ID: 1034848415

View in Genome Browser
Species Human (GRCh38)
Location 7:154470277-154470299
Sequence TTCCTTCCTCCTCATTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034848413_1034848415 8 Left 1034848413 7:154470246-154470268 CCTCTCAGCAGCTCAGTAGCTCA 0: 1
1: 0
2: 2
3: 21
4: 206
Right 1034848415 7:154470277-154470299 TTCCTTCCTCCTCATTATGGTGG 0: 1
1: 1
2: 2
3: 24
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034848415 Original CRISPR TTCCTTCCTCCTCATTATGG TGG Intronic
902374155 1:16022509-16022531 ATCCTTCCTCTTCATTTGGGTGG + Intronic
902759676 1:18572957-18572979 TCCGATCCTCCTCATCATGGTGG - Intergenic
903218382 1:21855325-21855347 TTCCTTCCTCCAGGTGATGGTGG + Exonic
907259002 1:53202469-53202491 TGCCTTACTTTTCATTATGGAGG - Intronic
907448509 1:54526437-54526459 TTCCAGCCTCTTCATTATTGTGG - Intergenic
909131798 1:71746206-71746228 TTCTTTCCTCCTCATCATAAGGG - Intronic
911451937 1:98073908-98073930 TTCCTTCCTTCTCATTATGGTGG - Intergenic
911542836 1:99179190-99179212 TTTATTCCTCCTCATTAGGATGG - Intergenic
914439469 1:147691157-147691179 TTCTATCCTTCTCATTATGGGGG - Intergenic
915618899 1:157066631-157066653 TTTTTTCCCCCTCATTATTGAGG + Intergenic
915748212 1:158181382-158181404 TTTCTTCCTTCTCTTTATGCTGG + Intronic
916253210 1:162758920-162758942 CTCCTTCCTTCTTTTTATGGAGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
917978462 1:180254883-180254905 TTCTTTCCTCCTCCCTATGTGGG - Intronic
918746976 1:188215049-188215071 TTCCTTCCTCCTCAATATTTTGG + Intergenic
918927648 1:190809094-190809116 TTCCTTACTCCTGACTACGGGGG + Intergenic
919324976 1:196096048-196096070 TTATTTCCTCCTAATTATAGAGG - Intergenic
919799664 1:201345978-201346000 TTCCTTGCTCCTCCTTGAGGAGG - Intergenic
920534903 1:206731116-206731138 TTCCTTCCTCCTGTTGATGCAGG + Exonic
922188747 1:223298462-223298484 TTCCTCCCTCTCCAGTATGGGGG + Intronic
924539988 1:244971079-244971101 CTCCTGCGTCCTCATTAAGGAGG - Exonic
1063051467 10:2453851-2453873 TTCCTCCATCCTCAATGTGGGGG - Intergenic
1066753034 10:38679200-38679222 ATCCTTCCTCCTCATTTTTTCGG - Intergenic
1067535055 10:47102966-47102988 CTCCTTCCTCCTTATTTTGATGG - Intergenic
1068049551 10:51932048-51932070 GTCCATCCTCCTCATTAGGTAGG + Intronic
1070244213 10:74715295-74715317 TTCCCTCCTCTTCAATTTGGTGG + Intergenic
1070488595 10:76954334-76954356 TTCCTTCCTCTTCATTGCCGAGG - Intronic
1071901890 10:90129354-90129376 TTCCTTCCTCCTCACCCTGCTGG + Intergenic
1074419923 10:113299734-113299756 CACCTTCCTCCTCATTCAGGTGG - Intergenic
1074935546 10:118176380-118176402 TTCCTTTCTTCTCATTATTATGG - Intergenic
1077821638 11:5749521-5749543 TTCATTTCTCCTTATTGTGGGGG - Intronic
1078257634 11:9673653-9673675 TTCCTTCCTCCAGGGTATGGGGG + Intronic
1080346246 11:31329005-31329027 TACCTTCCTCCTGATTCTGATGG + Intronic
1080597369 11:33785605-33785627 TTTCTTCCTTCTTATTAGGGAGG - Intergenic
1080659877 11:34286998-34287020 GTTCTGCCTCCTCATCATGGTGG + Intronic
1082622803 11:55444849-55444871 TTGCATCCTCCTGTTTATGGTGG + Intergenic
1083406023 11:62457773-62457795 TTCCTCCCTCCTCTCTCTGGTGG - Intronic
1085349157 11:75787500-75787522 CTGCTTCCTGCACATTATGGTGG - Intronic
1085890793 11:80576198-80576220 TTTCTTCCTTCTGATTATGTTGG - Intergenic
1086211501 11:84325780-84325802 TTCCTTCCTCTTCAATATTTTGG + Intronic
1087251685 11:95907476-95907498 GTCCTTCCTCCTCATTTTTTTGG - Intronic
1087379526 11:97386828-97386850 TTTCCTCATCCTCATTATGAAGG + Intergenic
1087606539 11:100384415-100384437 TTCATTCCTCCTCAATAGGTGGG + Intergenic
1089736137 11:120551381-120551403 TTCCTTCCTCCTGGGTATGAGGG - Intronic
1090522377 11:127493092-127493114 TACCTTCCTCCAGATTAGGGGGG + Intergenic
1091133244 11:133164592-133164614 TTCCTTCCTTGTAATTATGTAGG + Intronic
1092308132 12:7322741-7322763 TTCCTGCCTCCCCCTTATGCAGG + Intronic
1093795696 12:23307840-23307862 CTAATCCCTCCTCATTATGGTGG + Intergenic
1094473001 12:30820603-30820625 TTCCTTCTCCCTCATTATTCTGG - Intergenic
1095213347 12:39520156-39520178 TTCCTTCCTCTTCAATTTTGTGG - Intergenic
1096537550 12:52285136-52285158 TTCTATCATCCTCATTTTGGAGG + Intronic
1096970000 12:55657923-55657945 TTCCTTCCTTCTCCATTTGGAGG - Intergenic
1097521147 12:60672499-60672521 TCCATTCCTCCTCATTGTGTGGG - Intergenic
1098222440 12:68284626-68284648 TTCCTTCCTCCCCACTCTGGTGG - Intronic
1098682152 12:73369834-73369856 TTCCTTCCCCCTAGATATGGGGG + Intergenic
1098740323 12:74165858-74165880 TTCCTTCCTCCTTAATTTGTTGG - Intergenic
1098772114 12:74565632-74565654 TTTCTTCCTCCTCTTTTTGGGGG - Intergenic
1101111266 12:101488521-101488543 TTTCTTCCTTCTTATTAGGGAGG + Intergenic
1101814501 12:108135523-108135545 TCTCCTCCTCCTCCTTATGGTGG + Intronic
1102499876 12:113344623-113344645 TTTCTTTCTCATCATTCTGGAGG - Intronic
1105299772 13:19121818-19121840 TTCCTTCCTCTTCATTTTTTGGG + Intergenic
1106854159 13:33829752-33829774 TTTCTTCCTTCTCATTATCCAGG - Intronic
1107240769 13:38231404-38231426 TCCATTCCTCCTCACTAGGGAGG + Intergenic
1109581410 13:64342341-64342363 TTCCTTGCTCCTCAATATTTTGG + Intergenic
1109777567 13:67062001-67062023 TTCCTTCCTCCTCAAAATTCAGG - Intronic
1111360917 13:87175020-87175042 ATCCTTCCTCCTAAATGTGGTGG + Intergenic
1111388286 13:87559196-87559218 TTTCTTTATGCTCATTATGGTGG + Intergenic
1111722155 13:91959502-91959524 TTCCTTCCTCCTCATGTTTTTGG - Intronic
1111786047 13:92787899-92787921 CTCCTTCCTCTTCATCTTGGCGG - Intronic
1111816473 13:93160153-93160175 TTACTTCATCCACATCATGGAGG - Intergenic
1113066970 13:106382592-106382614 GTCCTGCCTTGTCATTATGGTGG + Intergenic
1114381284 14:22207180-22207202 TTACTTTCTCTTAATTATGGAGG + Intergenic
1114511518 14:23265785-23265807 TTCCTTCCTTCTCATTATTTTGG + Intronic
1114989394 14:28268573-28268595 GTCCTTCCTCCTCAATTTTGTGG - Intergenic
1115089202 14:29553726-29553748 TTCCTTCCTCCGTCTTCTGGTGG - Intergenic
1116077956 14:40136085-40136107 GTCCTTCCTCCTCATTTTTGTGG + Intergenic
1116140089 14:40982352-40982374 TTCTTTCCTACTCATTGTGTTGG - Intergenic
1117315725 14:54568463-54568485 TTCCTTCCTCCTCCTTCTTTTGG + Intronic
1117611880 14:57491991-57492013 TTCCATCCTGCTCAATATGCTGG - Intronic
1119164443 14:72480596-72480618 TTCCCTCCTCCTCCTTATCTGGG - Intronic
1119693074 14:76691997-76692019 ATCCTTCCCCCTCATCATGGTGG + Intergenic
1120035849 14:79697377-79697399 TTTCTTCTTCCTCACTATGAAGG + Intronic
1120960372 14:90119251-90119273 GTCCTTCCTCCTCAATATTTTGG - Intronic
1121221781 14:92290910-92290932 ATCCTTCTTCCACATTATGGAGG + Intergenic
1121721186 14:96109730-96109752 TTCCTTCCTCCGTAAAATGGAGG + Intergenic
1121885111 14:97535667-97535689 GTCCTGCCTGCTCTTTATGGGGG + Intergenic
1122413310 14:101536968-101536990 TTCCTTCCTCCACATACTGTTGG - Intergenic
1122677253 14:103425802-103425824 TTGCTTCCTCCTGAAAATGGGGG + Intronic
1124516688 15:30372341-30372363 TTCTCTCCTCCTCCCTATGGAGG - Exonic
1124726230 15:32158390-32158412 TTCTCTCCTCCTCCCTATGGAGG + Exonic
1125405183 15:39345460-39345482 ATCCTTTCTCCCCATTAAGGAGG + Intergenic
1127302541 15:57669662-57669684 TTCCTTCCTTCTAATTATTTCGG + Intronic
1127629974 15:60819205-60819227 AATCTTCATCCTCATTATGGTGG - Intronic
1128786555 15:70401810-70401832 TTCCTTCCATCCCATTATGCTGG + Intergenic
1128888866 15:71312825-71312847 TGGCTTCCTCCTCATTATTCAGG + Intronic
1129025731 15:72572120-72572142 TTGCATCATCCTCATTATAGCGG - Exonic
1129244733 15:74272290-74272312 CTCCTCCCTCCTCATCCTGGAGG + Intronic
1131444417 15:92485336-92485358 TCTATTCCTCCTCATTAGGGAGG - Intronic
1133167261 16:3957121-3957143 TTCCTTCCTCCTCCTTTTCAAGG - Intronic
1134133509 16:11665446-11665468 TTCCTGCCTCCTCTTTGTTGGGG + Intergenic
1135207167 16:20493163-20493185 TTCTTTCATCTTCATTATTGTGG - Intergenic
1135211718 16:20530469-20530491 TTCTTTCATCTTCATTATTGTGG + Intergenic
1135534451 16:23282270-23282292 GTTCTTCCCCCTCATTTTGGGGG - Intronic
1136920502 16:34267351-34267373 GTCCTTCCTCCTCAGTATTCCGG + Intergenic
1137639240 16:50013851-50013873 TCCCTTCTTCCTCAGTCTGGGGG - Intergenic
1137683773 16:50372241-50372263 CTCCTTCCTCCCCTTTCTGGTGG + Intergenic
1137865057 16:51885761-51885783 TTCTTTCATGCACATTATGGGGG - Intergenic
1139767149 16:69240429-69240451 TTCCTTCCTCGTGTTTTTGGTGG + Intronic
1141028902 16:80571019-80571041 TTCCTCCTTCCCCATTTTGGGGG - Intergenic
1142510662 17:390647-390669 TTCCTTCCTCCCGTTTCTGGGGG - Intergenic
1143041781 17:4043504-4043526 TCCCAGCCTCCTCCTTATGGTGG - Intronic
1143168025 17:4908375-4908397 TGCCTTGCTCCTCATGCTGGAGG + Intergenic
1143449889 17:7029794-7029816 TGCCTTCCTGCTCATTGTGTAGG + Intronic
1144951697 17:18997941-18997963 TTCCTTCCTCCTCAGTGTCATGG - Intronic
1145989738 17:29071856-29071878 TACCTTCCTCCACTTTATGAAGG + Intergenic
1146185924 17:30724186-30724208 TTACTTCCTCCTAGTTCTGGAGG - Intergenic
1146426993 17:32749798-32749820 TTTCTTTCTCCTCCTTAAGGAGG + Intronic
1146914986 17:36672753-36672775 ATCCTTCCTCCTCATTACTAGGG + Intergenic
1147034911 17:37672631-37672653 TTCCTTCCTCCTGAGGGTGGAGG - Intergenic
1147231936 17:39025944-39025966 TTCCTTCCTTCTTTTTATAGGGG - Intergenic
1148208717 17:45795324-45795346 TGCCTGCCTGCCCATTATGGGGG - Intronic
1148436945 17:47692735-47692757 TTCCTTCCTCCTCCTCCTGCTGG - Intergenic
1148952518 17:51326067-51326089 TTCCTTGCTCCTCAGTTTGCAGG + Intergenic
1150209708 17:63435364-63435386 TTCCTTCCTCCTCAGCACAGTGG + Intronic
1151361777 17:73593381-73593403 ATCCTTCCTCCTCATTGTGCAGG + Intronic
1151439455 17:74118795-74118817 TTCTCTCCTCCTGATTCTGGTGG - Intergenic
1151665189 17:75541565-75541587 TTCCTGCCTTCACATTTTGGAGG - Intronic
1155283956 18:24270377-24270399 TTACTTCCCCCCCATTATGCAGG + Intronic
1157189474 18:45568477-45568499 GTACTTCCTCCTCATTGTGATGG + Intronic
1158742510 18:60159656-60159678 CCTCTTCCTCCTCATTATAGAGG - Intergenic
1158746131 18:60201883-60201905 TTCCCTCCTGTTGATTATGGTGG + Intergenic
1159638270 18:70832683-70832705 TTCCCTCCTCTTCATTATTCTGG + Intergenic
1159667618 18:71181486-71181508 TTACTTACTCATAATTATGGAGG - Intergenic
1160533795 18:79580611-79580633 TTCATTCCTCCCCATCTTGGGGG + Intergenic
1162006993 19:7787451-7787473 TTCCTTCCTTCTCATTTTCTTGG - Intergenic
1162972852 19:14191543-14191565 TTACTTCCTCCTAGTTCTGGAGG + Intronic
1163582241 19:18145736-18145758 TTCCGTCCTCCACACTCTGGGGG - Exonic
1163630375 19:18415303-18415325 CTCCCTCCTCCTCATTAAAGTGG - Intergenic
1163637067 19:18441877-18441899 ACCCTTTCTCATCATTATGGCGG + Intergenic
1164402732 19:27912772-27912794 CTCCTTCCCCCTCATTACTGAGG + Intergenic
1164928318 19:32149454-32149476 TTCCTTCCTCTGCTTTTTGGGGG - Intergenic
1167579859 19:50334966-50334988 TTCCTTCCCCCTCAGTGTGAAGG - Intronic
1168551217 19:57296782-57296804 TTCCCTCCTCTTCATTATTCTGG + Intergenic
925667117 2:6270238-6270260 TTCCTTCCTCCTGATTAACATGG - Intergenic
925853567 2:8107753-8107775 TTCCTTCCTCCTCATGCAGCCGG - Intergenic
926605706 2:14896471-14896493 TTCCTTCCTCCGTGTTATGGGGG + Intergenic
927242337 2:20929940-20929962 GTCCTTCCTCCACATTATGGAGG + Intergenic
927287191 2:21369192-21369214 AGCTTTCCTCCTCATTATGAAGG - Intergenic
927903292 2:26838944-26838966 ATCCTTCCTCTTGAGTATGGAGG - Intergenic
927919512 2:26961235-26961257 CTCCTTCTTCCTCAGTCTGGGGG - Intergenic
928104962 2:28464047-28464069 TTACTTCTTCCTCATCATGCTGG - Intronic
928589068 2:32795043-32795065 TTCCTTCCTCCTCAATTTTTTGG - Intronic
930713876 2:54574537-54574559 TTCCTTCCTCCTGCCTTTGGAGG + Intronic
930800911 2:55441720-55441742 TTGCTTCCTCCTCCTTAGAGAGG - Intergenic
933565471 2:83945194-83945216 TTCCTTCCACCCTATTAAGGAGG + Intergenic
933613757 2:84462985-84463007 TGCCTTCCTCCTCCCTCTGGGGG - Intergenic
934164053 2:89278208-89278230 TTCCTTCCGCATGATAATGGGGG + Intergenic
934203221 2:89904316-89904338 TTCCTTCCGCATGATAATGGGGG - Intergenic
936063762 2:109315108-109315130 TTCCTTTTTCTTCATTATTGTGG - Intronic
937899726 2:127010491-127010513 TTCCTTCCTCTTCAATTTGTTGG + Intergenic
937903942 2:127042805-127042827 TTCCTTCCTCTTAAATGTGGTGG + Intergenic
939439715 2:142231156-142231178 TTCCTTCCTCCTGATAATTTGGG - Intergenic
940124554 2:150309664-150309686 TTCATTCCTCCTTACTATGTGGG + Intergenic
941645647 2:168037868-168037890 CTCTTTCCCCCTCATTATGAAGG - Intronic
941691096 2:168501509-168501531 TTTCTTCGACCTCATTATAGGGG - Intronic
942716407 2:178897595-178897617 TTCATTCTACCTCATCATGGCGG - Intronic
943585917 2:189739924-189739946 TTCATTTCTCCTCATCCTGGAGG - Intronic
943945537 2:194057520-194057542 TTCCTTCCTTCTGATTGTGTTGG - Intergenic
944471618 2:200059255-200059277 GTCCTTCCTCCTCAATATTTTGG - Intergenic
947065112 2:226216090-226216112 TTCCTTCCTCTTCCTCAAGGGGG + Intergenic
947624403 2:231610788-231610810 TTTCTACCTCCTCATTTTGCTGG - Intergenic
947840419 2:233204266-233204288 TTCCTTCCGCGGCATTTTGGGGG - Exonic
947922139 2:233886328-233886350 TTCCTTCTTCCTGCTTATTGAGG + Intergenic
947922334 2:233888213-233888235 TTCCTTCTTCCTGCTTATTGAGG + Intergenic
1169948384 20:11014224-11014246 TTCCTTCTTCCTCATCTTGTGGG + Intergenic
1172854077 20:37987891-37987913 TTCCTTCGTGATCAGTATGGGGG + Intronic
1172922354 20:38495813-38495835 CTCCTTCCTCCTCATTCAGAAGG - Intronic
1174047211 20:47741954-47741976 CTCCTTCCTCCTCATTCCAGAGG + Intronic
1174117391 20:48236320-48236342 TTCCATCCTACTAATTTTGGAGG + Intergenic
1175276428 20:57774121-57774143 TTCCTTCCCCATCATCTTGGGGG + Intergenic
1175315835 20:58045953-58045975 TTTCTTGCTCCTCATTGTGTAGG - Intergenic
1175720838 20:61286064-61286086 TCCCTTGCTCCTCATTAGGATGG - Intronic
1175840871 20:62026495-62026517 TTCCTTCTGCGTCATTTTGGGGG - Intronic
1177757112 21:25361280-25361302 TCCCTTCCTCCTCATTCTGCAGG - Intergenic
1178106313 21:29323283-29323305 TTCCTTCCTCCTCAGCTTGCAGG - Intronic
1181980513 22:26762757-26762779 TTCCTTCCTCCCCTCTATGATGG + Intergenic
1182778079 22:32845740-32845762 TTCCTTCCACCTTGTTGTGGTGG - Intronic
1184901269 22:47448008-47448030 TTCCTTCATCCTAAGTGTGGTGG + Intergenic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
949264577 3:2141454-2141476 TTCCTTCCTGTTCCTTTTGGAGG - Intronic
949562763 3:5218045-5218067 TTCCTTCCTCCTCATGCTCCTGG + Exonic
950006539 3:9695162-9695184 TTCCTCCCTTCTCAGTATGTGGG + Intronic
951245061 3:20331330-20331352 TTGCTTCCTACTCATTATATGGG + Intergenic
951309178 3:21103044-21103066 GTCCTTCCTCCTCAATATTTTGG + Intergenic
951954370 3:28238744-28238766 TGCCTTGATCCTCATTATTGGGG - Intergenic
952695819 3:36264283-36264305 TTCATTCCTCCTCACTGGGGAGG - Intergenic
952763790 3:36938008-36938030 TTGCTTCCTCCTCAATCTGAGGG + Intronic
952805537 3:37346944-37346966 TTCCTTCCTCCTCTTTCTTCTGG - Intronic
953329563 3:42041572-42041594 ATTCTTCCTCCTCAATATGAGGG + Intronic
954159667 3:48711946-48711968 TTCCTTCCTCCTCATCAGCAGGG - Intronic
954601566 3:51874603-51874625 TTCCTTCCTCCTCACCAAAGTGG + Intronic
958110686 3:89139787-89139809 TTCATTCCTCCTCTCTGTGGAGG + Intronic
959266419 3:104145930-104145952 TTCTTTCCTTCTCATTCTAGGGG - Intergenic
959266512 3:104147066-104147088 TTCTTTCCTACTCATTCTAGAGG + Intergenic
959614650 3:108333846-108333868 TTCCTTCCCCTTCATTATGCTGG + Intronic
961859312 3:129901946-129901968 TTCCTTCCTCCTCATCATTAGGG - Intergenic
966499469 3:180622953-180622975 TTCCCTCCTCCTCAATATTTTGG + Intronic
969094230 4:4719899-4719921 TCTCTTCCTCCCCATTCTGGAGG - Intergenic
972831202 4:42815511-42815533 TTCCTTCCTCCTCACTTGGTTGG - Intergenic
973066477 4:45800209-45800231 TTCCTTCTGCCTCTATATGGAGG + Intergenic
973835266 4:54803296-54803318 TTCCTTCCTCCTGGGTATGAAGG + Intergenic
974424321 4:61721243-61721265 TTCCTTGCTCCTCAGTTTGCAGG - Intronic
974484383 4:62488299-62488321 TTCTTTTCCACTCATTATGGGGG - Intergenic
974660592 4:64883325-64883347 TTCCTGACTCATCATTTTGGAGG + Intergenic
974889671 4:67865953-67865975 TTCCCTCCTCCTCAATATTTTGG - Intronic
977948301 4:102939512-102939534 ATCCTTCCTCCTCATTTTTTTGG - Intronic
978298688 4:107239719-107239741 TTCCCTCTTCCTCATTGTGATGG - Intronic
978415179 4:108467491-108467513 TCACTTCCACCTCATTATGTTGG + Intergenic
985202521 4:187498432-187498454 TTCCTTTCTCCTCCTTACTGAGG + Intergenic
985658034 5:1142231-1142253 TTTCTTCCTCCTGATTATGGGGG - Intergenic
986808481 5:11331321-11331343 TGCTTTCCTCCTCAGTATGAGGG + Intronic
987429632 5:17816718-17816740 TTCCTTCCTCCTCATTCCGCTGG + Intergenic
987561063 5:19520621-19520643 TTCCTTCCTCCTCATTTGAATGG - Intronic
988829031 5:34969705-34969727 TTCCTTCCTCCTGGTCAGGGAGG + Intergenic
989783460 5:45298484-45298506 TCCCTTTGTCCTCATTATTGTGG - Intronic
989814841 5:45723250-45723272 TTTCTTTCTCCTCCTTTTGGAGG - Intergenic
990415745 5:55584991-55585013 AGCCTTCCTGCTCATTATGAAGG - Intergenic
990497892 5:56367148-56367170 TTCCTTTCTCATCATTCTGGTGG + Intergenic
991439178 5:66628492-66628514 TTCCTTCCTATTGATTATAGAGG + Intronic
992090004 5:73308385-73308407 TTCCTAACCCTTCATTATGGAGG - Intergenic
993238481 5:85346924-85346946 TTCCCTTCACCTCATTGTGGAGG - Intergenic
993603995 5:89964454-89964476 TTTCTTCTTCCTCATTTTTGTGG - Intergenic
993625192 5:90215385-90215407 TTCCTTCCTCTTCAGTTTTGTGG - Intergenic
993667182 5:90713810-90713832 TTCCTTTCTCCTACTCATGGAGG - Intronic
994397674 5:99239187-99239209 TTCCTTCCTTCTTGTTATAGGGG - Intergenic
994946617 5:106401951-106401973 TTCCTTCCTCATTATTTGGGAGG + Intergenic
995331253 5:110949478-110949500 GTCCTTCCTCCTCAGTATTCCGG + Intergenic
995641061 5:114258376-114258398 TTCTATCCTCCTCAATTTGGGGG + Intergenic
996018907 5:118570603-118570625 TTCCTTGCTCCTCAGTTTGCAGG + Intergenic
996426913 5:123322863-123322885 TTCCCTCCTCCTCAATATTTTGG + Intergenic
997725997 5:136120264-136120286 AGCCTTCCTCCTCACTATGAAGG + Intergenic
998253807 5:140569960-140569982 TTCTTGTCTCCTCATTCTGGAGG - Intronic
998664352 5:144279537-144279559 TTCTTTCCTCGTAATTCTGGAGG + Intronic
999215874 5:149934632-149934654 ATCCTTCCCATTCATTATGGGGG + Exonic
1001258412 5:170203620-170203642 TTCTATCGTACTCATTATGGAGG + Intergenic
1001981371 5:176040108-176040130 TTCCTTCCTCTTCATTCTTTGGG + Intergenic
1002236092 5:177803958-177803980 TTCCTTCCTCTTCATTCTTTGGG - Intergenic
1002315544 5:178340986-178341008 TTCCTCCATCTTCATAATGGGGG - Intronic
1003688442 6:8327590-8327612 TTCTTCCCTCCTAACTATGGTGG + Intergenic
1008465929 6:51830717-51830739 TTCATTCTTCCTCTTTTTGGGGG - Intronic
1009592774 6:65693989-65694011 TTTCTTCATCCTCCTTGTGGGGG - Intronic
1009632980 6:66223633-66223655 TTCCTTACTAATCATTATGATGG + Intergenic
1010549055 6:77198556-77198578 TTCTTTCCTCCTCAATATTTTGG + Intergenic
1011307884 6:85949026-85949048 TTCCTTCCTTCTGATGAAGGTGG - Intergenic
1011528842 6:88297892-88297914 TTCCCTCCTACTCTTTTTGGGGG - Intergenic
1011540474 6:88422253-88422275 TTCCTTTCTCATCTGTATGGTGG + Intergenic
1013726036 6:113097026-113097048 ATCCTTACTCCTCTTTATTGAGG + Intergenic
1013792584 6:113854670-113854692 TTCCTTCCCTGTCATTATGCAGG + Intergenic
1014210854 6:118706748-118706770 TTCCGTCCTCCTCATCAATGTGG + Intronic
1014341052 6:120207353-120207375 ATCCTTCCTCCTCAATTTTGTGG - Intergenic
1014497770 6:122147781-122147803 ATCCTTCTTCCTCATTGTCGTGG - Intergenic
1015053625 6:128873698-128873720 TTCCTTCCTTCTACTTATGTTGG - Intergenic
1015723710 6:136276219-136276241 GTCCTTCCTCCTCAGTATTCCGG + Exonic
1016182165 6:141160305-141160327 ATCTTTCCTCCTCATTATAAGGG - Intergenic
1016727818 6:147395837-147395859 GTCTTTCCTCCTCTTCATGGTGG - Intergenic
1016923960 6:149322034-149322056 TTCCTTTCTCTTTATTATGCAGG - Intronic
1017782460 6:157726683-157726705 CTCATTCCTCCTCATTACTGAGG + Intronic
1018096305 6:160390107-160390129 TTCATGCCTCCCCATTTTGGAGG - Intronic
1018268550 6:162051710-162051732 TTCCTTCCTCTCCATCCTGGTGG + Intronic
1018577704 6:165276751-165276773 TTCCTTCCTCCTCATCCTCATGG + Intergenic
1018804575 6:167248884-167248906 TTTCTTCCTCTTCCTTTTGGGGG + Intergenic
1018825871 6:167407559-167407581 TTTCTTCCTCTTCCTTTTGGGGG + Intergenic
1020338336 7:7082335-7082357 TGCCTTCCTCCTTATTACAGAGG + Intergenic
1021221236 7:17977430-17977452 TTCTTTCCTGCTCATTCTGAAGG - Intergenic
1023301735 7:38780376-38780398 AGCCTTCCTCCTCCTGATGGAGG + Intronic
1023708488 7:42967072-42967094 TTCCTTCCTCCTCCTTTGGGAGG + Intergenic
1026185421 7:68079314-68079336 TTCCTTCCTCCTCACTTTCCAGG - Intergenic
1030953870 7:115826412-115826434 ATTCTAACTCCTCATTATGGTGG + Intergenic
1031239711 7:119221145-119221167 TTCCTCCAGCCTCATTAGGGAGG + Intergenic
1031534106 7:122912593-122912615 TACTTTCCTCCTCACTTTGGGGG + Intergenic
1031542570 7:123012933-123012955 ATCCTTACTCCTCATTGTGTAGG - Intergenic
1031823772 7:126536217-126536239 TTCCTTCATCATTCTTATGGTGG + Intronic
1032726921 7:134598600-134598622 GTCCTTCCTCCTCATTTTTTTGG + Intergenic
1032965877 7:137096835-137096857 ATCCTTCCTCCTCATTTTTTTGG - Intergenic
1033032178 7:137837740-137837762 TTTCTTTCTCATCATTCTGGAGG - Intronic
1033164062 7:139023554-139023576 TTCCTTGGTCCTCATCATGTAGG - Intergenic
1033356762 7:140606646-140606668 TTTCTTCCTCCTCAGTTTGGAGG - Intronic
1034466651 7:151233693-151233715 TTACTTCCTCCTCTTTTTAGTGG + Exonic
1034848415 7:154470277-154470299 TTCCTTCCTCCTCATTATGGTGG + Intronic
1035064006 7:156092177-156092199 TTCCTCCCTCCTCGTACTGGAGG + Intergenic
1035130908 7:156652162-156652184 TTCCTTCCTCCGAATTTTGAAGG + Intronic
1036669443 8:10771576-10771598 TACCTTGTTCCTCATTAGGGAGG - Intronic
1038935110 8:32241362-32241384 TTCCTTCCCCCTCAGTATGTTGG + Intronic
1039370303 8:36977736-36977758 TACCTTCCACCTCTCTATGGGGG - Intergenic
1039441411 8:37597928-37597950 TTCCTTCCTCCTGGTGATGGGGG - Intergenic
1041739168 8:61139937-61139959 TTCCTGCCTCCACACTGTGGAGG + Intronic
1043106582 8:76120750-76120772 TTCCTTCATCCTGAATCTGGAGG - Intergenic
1045352898 8:101358783-101358805 TTCCTTTCATCTCATCATGGAGG - Intergenic
1046453076 8:114419401-114419423 GTCCTTTCTCCTCATTTTGGGGG - Intergenic
1046929982 8:119832520-119832542 TTTCTTCCTGTTCATTCTGGCGG + Exonic
1047561043 8:125988452-125988474 TTTCTTCCTCTTCTTTAAGGGGG - Intergenic
1049347548 8:142146786-142146808 GTCCTTCCTGCTCATTGTGTCGG - Intergenic
1049422916 8:142524794-142524816 TGCCTTCCTCCACACTAAGGTGG - Intronic
1049910425 9:260847-260869 TTCATTCCTTTTTATTATGGAGG - Intronic
1051475620 9:17505248-17505270 TGCCTTCTTCCTGATTATAGGGG - Intergenic
1051505815 9:17826559-17826581 TTCCTTCCTCCTCAGCTTGCAGG - Intergenic
1051684897 9:19647941-19647963 TTCCTTCCTCTTCCTATTGGTGG + Intronic
1055225305 9:73988348-73988370 GTCCTTCCTCCTCATTTTTTGGG - Intergenic
1056907078 9:90662072-90662094 GTCCCTCCTCCTCAATATTGTGG + Intergenic
1057037389 9:91821248-91821270 TTGCTTTCTCCTAATTCTGGGGG - Intronic
1057640827 9:96819416-96819438 TAACTTCCTCCTTATGATGGAGG + Exonic
1057695502 9:97320292-97320314 ATCCCTCCTCCCCATGATGGCGG - Intronic
1058014467 9:100014889-100014911 TTCATTTCTCATCATTCTGGAGG + Intronic
1058150141 9:101454614-101454636 TTCATTCCTTCTCAGTTTGGAGG + Intergenic
1058446054 9:105056311-105056333 GTCATTGCTCCTCCTTATGGGGG - Intergenic
1061533342 9:131231867-131231889 TTGCTTCCTCTTCTTTTTGGGGG - Intronic
1062607147 9:137353434-137353456 TCCCCTCCTCCTCATTATGTGGG + Intronic
1185754551 X:2643021-2643043 TTCCTTCCTCCTCTTTGCTGTGG - Intergenic
1189699563 X:43703441-43703463 TTCCTTTCTCCTCGTTGTTGTGG + Intronic
1190379341 X:49824164-49824186 TTCTTTCCTCCTCAATATTTTGG - Intergenic
1190627720 X:52352726-52352748 TTCCTTCCTTCTGGGTATGGGGG - Intergenic
1190743572 X:53306679-53306701 TTCCTTCACTTTCATTATGGTGG - Intronic
1191811430 X:65193194-65193216 TTCCTTCCTCCTCAATTTTTTGG + Intergenic
1192490877 X:71576531-71576553 TTCCTTCCTGCTCTGTATAGTGG + Intergenic
1192771229 X:74194337-74194359 TTCCCTCCTCCTCAATTTTGTGG + Intergenic
1192862899 X:75097367-75097389 TTCCTAACTCCCCATGATGGTGG + Intronic
1192892241 X:75402838-75402860 GTCCTTCCTCCTCATTTTTCTGG - Intronic
1194010293 X:88553570-88553592 TTCTTCCCTCCTCAATTTGGGGG + Intergenic
1195104845 X:101593844-101593866 TCCCTTCCTCCTCACTGTGGGGG - Intergenic
1195311686 X:103638345-103638367 TTCATCCCTCCTCAGCATGGTGG + Intergenic
1197314412 X:124946849-124946871 TTCCTTCTACCTCATTAAGGTGG - Intronic
1197356729 X:125444880-125444902 CTCATTCCTCCTCATTGTGCTGG + Intergenic
1198783468 X:140261292-140261314 TTCCTTCCTCCTCAGCTTGCAGG - Intergenic
1199807243 X:151312455-151312477 TCCCTTCCTCCTCATTGCTGAGG - Intergenic
1200258198 X:154597029-154597051 TTCCTTCCTGCCCAGTTTGGTGG - Intergenic
1201471887 Y:14343331-14343353 TTCCTTTCCCTGCATTATGGTGG + Intergenic