAGGCGTGGG - Intronic
983213759 4:164983625-164983647 ACTGCAGAGGCTGCGTGCGGTGG + Intergenic
984732223 4:183078720-183078742 TCTGCAGGTACTGCAGGGGTCGG - Intergenic
985768675 5:1795658-1795680 ACTGCAGAGAGAGGAGGAGTGGG - Intergenic
986443292 5:7799587-7799609 CCTGCAGAGAATGCAGGGATTGG + Intronic
986714195 5:10510956-10510978 ACTGCAAAGACCTCAGGAGTCGG - Intronic
987705417 5:21457869-21457891 ACTGCAGTGTGTGCAGGCATGGG + Intergenic
987767447 5:22251238-22251260 ACTGCAGAGAATGCAGGGGAAGG + Intronic
988135036 5:27159362-27159384 ACTGCAGTGACTGCAGGCTTAGG - Intergenic
988230427 5:28471153-28471175 ACTGCAGAGACTCCAGAAGAAGG + Intergenic
988513294 5:31883863-31883885 AGTGCTGAGATTACAGGCGTGGG + Intronic
988559730 5:32269567-32269589 AGTGCTGAGATTGCAGGCATTGG + Intronic
989475934 5:41872735-41872757 AGTGCTGGGATTGCAGGCGTGGG - Intergenic
990056119 5:51580900-51580922 GGAGCTGAGACTGCAGGCGTGGG - Intergenic
991341363 5:65614468-65614490 ACTGCTGGGATTACAGGCGTGGG - Intronic
992824890 5:80538860-80538882 ACTGCTGGGATTACAGGCGTGGG + Intronic
992850825 5:80805849-80805871 ACTGCTGGGATTACAGGCGTGGG + Intronic
993073155 5:83191438-83191460 AGTGCTGAGATTACAGGCGTGGG - Intronic
993613698 5:90084719-90084741 GCTGCAGCCACTGCAGGGGTTGG - Intergenic
994981179 5:106876275-106876297 GCTGCAGTGAATGCAGGCCTGGG - Intergenic
995990756 5:118236266-118236288 GCTACAGAGACTGCAGGTCTTGG + Intergenic
996328922 5:122308715-122308737 AGTGCTGAGACTGCAGGCATGGG + Intergenic
997156179 5:131561391-131561413 AGTGCTGAGATTACAGGCGTGGG - Intronic
997329962 5:133052639-133052661 ACTGGAAGGACTGCAGGCCTAGG + Intronic
997441329 5:133910765-133910787 CCTGCAGGGACGCCAGGCGTTGG + Intergenic
997502282 5:134385747-134385769 AGTGCTGGGACTACAGGCGTGGG - Intronic
999753736 5:154649013-154649035 AGTGCTGAGATTACAGGCGTGGG - Intergenic
1000692622 5:164342109-164342131 AGTGCTGAGACTACAGGTGTGGG + Intergenic
1001209942 5:169801264-169801286 AGTGCTGAGATTACAGGCGTAGG + Intronic
1002081469 5:176740079-176740101 ACTGCAGAGACCCCAGGCTGGGG + Intergenic
1002133635 5:177095693-177095715 ACTCCAGATACTGCATGCCTCGG - Exonic
1002140651 5:177135316-177135338 ACTGCGGAGACTACAGGATTTGG + Exonic
1002259869 5:177985597-177985619 ACTGAACAGGCTGCAGGCTTTGG - Intergenic
1002542183 5:179913614-179913636 GCTGCAGAGAACGCAGGCGGCGG + Intronic
1005629855 6:27697187-27697209 AGTGCTGAGATTACAGGCGTGGG - Intergenic
1005720317 6:28595095-28595117 AATGCTGGGATTGCAGGCGTGGG - Intronic
1006908637 6:37549545-37549567 ACTGCACAGAGTGCAGGCTGAGG + Intergenic
1007211301 6:40195222-40195244 AGTGGAAAGACTGCAGGCTTTGG + Intergenic
1007501526 6:42301490-42301512 AGTGCTGGGACTACAGGCGTGGG + Intronic
1009022883 6:57963037-57963059 ACTGCAGTGTGTGCAGGCATGGG - Intergenic
1010347563 6:74829949-74829971 AGTGCTGGGATTGCAGGCGTGGG - Intergenic
1011462172 6:87615980-87616002 ACTGAAGAAGCTGCAGGCTTTGG - Intronic
1011495884 6:87936315-87936337 ACTGCAGTGACTGCACGAGCAGG + Intergenic
1011930277 6:92701935-92701957 TCTGCAGAGCCTGCAGGGGCTGG - Intergenic
1012947930 6:105487691-105487713 AGTGCAGAGATTACAGGTGTGGG - Intergenic
1014216907 6:118761269-118761291 ACTGCTGGGATTACAGGCGTGGG + Intergenic
1015762308 6:136677399-136677421 AGTGCAGGGATTACAGGCGTGGG + Intronic
1017945182 6:159090809-159090831 ACTGCAGAAAATCCAGGCATGGG - Intergenic
1018616371 6:165690634-165690656 ACTGGGGAGTCTGCAGGTGTGGG - Intronic
1019039924 6:169095307-169095329 ACAGCAGGCTCTGCAGGCGTGGG + Intergenic
1019664661 7:2245800-2245822 AGTGCTGAGATTGCAGGTGTGGG + Intronic
1019744832 7:2693817-2693839 AGTGCTGAGAATGCAGGCATGGG + Intronic
1020438755 7:8195266-8195288 AGTGCTGGGATTGCAGGCGTGGG - Intronic
1021759715 7:23891870-23891892 ACTTCAGAGGCTGCTGGCCTAGG - Intergenic
1021788245 7:24174079-24174101 AGTGCTGAGATTGCAGGCATGGG - Intergenic
1022401896 7:30046548-30046570 AGTGCAAAGAATGCAGGCTTTGG + Intronic
1023772573 7:43571792-43571814 AGTGCAGGGATTACAGGCGTGGG - Intergenic
1023904806 7:44514401-44514423 AGTGCAGGGATTACAGGCGTGGG - Intronic
1025944062 7:66092891-66092913 ACTGCAGGCACAGCAGGCCTAGG + Exonic
1026014425 7:66661983-66662005 AGTGCTGAGATTACAGGCGTGGG - Intronic
1028447751 7:90944466-90944488 AGTGCTGAGATTACAGGCGTGGG - Intronic
1029366575 7:100120197-100120219 TCTGCAGAGGCTGCAGGAGCCGG + Intronic
1029448858 7:100629475-100629497 ACTGGAGGGACTGCAGGGCTAGG - Intronic
1029533349 7:101140024-101140046 AGTGCTGAGATTACAGGCGTGGG - Intergenic
1030001739 7:105071719-105071741 AGTGCTGAGATTACAGGCGTGGG + Intronic
1031926044 7:127639598-127639620 AGTGCTGGGATTGCAGGCGTGGG - Intergenic
1031928562 7:127661849-127661871 AGTGCTGAGATTACAGGCGTGGG - Intronic
1033910518 7:146258154-146258176 AGTGCTGAGATTACAGGCGTGGG + Intronic
1034027085 7:147717224-147717246 GCTGCAGTGACTACAGGCCTGGG + Intronic
1034820966 7:154215972-154215994 GCTGCAGAGAGGGCAGTCGTGGG + Intronic
1034845441 7:154440257-154440279 ACTGCAGAGACTGCAGGCGTGGG - Intronic
1035112835 7:156497640-156497662 AGTGCAGAGACTGGTGGCGGGGG - Intergenic
1035818776 8:2569119-2569141 ACTGCTTAGACTACAGGGGTAGG + Intergenic
1036151935 8:6307210-6307232 GTTGCTGAGACTACAGGCGTAGG + Intergenic
1037724926 8:21475175-21475197 ATGGCAAAGACTGCAGGCGGGGG - Intergenic
1037798347 8:22015938-22015960 AGTGCTGGGACTGCAGGCATGGG - Intergenic
1040899603 8:52404377-52404399 ACTGCTGAGACAGAAGGAGTCGG + Intronic
1041683158 8:60614150-60614172 ACTGGAGAGAATGCAGGCAAAGG - Intronic
1041887745 8:62831165-62831187 ACTGTAGAGAATGCTGGGGTAGG - Intronic
1042849368 8:73200959-73200981 CCTGCAGGCACTACAGGCGTGGG + Intergenic
1043523830 8:81074592-81074614 ACTGCAGAAACTGCTGGTCTGGG - Intronic
1044121306 8:88399578-88399600 AGTGCTGAGATTACAGGCGTGGG - Intergenic
1044364833 8:91332637-91332659 ACTCAAGAGACTGCTGGCGGTGG - Intronic
1045021704 8:98050130-98050152 ACTGCTGGGATTACAGGCGTGGG + Intergenic
1045252183 8:100491460-100491482 ACTGCTGGGACTGCAGGAGAGGG + Intergenic
1045315658 8:101041445-101041467 ACTTAAGAGACTGCAGGGGCTGG - Intergenic
1045917167 8:107485950-107485972 ACAGTAGGGACTGCAGACGTGGG + Intronic
1047646751 8:126878026-126878048 TCTGCACAGACTGCAGGGCTAGG - Intergenic
1049961955 9:745385-745407 AGTGCAGAGACTGCTAGCCTGGG + Exonic
1050746680 9:8884336-8884358 ACTTCTGAGACTGCAGGCATTGG + Intronic
1051564906 9:18486437-18486459 AGTGCTGAGACTACAGGTGTGGG - Intronic
1052037817 9:23703128-23703150 ACTGCTGATACTGCAGGTGCGGG + Intronic
1056468405 9:86881625-86881647 AGTGCTGAGACTACAGGTGTGGG - Intergenic
1056958563 9:91101926-91101948 ACTGAAGAGACTGCTGGAGAAGG + Intergenic
1057702321 9:97372594-97372616 AGTGCTGGGACTGCAGGTGTGGG - Intronic
1058063391 9:100523000-100523022 AGTGCTGGGATTGCAGGCGTGGG + Intronic
1058860878 9:109116790-109116812 AGTGCTGGGACTACAGGCGTGGG + Intronic
1059094746 9:111400222-111400244 ACTGCAGTGACCACAGGCTTAGG + Intronic
1059281072 9:113134655-113134677 ACTGCAAACACTGCAGGTATGGG + Intergenic
1059530391 9:115030215-115030237 ACTGCAGAGCCCTCAGGCCTAGG - Intronic
1060086914 9:120712126-120712148 GCAGCTGAGACTACAGGCGTGGG - Intronic
1061124602 9:128666495-128666517 ACTGCTGGGATTACAGGCGTGGG - Intergenic
1061204221 9:129153660-129153682 GCTGCAAAGACTGCAGGTGAAGG + Intergenic
1061438510 9:130582320-130582342 ACAGCTGAGACTGCAGGGGTGGG - Intronic
1061769545 9:132907820-132907842 AGTGCTGGGACTACAGGCGTGGG - Intronic
1062205940 9:135337363-135337385 AGCGCAGAGACTTCAGGGGTGGG + Intergenic
1062313249 9:135951207-135951229 AGTGCTGGGACTACAGGCGTGGG + Intronic
1062499955 9:136848058-136848080 ACTGCAGCGGCTGGAGGCGAAGG - Exonic
1203627286 Un_KI270750v1:35385-35407 ACTCCAGAGATTGCAGGAGAAGG - Intergenic
1187165611 X:16801448-16801470 AGTGCTGGGATTGCAGGCGTGGG + Intronic
1187538765 X:20169262-20169284 ACTGCTGGGATTACAGGCGTGGG + Intronic
1190994778 X:55595907-55595929 AGTGCTGGGATTGCAGGCGTGGG - Intergenic
1192438428 X:71156842-71156864 ACAGCAGAGAATGCGGGGGTGGG - Intronic
1192498603 X:71633554-71633576 ACTGCTGAGGCTGGAGGCGAGGG + Intergenic
1195362485 X:104097137-104097159 AGTGCTGAGATTGCAGGCGTGGG - Intergenic
1195386590 X:104319345-104319367 ACTGCTGGGATTACAGGCGTGGG - Intergenic
1196067566 X:111481881-111481903 ACAGCAGAGAATGTAGGGGTCGG - Intergenic
1196822894 X:119717202-119717224 AGTGCTGAGATTACAGGCGTGGG - Intergenic
1198431535 X:136571540-136571562 GCTGCTGAGACTACAGGCATGGG + Intergenic
1200033232 X:153312767-153312789 CGTGCAGGGACTGCAGGCCTGGG + Intergenic