ID: 1034845712

View in Genome Browser
Species Human (GRCh38)
Location 7:154442803-154442825
Sequence CTGGGAAGTAGCTGAATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034845712_1034845716 0 Left 1034845712 7:154442803-154442825 CCCAGAATTCAGCTACTTCCCAG 0: 1
1: 0
2: 1
3: 32
4: 368
Right 1034845716 7:154442826-154442848 CATACCCACCACTGCCACCCAGG 0: 1
1: 0
2: 2
3: 55
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034845712 Original CRISPR CTGGGAAGTAGCTGAATTCT GGG (reversed) Intronic
900491997 1:2954862-2954884 GTGGGAGGTAGCTGAATCATTGG - Intergenic
900730952 1:4259323-4259345 GTGGGAGGTAACTGAATCCTGGG + Intergenic
903322676 1:22552259-22552281 CTGGGAAGTGGCTCAGATCTGGG + Intergenic
903591835 1:24462216-24462238 CTGGGAGGTAACTGAATCATGGG - Intronic
904010717 1:27388649-27388671 CTGGGAAGAAGGTGACATCTAGG + Intergenic
904125997 1:28239262-28239284 CTGCCAAGTAGCTGAACTGTAGG - Intronic
904789853 1:33011331-33011353 CTGGGAAGCACATGACTTCTGGG - Intronic
904867634 1:33593596-33593618 GTGGGAAGAACCTGAATTATGGG - Intronic
905042095 1:34968212-34968234 CTGGGAAGAAGCTGCAATCTTGG + Intergenic
905123302 1:35699196-35699218 GTGGGAGGTAACTGAATCCTGGG + Intergenic
906513119 1:46422935-46422957 GTGGGAAGGAACTGAATTCATGG - Intergenic
906845574 1:49187908-49187930 GTGGGAGGTAACTGAATTATGGG + Intronic
908028839 1:59978338-59978360 CTGGGATATACCTGAATTATGGG + Intergenic
909023510 1:70458436-70458458 CTGGGAAGAAGATGCATGCTGGG - Intergenic
909068568 1:70964595-70964617 CTGGGAAGTAATTGAATCATGGG - Intronic
909686907 1:78359485-78359507 GTGGGAAGTAGTTGAATTATGGG + Intronic
909911520 1:81263553-81263575 CTGGGAAGAGGCTGAATATTGGG - Intergenic
910643684 1:89490698-89490720 GTGGGAGGTAGTTGAATTATGGG - Intergenic
913477828 1:119256043-119256065 CTGGCAAGTACCTGTAATCTTGG - Intergenic
913709858 1:121472405-121472427 CTGGGAGGTAACTGAATCATGGG - Intergenic
917167561 1:172129705-172129727 GTGGGAGGTAACTGAATTATGGG - Intronic
918253480 1:182725603-182725625 CTGGGTAGTCCCTGAATCCTAGG + Intergenic
918324421 1:183395938-183395960 CTGGGAAATAGGAGAAGTCTGGG - Intronic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
920783834 1:209021059-209021081 GTGGGAAGTGATTGAATTCTGGG + Intergenic
920786821 1:209050323-209050345 CTGGGAAGAGGCTGAATCCAGGG + Intergenic
920883789 1:209905033-209905055 GTGGGAGGTAACTGAATTATGGG - Intergenic
921609594 1:217195461-217195483 GTGGGAGGTAACTGAATTATGGG + Intergenic
921742391 1:218700624-218700646 CTAGGAAGTAGATGAATTCATGG - Intergenic
922168924 1:223138886-223138908 GTGGGAGGTAACTGAATCCTGGG + Intronic
923427761 1:233889346-233889368 GTGGGAGGTAACTGAATTATGGG - Intergenic
924017974 1:239748549-239748571 CTGTGCAGAAGCTGATTTCTAGG + Intronic
1062973247 10:1664676-1664698 CTGACAAGTAGCTGAAGACTGGG + Intronic
1063194902 10:3732232-3732254 CTGGGAGGTAACTGAATCATGGG + Intergenic
1063495097 10:6499896-6499918 CTGGGATGTGGCTGGATTCCTGG - Intronic
1063518637 10:6721062-6721084 GTGGGAGGTAACTGAATTATGGG - Intergenic
1063580710 10:7304189-7304211 CTGGGAGGTAACTGAATCGTGGG + Intronic
1063603071 10:7499625-7499647 CTGAGCAGAAGCTGAAATCTTGG - Intergenic
1064253473 10:13724857-13724879 GTGGGAAGCAGATGAATCCTGGG + Intronic
1065460449 10:25957210-25957232 GTGGGAAGTAACTGAATCGTGGG + Intronic
1066617576 10:37311094-37311116 CATGGAAATAGCTGAGTTCTGGG - Intronic
1067569633 10:47361867-47361889 TTGGCAAGAAGTTGAATTCTAGG + Intergenic
1068021329 10:51588880-51588902 AAGGGAAGTAACTGTATTCTTGG - Intronic
1068379254 10:56227968-56227990 ATGGGAATTTGCTGAAATCTTGG + Intergenic
1071102396 10:82054299-82054321 TTGAGAAGTGGCTGGATTCTGGG + Intronic
1072361608 10:94664496-94664518 CTAGGAAGGAGCTGAATCCAGGG - Intergenic
1077516165 11:3003312-3003334 CTGGGAAGCATCTGAAACCTAGG - Intronic
1077596766 11:3538704-3538726 GTGGGAAGTAGTTGAATCATGGG - Intergenic
1077611044 11:3643141-3643163 CTGGGAGATAGCAGGATTCTAGG - Intergenic
1078804287 11:14681354-14681376 GTGGGAAGTAATTGAATTGTGGG + Intronic
1078815945 11:14822770-14822792 CTAAGAAGTAGCTGAATTCAGGG + Intronic
1079356292 11:19732693-19732715 CTGGGGACTAGCTGGACTCTGGG + Intronic
1079841453 11:25405772-25405794 CTTGCAAGTGGCTGAATTATAGG - Intergenic
1079907201 11:26263478-26263500 CTGGGAAGGAGCAGCTTTCTTGG - Intergenic
1081250094 11:40819388-40819410 TGGGGAAGTAGCAGAATTCCGGG - Intronic
1081314951 11:41620778-41620800 CTGGGAGGTAACTGAATCATGGG + Intergenic
1081784338 11:45736061-45736083 GTGGGAAGTAACTGAATCATGGG + Intergenic
1082270087 11:50160953-50160975 GTGGGAAGTAGTTAAATTATGGG - Intergenic
1082865179 11:57893285-57893307 GTGGGAAGTAACTGAATCATGGG + Intergenic
1083167073 11:60896469-60896491 GTGGGAAGTAACTGAATCATGGG + Intronic
1084252683 11:67912676-67912698 GTGGGAAGTAGTTGAATCATGGG - Intergenic
1085577506 11:77620212-77620234 GTGGGAGGTAACTGAATTATGGG + Intronic
1086347778 11:85915010-85915032 GTGGGAAGTAATTGAATTATGGG - Intronic
1086638613 11:89123383-89123405 GTGGGAAGTAACTGAATCATGGG - Intergenic
1086823057 11:91459637-91459659 GTGGGAAGTAGTTGAATCATGGG - Intergenic
1087183354 11:95160489-95160511 CTGGGAAGGAGCCAAGTTCTAGG - Intergenic
1087908494 11:103726440-103726462 GTGGGAAGTAATTGAATTATAGG - Intergenic
1087973389 11:104513731-104513753 GTGGGAGGTAACTGAATTATGGG - Intergenic
1088682084 11:112252122-112252144 CTGGGAATTTGCAGAAATCTTGG + Intronic
1088863836 11:113826976-113826998 GTAGGAACTACCTGAATTCTGGG - Intronic
1089005668 11:115088734-115088756 CTGGGAAGTATTTGGGTTCTGGG + Intergenic
1089952066 11:122536936-122536958 CTGGAAGGTAACTGAATTATGGG + Intergenic
1090762423 11:129849039-129849061 GTGAGAAGTACGTGAATTCTGGG - Intronic
1092422930 12:8347477-8347499 GTGGGAAGTAGTTGAATCATGGG - Intergenic
1092613889 12:10198919-10198941 GTGGGAAATAGCACAATTCTGGG - Intergenic
1092653151 12:10656053-10656075 GTGGGAAATAACTGAATTATGGG + Intronic
1093141722 12:15517336-15517358 GTGGGAAGTAACTGAATCCTGGG - Intronic
1095147788 12:38750959-38750981 GTGGGAGGTAACTGAATCCTGGG + Intronic
1095576336 12:43744312-43744334 GTGGGAAGTAATTGAATTATGGG + Intronic
1095689152 12:45068307-45068329 CTGGGAAGTAATTGAATCATGGG - Intergenic
1098972185 12:76868352-76868374 GTGGGAGGTAACTGAATCCTGGG + Intronic
1099779945 12:87182026-87182048 CTGGGAGGTAACTGAATCATGGG + Intergenic
1100585861 12:95978572-95978594 CTGGGAGGTGGGGGAATTCTAGG + Intronic
1101222913 12:102659177-102659199 GTGGGAGGTAACTGAATCCTAGG - Intergenic
1101567982 12:105927640-105927662 ATGGGAAGTAGCTGAATCGTGGG - Intergenic
1102104312 12:110307441-110307463 CTGGCTAGTAGTTGAATTCCTGG + Intronic
1102587107 12:113931276-113931298 CTGGGGACTAGCTGGGTTCTGGG - Intronic
1103990042 12:124792882-124792904 CTGGGAAGGGGCTGTATCCTCGG + Intronic
1104718229 12:131030411-131030433 CTGAGATCTAGCTGCATTCTCGG - Intronic
1104793172 12:131496821-131496843 CTCGGAAGCATCTGAAGTCTGGG - Intergenic
1106204556 13:27578802-27578824 CTGGGAAGGAGCTGAAAGCCAGG - Intronic
1106303669 13:28492428-28492450 CTTGAAAGTATCTGAATTATTGG + Intronic
1109390053 13:61681598-61681620 GTGGGAGGTAACTGAATTATGGG + Intergenic
1109871720 13:68341973-68341995 GTGGGAAGTGACTGAATTATGGG - Intergenic
1110383184 13:74877768-74877790 GTGGGAAGTAACTGAATCATGGG + Intergenic
1111411583 13:87884164-87884186 GTGGGAAGTAACTGAATAATGGG - Intergenic
1112254990 13:97821336-97821358 GTGGGAGGTAGCTGAATCATAGG + Intergenic
1112988541 13:105482128-105482150 CTGGGAGGTAACTGAATCATGGG - Intronic
1113589901 13:111491153-111491175 CTGGGAAGGAGCTGGAATGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114721805 14:24890574-24890596 CTGTGAAATTGCTGAATACTAGG + Intronic
1114871766 14:26666978-26667000 GTGGGAAGTAGTTGAATCATGGG - Intergenic
1115076836 14:29403173-29403195 GTGGGAGGTAACTGAATTATGGG - Intergenic
1115271376 14:31557220-31557242 ATGGCAAGAAGATGAATTCTTGG - Intronic
1115520890 14:34231909-34231931 GTGGGAAGGAGTTGAATTCTTGG - Intronic
1115779407 14:36752730-36752752 GTGGGAAGTAACTGAATCATGGG + Intronic
1116066916 14:39996453-39996475 CTGGGAGGTAACTGAATCATGGG - Intergenic
1116874507 14:50097839-50097861 CTGGGAAGTACCAAAATTCAAGG - Intergenic
1117880242 14:60306242-60306264 GTGGGAAGTAACTGAATCATGGG - Intergenic
1118468666 14:66054771-66054793 GTGGGAGGTAACTGAATTGTGGG + Intergenic
1118539341 14:66805280-66805302 GTGGGAAGTAACTGAATCATGGG - Intronic
1120377902 14:83732952-83732974 GTGGGAAGCAACTGAATTATGGG + Intergenic
1120761172 14:88286798-88286820 GTGGGAAGTAACTGAATCATGGG - Intronic
1121972356 14:98369990-98370012 CTGGGAGGTAAGTGAATTGTGGG - Intergenic
1121996394 14:98606815-98606837 CTGGGAAGATGCTGGATGCTGGG + Intergenic
1123756209 15:23399452-23399474 CTGAGAAGCAGCTCAATTCTGGG + Intergenic
1128537487 15:68501843-68501865 CAAGGAAGTTGCTCAATTCTCGG - Intergenic
1128873537 15:71183282-71183304 GTGGGAGGTAACTGAATCCTGGG - Intronic
1129206102 15:74037848-74037870 CTGGGCAGTAACTGAAGTCAGGG - Intronic
1129276582 15:74449552-74449574 CTGGGAATGAGCTGCATCCTGGG - Intronic
1132516711 16:369414-369436 TTGGGGAGCAGCTGACTTCTGGG - Intronic
1132598434 16:763532-763554 CTGGGAAGTAGCTGAACTCGGGG + Intronic
1133390383 16:5405303-5405325 GTGGGAAGTAACTGAACTATGGG + Intergenic
1133714688 16:8435822-8435844 GTGGGAAGTAGTTGGATCCTGGG - Intergenic
1134460126 16:14423269-14423291 CTGAGAAGCAGCTCAATTCTGGG - Intergenic
1135611942 16:23875943-23875965 CTGAGAAGTAGCTGACTTTTTGG + Intronic
1135938492 16:26800999-26801021 TTGGTAAGTAGCTAATTTCTTGG + Intergenic
1138050589 16:53773051-53773073 CTGGGAAGCAGCTGATTACTTGG + Intronic
1138643261 16:58403297-58403319 CTGGGAAATGTCTGCATTCTCGG - Exonic
1139501453 16:67369820-67369842 GTGGGAAGTAACTGAATTATGGG - Intronic
1139588545 16:67919905-67919927 CAGGGAAGTTGCTGCTTTCTGGG - Intronic
1140145660 16:72304937-72304959 GTGGGAAGTAATTGAATTATAGG - Intergenic
1140247742 16:73266681-73266703 GTGGGAGGTAACTGAATCCTGGG + Intergenic
1142364273 16:89641771-89641793 CTGGGAAGCAGGTGCATTCCTGG - Intergenic
1145846000 17:28039945-28039967 CTGGGAAGTAGCAGAAGTGAGGG + Intergenic
1148228074 17:45913342-45913364 GTGGGAAGTAACTGAATCATGGG - Intronic
1148392566 17:47283416-47283438 CTGGGAACTCGATGGATTCTGGG - Exonic
1149072335 17:52557317-52557339 GTGGGAAGTAAATGAATTGTGGG + Intergenic
1149541893 17:57473722-57473744 GTGGGTAGTAGCTGGATTCCAGG - Intronic
1150453402 17:65288055-65288077 CTGGGAAGGACATGAATTCTGGG - Intergenic
1151957693 17:77388610-77388632 CTGGGAAGCAGCTGGCTCCTGGG + Intronic
1152183280 17:78838798-78838820 CTGGGAAGTAGCTGAAGAGAAGG - Intronic
1152220582 17:79062911-79062933 ATGGGAAGTAACTGAATCATGGG - Intergenic
1152331119 17:79673824-79673846 CTGGCATGAAGCTGAATTCCAGG + Intergenic
1153077443 18:1181073-1181095 CTGGGAAGTAATTGAATCATGGG - Intergenic
1153817187 18:8800752-8800774 GTGTGAAGTAGCTGGATTCCAGG - Intronic
1155797992 18:30064676-30064698 CTGGCATGTGGCTCAATTCTGGG - Intergenic
1156776031 18:40790052-40790074 GTGGGAAGTAACTGAATCATGGG + Intergenic
1157003216 18:43551537-43551559 GTGGGAAGTAACTGAATCATGGG - Intergenic
1157172861 18:45424121-45424143 CTGGATCCTAGCTGAATTCTGGG + Intronic
1157973151 18:52294044-52294066 TTTTGAGGTAGCTGAATTCTGGG - Intergenic
1157988018 18:52462093-52462115 CTGACAAGCAGTTGAATTCTGGG - Intronic
1158061369 18:53347894-53347916 GTGGGAGGTGGCTGAATTATAGG - Intronic
1158590286 18:58773293-58773315 CTGGGAAATAGCAGAATAGTGGG - Intergenic
1158904621 18:62000215-62000237 CTGGGAGGTAACTGAATCATGGG + Intergenic
1159555644 18:69941919-69941941 GTGGGAGGTAGCTGAATCATGGG + Intronic
1159635992 18:70805771-70805793 GTGGGAGGTAACTGAATTATGGG + Intergenic
1159755684 18:72361148-72361170 GTGGGAAGTAACTGAATCATGGG - Intergenic
1161857113 19:6772420-6772442 GTGAGAAGTGGGTGAATTCTGGG + Intergenic
1165557530 19:36647781-36647803 GTGGGAAGTAACTGGATTATGGG + Intronic
1166638002 19:44469034-44469056 GTGGGAAGTGACTGAATTATGGG - Intergenic
1167238776 19:48330818-48330840 CTGGGAAGAACCTGGATTCTGGG + Intergenic
1167290497 19:48622430-48622452 CTGGGAAGCCCCTGAATTCTTGG - Intronic
924966195 2:78505-78527 GTGGGAAGTAACTGAATCATGGG - Intergenic
926986666 2:18631950-18631972 GTGGGAAGTAATTGAATTATGGG + Intergenic
927409415 2:22807288-22807310 GTGGGAAGTAACTGAATCATGGG - Intergenic
928862310 2:35874234-35874256 GTGGGAGGTAGCTGAATCATGGG - Intergenic
929778054 2:44940816-44940838 CAGAGAGGCAGCTGAATTCTGGG + Intergenic
929965403 2:46530891-46530913 GTGGGAAGTAACTGAATCATGGG - Intronic
930979886 2:57510880-57510902 GTGGGAGGTAACTGAATTATGGG + Intergenic
931663778 2:64595358-64595380 CTGGGAAATACCTCTATTCTGGG + Intergenic
932102768 2:68915715-68915737 CTGTGAGCTAGGTGAATTCTAGG - Intergenic
932425860 2:71634731-71634753 CTGGGAGGCAGCTCAGTTCTGGG + Intronic
932791751 2:74659521-74659543 CAGGAAAAGAGCTGAATTCTTGG - Intronic
933085238 2:78046912-78046934 GTGGGAAGTAGTTGAATCATAGG + Intergenic
933251264 2:80031546-80031568 CTGGGAGGTAACTGAATCATGGG - Intronic
933400795 2:81794481-81794503 GTGGGAAGTGACTGAATTATGGG + Intergenic
933557594 2:83850193-83850215 GTGGGAGGTAACTGAATCCTGGG - Intergenic
933591138 2:84233862-84233884 ATGGGAAGAATCAGAATTCTGGG - Intergenic
934921824 2:98350028-98350050 CTGGGGATTAGATGAGTTCTCGG - Intronic
936803432 2:116294794-116294816 CTGTGAAGAAGCTGTATGCTGGG + Intergenic
936813778 2:116434278-116434300 CTGGGAGGTAACTGAATTACAGG - Intergenic
936843396 2:116801881-116801903 GTGGGAAGTATTTGAATTATGGG - Intergenic
938737452 2:134199329-134199351 CCGGGATGGAGCTGAAGTCTCGG + Intronic
939232576 2:139448848-139448870 CTTGGGAGCAGCTGAGTTCTTGG + Intergenic
939348728 2:141003478-141003500 GTGGGAGGTAACTGAATTATGGG + Intronic
941332386 2:164194682-164194704 GTGGGAAGTAATTGAATCCTGGG + Intergenic
941983175 2:171482769-171482791 TTGAGAAATAGCTGAATTCCTGG + Exonic
942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG + Intergenic
943372033 2:187027936-187027958 GTGGGAGGTAACTGAATCCTTGG - Intergenic
943372242 2:187029141-187029163 GTGGGAAGTAATTGAATTATGGG + Intergenic
943550470 2:189332496-189332518 GTGGGAGGTAACTGAATTATGGG + Intergenic
943849413 2:192698341-192698363 GTGGGAGGTAACTGAATTATGGG - Intergenic
944625982 2:201569225-201569247 CTGTAAAGTAGCTCAAGTCTGGG + Intronic
945527539 2:210906822-210906844 GTGGGAAGTAACTGAATCATGGG + Intergenic
946672047 2:222115400-222115422 CTGGGAAGTAGCAGCATCTTTGG - Intergenic
946950542 2:224870072-224870094 GTGGGAAGTAATTGAATTATGGG + Intronic
947708657 2:232296517-232296539 GTGGGAAGTAATTGAATTATGGG + Intronic
1169905455 20:10598750-10598772 CTGGTAAGAAGCCGATTTCTTGG + Exonic
1170056286 20:12208065-12208087 TTTGGAAGTAGCTGAAATCAGGG - Intergenic
1172480894 20:35270737-35270759 CTCAGAAGTGGCTGAATACTCGG + Intronic
1172523473 20:35583793-35583815 GTTGGAAGTAGCTAAAGTCTGGG + Intergenic
1173172229 20:40736725-40736747 GTGGGAAGTAACTGAATCATGGG - Intergenic
1173697250 20:45028907-45028929 TTTGGAAGTAGATGACTTCTAGG + Intronic
1173984528 20:47250739-47250761 CTTTGAAGGAGCTGATTTCTGGG - Intronic
1174734504 20:52952815-52952837 GTGGGAAGTAACTAAATTATGGG - Intergenic
1174776077 20:53344148-53344170 CTGGGAAGTACCTGGAAGCTTGG - Intronic
1174865917 20:54135594-54135616 GTGGGAAGTAATTGAATTATGGG - Intergenic
1175236233 20:57514216-57514238 CTAGGAGGTGGCTGGATTCTGGG - Intronic
1177205519 21:18005961-18005983 CGGGGAAGTGACTGAATTATGGG + Intronic
1177240862 21:18455009-18455031 GTGGGAAGTAACTGAATCATGGG + Intronic
1177635181 21:23778479-23778501 GTGGGAGGTAACTGAAATCTTGG + Intergenic
1178025381 21:28460402-28460424 GTGGGAAGTAACTGAATCATAGG + Intergenic
1181842621 22:25676997-25677019 CTGGGAAGCAAGTGCATTCTTGG - Intronic
1182984846 22:34706607-34706629 CTGGGAAGCAGGTAAATGCTGGG + Intergenic
1183632499 22:39041737-39041759 CTGTGGAGTAGCTGGATTATAGG - Intronic
1203323308 22_KI270737v1_random:90229-90251 CTGGGAGGTAATTGAATTATGGG + Intergenic
949858947 3:8487943-8487965 GTGGGAAGTAACTGAATCATGGG + Intergenic
950805923 3:15603091-15603113 GTGGGAAGTAACTGAATCATGGG - Intronic
951002595 3:17581044-17581066 GTGGGAAGTAACTGAATCATGGG + Intronic
951054917 3:18136436-18136458 GTGGGAGGTAACTGAATTGTGGG - Intronic
952171534 3:30812547-30812569 GTGGGAAGTAGTTGAATCATGGG - Intronic
952209152 3:31211901-31211923 CTAGAAAGTAGCAGAAATCTTGG + Intergenic
952790917 3:37200178-37200200 CTGGAAAATAGGTGTATTCTGGG + Intergenic
953156100 3:40375504-40375526 GTGGGAAGTAACTGAATCATGGG + Intergenic
953496558 3:43392639-43392661 GTGGGCAATAGCCGAATTCTAGG - Intronic
954196759 3:49001720-49001742 CTGGGTAGTATCTGACTTTTGGG - Intronic
954977724 3:54712420-54712442 GTGGGAAGTAGTTGAATCATGGG + Intronic
956911034 3:73817275-73817297 GTGGGAAGTAGTTAAATTATGGG - Intergenic
958112196 3:89162818-89162840 TTGGGAAGGACCTGAACTCTAGG + Intronic
958461810 3:94407236-94407258 ATGGGAACTTGCTGAATCCTGGG + Intergenic
958584932 3:96074862-96074884 GTGGGACTTTGCTGAATTCTGGG - Intergenic
958860375 3:99437972-99437994 GTGGGAAGTAGTTGAATCATGGG + Intergenic
959512733 3:107232730-107232752 GTGGGAAGTAACTGAATCATGGG + Intergenic
959741992 3:109731118-109731140 GTGGGAGGTAGTTGAATTCTGGG - Intergenic
960465164 3:117989187-117989209 CTGGGAAGAAGCTGATTTAGAGG - Intergenic
961257639 3:125570590-125570612 GTGGGAGGTAACTGAATTATGGG + Intronic
961951170 3:130750906-130750928 CTGGGAAGTGCCTGAACTATAGG + Intergenic
962417519 3:135196638-135196660 CTGGGAAGTAGGATAATTTTAGG + Intronic
962575919 3:136754644-136754666 CTGGCAAGTAGCTGAACACGAGG - Intergenic
963280593 3:143381247-143381269 GTGGGAGGTAGTTGAATTATGGG + Intronic
963632484 3:147750556-147750578 GTGGGAAGTAATTGAATTATGGG - Intergenic
964297250 3:155247186-155247208 CTGCGAACTAGCTCAAGTCTGGG - Intergenic
965331674 3:167381919-167381941 CAGGGAAGTATCTGAATGCAAGG + Intergenic
967559773 3:190904501-190904523 ATGGGAGGTAACTGAATTATGGG + Intergenic
968552835 4:1232849-1232871 CTGGGGAGTCGGTGAATTCTGGG - Intronic
969200130 4:5597011-5597033 CCAGGAAGAAGCTGAAATCTCGG + Intronic
969364859 4:6688514-6688536 CTGGGAAGGACATGAATTTTGGG - Intergenic
970340667 4:15103387-15103409 ATGGGAGGTAGCTGAATCATGGG + Intergenic
970552718 4:17199219-17199241 GTGGGAAGTAACTGAATCATGGG - Intergenic
970773565 4:19644858-19644880 CTGGGAGGTAATTGAATTATGGG + Intergenic
971032294 4:22652895-22652917 ATGGGAAGTAGTTGAATCATGGG - Intergenic
974455396 4:62123999-62124021 ATGGGAAGTAACTGAATCATGGG - Intergenic
974679747 4:65146148-65146170 CTGGGAAGTAATTGAATCATGGG - Intergenic
975717174 4:77216353-77216375 CTGGGTATTAGCTGAAGACTGGG + Intronic
976297124 4:83483803-83483825 TTGGGAAGTACCTGAGTGCTAGG - Intronic
976883288 4:89956742-89956764 ATGGGAAGTCTCTCAATTCTGGG - Intergenic
977316815 4:95460460-95460482 CTGGGAGATAACTGAATACTGGG + Intronic
977736611 4:100424721-100424743 GTGGGAACTAGCTGAAACCTTGG + Intronic
978226098 4:106337344-106337366 GTGGGAGGTAACTGAATCCTGGG + Intronic
978619422 4:110623333-110623355 CTGGGCAGGAGCTGAATTCCCGG - Intronic
979326708 4:119388862-119388884 GTGGGAAGTAGTTGAATCATGGG + Intergenic
979398379 4:120217867-120217889 GTGGGAGGTAGTTGAATTATGGG - Intergenic
979496638 4:121391447-121391469 GTGGGAGGTAACTGAATTATGGG - Intergenic
979975035 4:127185500-127185522 GTGGGAAGTAACTGAATCATGGG + Intergenic
981014582 4:139960677-139960699 CTGGGAAGGAACAGAAGTCTGGG - Intronic
981268308 4:142814071-142814093 CTTGGAAGTAGCTGAAAAATGGG + Intronic
981297849 4:143153680-143153702 GTGGGAGGTAGCTGAATCATGGG + Intergenic
982569035 4:157025555-157025577 CTGGGAAGTAACTGAATCATGGG - Intergenic
983244578 4:165273511-165273533 GTGGGAAGTAGTTGAATCATGGG + Intronic
984571315 4:181397656-181397678 GTGGGAGGTAGCTGAATCATGGG - Intergenic
984829490 4:183958485-183958507 ATGAGAAGTAGCTGAATTACAGG - Intronic
985007188 4:185545558-185545580 CTGGGATGCAGCTGAATACTTGG + Intergenic
985542922 5:495123-495145 CTGGGAAGCAGCGGGAGTCTCGG + Intronic
986179227 5:5377870-5377892 GTGGGAGGTAACTGAATCCTGGG + Intergenic
987037344 5:14031726-14031748 CTGAGCAGAAGCTGCATTCTAGG - Intergenic
987687065 5:21218549-21218571 GTGGGAAGTAGTTGAATCATGGG - Intergenic
988080529 5:26409729-26409751 CTGGGAAGTAATTGAATCATGGG + Intergenic
988119471 5:26942276-26942298 GTGGGAAGTAATTGAATTGTGGG - Intronic
989145121 5:38241830-38241852 CTGGGAAGTAACTGAATTAGTGG - Intergenic
989967006 5:50476047-50476069 CTGGGAGGTAACTGAATCATGGG + Intergenic
990001777 5:50901806-50901828 CTGGGAAGTAACTGAATCATGGG + Intergenic
990342990 5:54842741-54842763 GTGGGAAGTGGCCAAATTCTGGG + Intergenic
990953772 5:61323719-61323741 CTGGGACCTAGCTGGAATCTAGG + Intergenic
991000724 5:61779987-61780009 GTGGGAGGCAGCTGAATTCCAGG + Intergenic
992399377 5:76397657-76397679 CTAGGAAGCAGCTGAGTTTTAGG + Intergenic
993260854 5:85656104-85656126 GTGGGAAGTAATTGAATTATGGG + Intergenic
993277035 5:85873229-85873251 CATGGTAGTAGCTGAATTCCTGG + Intergenic
993391610 5:87325250-87325272 GTGGGAAGTAACTGAATTATGGG - Intronic
993747251 5:91615832-91615854 GTGGGAAGTAACTGAATCATGGG - Intergenic
994346879 5:98697637-98697659 CTGGGAAGGGGCTGAATCCAAGG - Intergenic
994976083 5:106808761-106808783 CTGAGAATTTGTTGAATTCTTGG - Intergenic
994994996 5:107049619-107049641 GTGGGAGGTAACTGAATTATGGG + Intergenic
995190405 5:109313516-109313538 ACGGGAAATAGATGAATTCTAGG - Intergenic
995529334 5:113076443-113076465 CAGAGTAGTAGCTGATTTCTTGG + Intronic
996468127 5:123826593-123826615 GTGGGAAGTAATTGAATTATGGG + Intergenic
997406711 5:133654798-133654820 CTGGGAAGGACCTGAACTCGTGG - Intergenic
999611308 5:153372835-153372857 GTGGGCAGTTGCTGAATTCTGGG - Intergenic
1000030638 5:157398334-157398356 GTGGGAAGTAATTGAATTATGGG - Intronic
1000512786 5:162204477-162204499 GTGGGAAGTAATTGAATTATGGG - Intergenic
1001681382 5:173559685-173559707 CTGGGAAGGATATGAGTTCTTGG - Intergenic
1001734139 5:173985066-173985088 GTGGGAAGTAACTGAATTGTGGG - Intronic
1001851492 5:174970783-174970805 CTGGGCACTAACTGAATTCCTGG + Intergenic
1003627629 6:7757573-7757595 CTGGGAAGGACGTGAATTTTGGG + Intronic
1005639755 6:27784813-27784835 CTGAGAAATGGCTGAATTTTGGG + Intergenic
1006977662 6:38118521-38118543 CTTGAAAGTAACTGAATCCTGGG + Intronic
1007783854 6:44269255-44269277 GTGGGAAAGATCTGAATTCTAGG + Intergenic
1008828329 6:55726924-55726946 GTGGGAGGTAGCTGAATCATGGG - Intergenic
1009635062 6:66254207-66254229 TTGGGAAGTGACTGAATTATGGG - Intergenic
1010882852 6:81201097-81201119 TTGGGAGGTAACTGAATCCTGGG + Intergenic
1011051982 6:83161801-83161823 CTTGGATGTAGCAGAATTATAGG - Intronic
1013138490 6:107306250-107306272 GTGGGAAGTAACTGAATCATGGG + Intronic
1013423229 6:109985786-109985808 GTGAGAAGTGGCTGGATTCTGGG - Intergenic
1014896761 6:126910734-126910756 GTGGGAGGTAGCTGAATCATGGG + Intergenic
1015126734 6:129763300-129763322 CTGGAATGGAGCTGAAGTCTGGG - Intergenic
1015867322 6:137740263-137740285 CTGGAAAGAACATGAATTCTCGG - Intergenic
1016595390 6:145792096-145792118 CTGGGAAGTAATTGAATCATGGG - Intergenic
1020955149 7:14731142-14731164 CTGGGAAGTGGATAGATTCTTGG + Intronic
1021010332 7:15455736-15455758 CTCAGGAGCAGCTGAATTCTAGG - Intronic
1021090317 7:16475181-16475203 GTGGGAGGTAACTGAATTATGGG - Intronic
1021192860 7:17642666-17642688 GTGGGAAGTAACTGAATCATGGG + Intergenic
1021230362 7:18080135-18080157 CTGGGAAGTAATTGAATCATGGG - Intergenic
1021538755 7:21733485-21733507 CTTGTAGGTAGCTGAATTCTAGG - Intronic
1021767343 7:23963171-23963193 CTGTGAACTTGGTGAATTCTAGG + Intergenic
1023019586 7:35998694-35998716 GTGGGAGGTAACTGAATTATGGG + Intergenic
1023263390 7:38380340-38380362 CTGGGAATTAACTGGATTTTAGG + Intergenic
1023683742 7:42714727-42714749 CCTGGCAGTAGCTGAATTCAAGG + Intergenic
1023743737 7:43303134-43303156 CAGCGAAGTTGCTGAAATCTGGG - Intronic
1023760882 7:43464052-43464074 CAGGAAAGCAGATGAATTCTGGG + Intronic
1024656343 7:51454181-51454203 CTGGGAATTCCCTGAATGCTGGG + Intergenic
1024674948 7:51630017-51630039 ATGGGAAGTAACTGAATCATGGG - Intergenic
1025939263 7:66062187-66062209 GTGGGAAGTGGCTGCATTATAGG - Intergenic
1026573673 7:71554222-71554244 GTGGGAGGTAGTTGAATCCTGGG + Intronic
1026638095 7:72101859-72101881 CTGAAAAGCAGCTTAATTCTAGG - Intronic
1027835719 7:83238958-83238980 GTGGGAAGTAACTGAATCATGGG - Intergenic
1028846970 7:95492133-95492155 CTGGGAGTTGGCTGAATTCCAGG + Intronic
1029026613 7:97423449-97423471 GTGGGAGGTAACTGAATTATGGG + Intergenic
1029111013 7:98213016-98213038 CAGGGAAGTGGCTGAATGTTCGG - Intergenic
1030207869 7:106968134-106968156 CTGGGAGGTAGCTTCATTCCTGG - Intergenic
1030607546 7:111653900-111653922 GTGGGAAGTAGTTGAATCCTGGG - Intergenic
1031405213 7:121377068-121377090 GTGGGAAGTAATTGAATCCTGGG + Intronic
1032056576 7:128689193-128689215 CTGGGCAGAAGCTGCAATCTCGG - Intergenic
1032561279 7:132895578-132895600 CTGGGAAGTAACTGAATAATGGG + Intronic
1032965020 7:137086466-137086488 GTGGGAAGTAACTGAATCATGGG - Intergenic
1034037549 7:147840371-147840393 CTGGGAAGAAGGTGCATTCCAGG - Intronic
1034167870 7:149039488-149039510 CTGGGAAGGACATGAATTTTGGG - Intergenic
1034845712 7:154442803-154442825 CTGGGAAGTAGCTGAATTCTGGG - Intronic
1035302153 7:157904555-157904577 CTGGCAAGAAGCTGGACTCTGGG - Intronic
1035447690 7:158954015-158954037 GTGGGAAGTAACTGAATCGTGGG + Intronic
1036247939 8:7136530-7136552 GTGGGAAGTAGTTGAATCATGGG + Intergenic
1036434461 8:8720540-8720562 GTGGGAGGTAACTGAATTATGGG + Intergenic
1036624988 8:10463033-10463055 GTGGGAGGTAGCTGAATCATGGG - Intergenic
1036993824 8:13631301-13631323 CTGGGAAGTAACTGAATCATGGG - Intergenic
1037112238 8:15177414-15177436 CTGGAAAATTGCTGAATACTTGG - Intronic
1037883268 8:22583142-22583164 ATGGGAGGTAACTGAAGTCTGGG - Intronic
1039292479 8:36111389-36111411 CTGTAAAGTAGCTCAAGTCTGGG + Intergenic
1039448013 8:37648158-37648180 CTGGGAAGTGGTTGAAGTCATGG - Intergenic
1041336974 8:56796647-56796669 CTGAGAAGTGGCAGACTTCTTGG + Intergenic
1043801051 8:84610013-84610035 GTGGGAGGTAACTGAATTATGGG - Intronic
1044020810 8:87103686-87103708 GTGGGAAGTAACTGAATCATGGG - Intronic
1044432371 8:92123502-92123524 CATGGAAGTAGCTGAAATCCAGG - Intergenic
1045140176 8:99271832-99271854 GTGGGAAGTAACTGGATTATGGG - Intronic
1045174202 8:99703868-99703890 CTGTGAAATAGCTGAACTTTAGG + Intronic
1045567728 8:103338580-103338602 CTGGGAGGTAACTGAATCATGGG - Intergenic
1045817102 8:106289816-106289838 GTGGGAAGTAACTGAATCATCGG + Intronic
1046230319 8:111347456-111347478 CTGGGAAGAAGCTGAAATCCTGG - Intergenic
1046832135 8:118758092-118758114 CAGGGAAGAAGATGAATTCCAGG + Intergenic
1047153643 8:122293780-122293802 CTGGGAGGTAACTGAATCATGGG - Intergenic
1047602218 8:126437275-126437297 GTGAGAAGTGGCTGGATTCTGGG - Intergenic
1048111045 8:131469225-131469247 CTGGTAACTACCTGAATGCTTGG - Intergenic
1048521463 8:135159318-135159340 ATGGGAAGAACATGAATTCTGGG - Intergenic
1049141105 8:140955242-140955264 CTGGGAGGTAACTGAATCATGGG + Intronic
1050053341 9:1625729-1625751 CTGAGGAGTGCCTGAATTCTGGG - Intergenic
1050185670 9:2970202-2970224 TTGAGAAGTGGCTGAATTCTGGG + Intergenic
1052071091 9:24081885-24081907 GTGGGAAGTAGATGAATCATGGG + Intergenic
1054960620 9:70964518-70964540 CTGAGAAGTAACTAATTTCTAGG + Intronic
1055262093 9:74448987-74449009 CTGGAATGTAGCTGTATCCTGGG + Intergenic
1055805248 9:80085765-80085787 GTGGGAAGTAACTGAATCATGGG + Intergenic
1057065243 9:92043654-92043676 CTGCGAAGTGTCTGGATTCTGGG - Intronic
1058726546 9:107810196-107810218 CTGGGAAGTAGCTGCCATGTCGG - Intergenic
1059599678 9:115763087-115763109 GTGGGAGGTAACTGAATTATGGG + Intergenic
1060803726 9:126562009-126562031 CTGGGAAGTCCCTTAGTTCTGGG + Intergenic
1062157750 9:135063071-135063093 GTGGGAGGTAGCTGAATCATGGG - Intergenic
1062681391 9:137783678-137783700 CTGGGAAGGACCTGTCTTCTCGG + Intronic
1186114021 X:6286392-6286414 GTGGGAGGTAACTGAATTATGGG - Intergenic
1186125961 X:6414143-6414165 GTGGGAGGTAACTGAATTATGGG + Intergenic
1186149424 X:6658427-6658449 GTGGGAAGTACTTGAATTATGGG - Intergenic
1186223762 X:7375852-7375874 GTGGGAAGTAATTGAATTATGGG + Intergenic
1186314002 X:8349431-8349453 GTGGGAAGTAATTGAATTATGGG - Intergenic
1190522330 X:51293068-51293090 CTAGGAAGTAGCTGAATGAGTGG - Intergenic
1191030822 X:55968578-55968600 GTGGGAAGTAATTGAATTATGGG + Intergenic
1192157832 X:68759525-68759547 CTGGGAAGTGGCAGATGTCTGGG - Intergenic
1194049526 X:89052405-89052427 GTGGGAAGTAACTGAATCATGGG - Intergenic
1194321251 X:92448352-92448374 GTGGGAAGTGACTGAATTATGGG + Intronic
1194778352 X:97992539-97992561 GTGGGAGGTAACTGAATCCTGGG - Intergenic
1194851313 X:98873030-98873052 GTGGGAGGTAACTGAATTATGGG + Intergenic
1195821940 X:108955424-108955446 CAGGGAAGTGACTGAATTGTGGG + Intergenic
1196529015 X:116761604-116761626 CTGTAAAATGGCTGAATTCTGGG - Intergenic
1196930283 X:120675304-120675326 GTGGAAAGTAACTGAATTATGGG - Intergenic
1198403099 X:136286682-136286704 GTGGGAAGTAACTGAATCATGGG - Intergenic
1200381704 X:155843715-155843737 GTGGGAAGTAATTGAATTATGGG + Intergenic
1200629368 Y:5561499-5561521 GTGGGAAGTGACTGAATTATGGG + Intronic