ID: 1034857310

View in Genome Browser
Species Human (GRCh38)
Location 7:154563722-154563744
Sequence AGGTGTGGGAGTGGAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 565}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034857302_1034857310 15 Left 1034857302 7:154563684-154563706 CCACTATCTGAGAAGAGGAAAAA 0: 1
1: 0
2: 2
3: 44
4: 396
Right 1034857310 7:154563722-154563744 AGGTGTGGGAGTGGAGTAGAAGG 0: 1
1: 0
2: 2
3: 57
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034857310 Original CRISPR AGGTGTGGGAGTGGAGTAGA AGG Intronic
900278979 1:1853109-1853131 AGCAGTGGGAGTGGAGCACAGGG - Intronic
900659173 1:3774337-3774359 GGGTGTGGGGGTGGAGGAGTTGG - Intronic
900967146 1:5966736-5966758 AGGGGTGGGAGTGGGCTAGAAGG - Intronic
900973629 1:6005009-6005031 AGGGGTGAGGGTGGAGTAGGGGG + Intronic
900973689 1:6005208-6005230 AGGGGTGAGGGTGGAGTAGGGGG + Intronic
900973701 1:6005248-6005270 AGGGGTGGGGGTGGAGTTGGGGG + Intronic
900973744 1:6005406-6005428 AGGGGTGGGGGTGGAGTTGTGGG + Intronic
900974002 1:6006356-6006378 AGGGGTGGGGGTGGAGTGGGGGG - Intronic
901110571 1:6790276-6790298 AGGAGTGGGGGTGGTGAAGAGGG + Intronic
901810072 1:11762393-11762415 AGGGGTGGGGGTGGAGTGGGAGG + Intronic
901865578 1:12104696-12104718 AGGTGGGGGAGGGCAGCAGAAGG - Intronic
902287200 1:15414299-15414321 AGGTGGAGGTGTGGAGAAGAGGG - Intronic
902615372 1:17620717-17620739 AGCTGTGGGGGTAGAGTAGGGGG + Intronic
902873933 1:19329906-19329928 AGGTGGGAGAGTGGAGAGGAGGG + Intergenic
902876757 1:19344963-19344985 AGGTCTGGGGGTGGAGCAGGAGG + Intronic
902962593 1:19975504-19975526 AGGTGGAGGAGAGCAGTAGAAGG + Exonic
903139820 1:21332704-21332726 AGGTGAGGGAGGGGAGGGGAGGG + Intronic
903468312 1:23567989-23568011 GGGTGAGGGAGTGGAGGAAAAGG - Intergenic
903578421 1:24353463-24353485 GTGTGTGGGTGTGTAGTAGAGGG + Intronic
903974135 1:27138188-27138210 TGGTGTGAGAATGGAGAAGAGGG - Intronic
904203162 1:28835015-28835037 ATGAGTGGGTGTGGGGTAGAGGG + Intronic
904239826 1:29136716-29136738 CAGTGTGGGAGTGGAGTTCACGG + Intergenic
904460641 1:30677690-30677712 TGGCCTGGGTGTGGAGTAGAAGG + Intergenic
904613411 1:31737381-31737403 AGGGGTGTGAGTGGGGTGGAGGG - Intronic
904771009 1:32881462-32881484 AGGTGTGGGAGTGAGGAAGAGGG + Intergenic
904839613 1:33363985-33364007 AGGTGGGGGAGGGGAGTAAGGGG - Intronic
905098452 1:35496457-35496479 ATATGTGGGAGTGGAATAGCTGG - Intronic
905292965 1:36935527-36935549 AGATGGGGGAGGGGAGGAGAAGG - Intronic
905874897 1:41426423-41426445 AGGTGGGAGAGAGGAGCAGACGG + Intergenic
906382503 1:45341596-45341618 AGGTGTGGCTGTGGGGTGGAGGG + Intronic
906688164 1:47775824-47775846 AGGTGTGAGAGTGGGGGTGAAGG + Intronic
906813098 1:48849567-48849589 AGGTGGGAGTGAGGAGTAGATGG - Intronic
906980083 1:50620842-50620864 TGGTGTGGGAGGGGAGGAGATGG + Intronic
908980861 1:69956320-69956342 GAGTGTGGGTGTGGAGAAGAGGG - Intronic
909056317 1:70825395-70825417 AGGTGTAGGAATGGAGAAGACGG + Intergenic
909206134 1:72760017-72760039 GGGTGTGGATGTGGAGTAAAAGG - Intergenic
910210905 1:84791909-84791931 AGGTGTGGGGCCGGGGTAGAAGG + Intergenic
911050240 1:93664919-93664941 ATGGGTGGGGGTGGGGTAGATGG - Intronic
911247098 1:95530099-95530121 AGCTGTGGGAGTTGAGGGGATGG - Intergenic
913121717 1:115748473-115748495 AGGGGTGGGAGTGGAATGGCAGG + Intronic
913126975 1:115800215-115800237 ATGTGAGGGAGTGGAGAATATGG + Intergenic
913558031 1:119988739-119988761 AGGTCTGGTGGTGTAGTAGAAGG + Intronic
914436311 1:147663288-147663310 AGGTGGGGGGGTGCAGTAAATGG + Intronic
914904143 1:151730075-151730097 AGGTATGGGAGTGGACCAGATGG + Intergenic
915237286 1:154493292-154493314 AGGTGTTGGAATGGACTGGAAGG - Intronic
915940608 1:160116140-160116162 AGATGTGGGAGTGGGGTGGAGGG - Intronic
915954661 1:160211715-160211737 AGGTGGGGGAGGGGAGCACAGGG + Exonic
916419537 1:164623349-164623371 TGGTGTGGGAATGGGGGAGATGG + Intronic
916513385 1:165493415-165493437 AGGTGAGGGAGTTGAATGGAAGG - Intergenic
916798180 1:168187403-168187425 AGGAGTGTGAGAGTAGTAGAAGG + Intronic
917418441 1:174836279-174836301 AGGTATGAGAGAGGAGTTGAAGG + Intronic
917597463 1:176543637-176543659 AGGTGTGGCATTGGAGATGAAGG - Intronic
917969958 1:180199977-180199999 GGGTGTGGGGGTGGAGGAGAGGG + Exonic
918009383 1:180572441-180572463 AGGTTTGGGACGGGAGTAGGTGG - Intergenic
918034236 1:180851352-180851374 GGGTGTGGTGGAGGAGTAGAGGG + Intronic
918659949 1:187075210-187075232 AGGTGTGGTCATGGAGTAGAAGG - Intergenic
919091661 1:192984854-192984876 GGGTGTGGGGAGGGAGTAGAGGG - Intergenic
919125949 1:193394073-193394095 AGGTCTGGGAGTATAGTATATGG + Intergenic
919334493 1:196214595-196214617 AGGTGTGGTAAAGGAGAAGAGGG + Intergenic
919807852 1:201391338-201391360 ATGTGTGGGCGAGTAGTAGATGG - Intronic
920089550 1:203442518-203442540 AGGTGGGAGAGAGGAATAGAAGG - Intergenic
920181407 1:204134241-204134263 AGGGTGGGGAGTGGAGTAGGCGG + Intronic
920228786 1:204456735-204456757 AAGTGTGGGAGTGGGGTGGTGGG - Intronic
920850501 1:209625106-209625128 AGGTGTGTGAGTGGTGGGGAAGG - Intronic
921712528 1:218387235-218387257 AGGGGTGGGAGGGGAGTGGAGGG + Intronic
921830319 1:219721297-219721319 AGGTGTGGGAGGGTGGGAGAAGG + Intronic
921921252 1:220672687-220672709 AGGGATGGGAGTGGGGAAGAGGG - Intergenic
922539878 1:226410520-226410542 AGGGGTGGGAGGGGAGGGGAGGG + Intergenic
922547437 1:226468815-226468837 ATGTGTGGTTGTGGAGGAGAAGG + Intergenic
922549051 1:226480645-226480667 AGGTGGGGGAGTGGAGGTGCTGG - Intergenic
923731701 1:236557391-236557413 AGGCTAGGGAATGGAGTAGAGGG + Intronic
923745188 1:236693584-236693606 TGGTGTGGGAGAGGAGGAGGGGG - Intronic
923774765 1:236968354-236968376 AGGTGTCGGAGTCGAGGTGAGGG + Intergenic
923814455 1:237359839-237359861 AGGGCTAGGAGTGGAGTAGATGG - Intronic
924509018 1:244712949-244712971 ACGTGTGGGAGAGGTGAAGACGG - Intergenic
924674883 1:246165713-246165735 AGGTCGGGGAGTGGAGAAGGTGG + Intronic
1063003399 10:1945570-1945592 AGGAGTGGGAGTGGATTCAATGG + Intergenic
1063279142 10:4605741-4605763 AAGTGAGGGAGAGGAGTAGAAGG - Intergenic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1064680779 10:17809147-17809169 ACGTGTGGGAGAGGAGTGGCGGG - Intergenic
1066050086 10:31626096-31626118 AGGGGTGGAAGAGGAGTGGATGG - Intergenic
1066197898 10:33118864-33118886 AGTGGTGGGGGTGGAGTAGATGG - Intergenic
1067044088 10:42974797-42974819 AGGTGAGAGAGAGGAGCAGAGGG + Intergenic
1067717260 10:48699127-48699149 AGGTCTGGGAGGTGAGGAGAGGG + Intronic
1068328640 10:55530850-55530872 AGGTCTGGCAGTGGAGCTGATGG + Intronic
1069267407 10:66478780-66478802 ATGTCTGGGAGTACAGTAGATGG - Intronic
1069597514 10:69681931-69681953 AGATGGGGGAGTGGAGTTGGGGG + Intergenic
1069721850 10:70554910-70554932 AGGAGGGGGAGGGGAGGAGAGGG - Intronic
1069939424 10:71944285-71944307 AGCTGTGGGAGTGGTCAAGATGG - Intergenic
1070649593 10:78225310-78225332 AAGTGGGGGAGGGGAGTTGATGG + Intergenic
1070781423 10:79139610-79139632 AGAGGTGGGAGGGGAGTGGACGG + Intronic
1070975828 10:80604745-80604767 AGAAGGGGGAGTGGAGTAGATGG - Intronic
1071076538 10:81760565-81760587 AGGGCTGGGGGTTGAGTAGAGGG - Intergenic
1071259111 10:83903482-83903504 AGGTGTGAGAGAGGAGAAAAAGG - Intergenic
1072641143 10:97212078-97212100 GGGGGTGGGAGGGGAGCAGAGGG - Intronic
1072780387 10:98247231-98247253 AGATGAGGGAGTTGAGGAGAGGG + Intergenic
1073049839 10:100660355-100660377 AGGTATGGGAGCGGGGTAGGAGG + Intergenic
1074203464 10:111259988-111260010 GGGGGTGGGAGTGGGGTGGAGGG - Intergenic
1074377091 10:112949930-112949952 CGGGGTGGGAGAGGAGGAGAAGG - Intergenic
1075442959 10:122494071-122494093 AAGTGAGGCAGTGGAGTTGAGGG - Intronic
1075515125 10:123102593-123102615 AGCTCTGGGAGGGGAGCAGAGGG - Intergenic
1076022698 10:127087423-127087445 GGGCAGGGGAGTGGAGTAGAGGG + Intronic
1077015983 11:399383-399405 AGGTGGAGGAGTGGGGCAGATGG - Intronic
1077198250 11:1292165-1292187 ATGTGTGGGTGTGCAGCAGAAGG - Intronic
1077273301 11:1691856-1691878 AGGTTGGGGTGTGGAGTAGGAGG + Intergenic
1077306421 11:1870581-1870603 TGCTGTGGGAGTGGAGCAGGTGG + Intronic
1077519014 11:3020199-3020221 AGGTGAGCGAGTGGCCTAGAAGG - Exonic
1078665909 11:13325008-13325030 AGCTGTGGGGATGGAGAAGAGGG + Intronic
1079013249 11:16846942-16846964 AGCTGTGGAAGTAGAGAAGAAGG + Intronic
1079365125 11:19802292-19802314 AGGGGTGGGATTGGGCTAGAGGG + Intronic
1081633056 11:44702394-44702416 AGATGAGGCAGTGGAGTGGATGG + Intergenic
1081871518 11:46384713-46384735 AGGCTTGGGAAGGGAGTAGAAGG - Intergenic
1082649081 11:55764960-55764982 AGGTGTGGGAGTAAAGGAAAGGG + Intergenic
1082960438 11:58914217-58914239 AGGTGTGGAATTGGATGAGAGGG - Intronic
1083254424 11:61487417-61487439 GCGTGTGGGAGTGGAGAAGAGGG + Intronic
1083300474 11:61737433-61737455 AGGTCTGGGAGTGGCCTGGAGGG + Intronic
1083613109 11:64013794-64013816 AGGCCTGGAAGTGGAGGAGAGGG - Intronic
1084292314 11:68181890-68181912 CGGTGTGGGAGTGCAGGGGACGG - Intronic
1084682297 11:70673510-70673532 TGGTGGGGGTGGGGAGTAGATGG + Intronic
1085172985 11:74464462-74464484 TGGAGTGGGAGAGGAGTTGAAGG + Intronic
1085173988 11:74470907-74470929 AGATGGGGGAGTGGGGTGGATGG + Intergenic
1085280102 11:75324611-75324633 GGGTGTGGGTGTGGAATAGGGGG + Intronic
1086008896 11:82074231-82074253 AGGTGGAGGAGTTTAGTAGATGG - Intergenic
1087158952 11:94930529-94930551 AGGTGTGGCCATGGAGTAAAGGG + Intergenic
1087430470 11:98047054-98047076 AGGTATGGGAGTGGAATCAATGG - Intergenic
1088709955 11:112499153-112499175 AGATGTGGGAGTGCAGAGGAGGG + Intergenic
1089314008 11:117578311-117578333 AGGTGTGGCAGTGAGGGAGAAGG - Intronic
1089588375 11:119524214-119524236 AGGTGAGGGAGCGGAGGAGAGGG + Intergenic
1091670613 12:2449648-2449670 CTGTGTGGGAGTGGTGGAGAGGG - Intronic
1092079563 12:5704127-5704149 GGGTGTGGGGGTGGGGAAGAGGG + Intronic
1093109171 12:15128809-15128831 AGGTGAGGGAGGGAAGAAGAAGG - Intronic
1094665210 12:32513334-32513356 AGGTGTAGGAGTGGAATGGTTGG + Intronic
1094681585 12:32671997-32672019 GGGTGTGGGTGTGGAGCAAAGGG + Intergenic
1095424440 12:42060464-42060486 AGGTGTGGGAGTGGTGGGGGTGG - Intergenic
1095444637 12:42271750-42271772 AGGGGAGGGAGGGGAGTGGAGGG - Intronic
1096254180 12:50052866-50052888 AAGTGTGGGAGTGGGGTAAGAGG + Intergenic
1096355689 12:50938682-50938704 AGCTGTGGAAATGGAGTGGAAGG - Intergenic
1096386571 12:51198488-51198510 ACGTGCGGGGGTGTAGTAGAGGG + Intronic
1096479129 12:51926356-51926378 AGGTGGGGGTGTGGAGTGGGCGG - Intergenic
1096535019 12:52266551-52266573 AGATGTGGGATTGGAGAACATGG - Intronic
1096594894 12:52688700-52688722 AGGTGTGGGTGGGGAGATGAGGG - Intergenic
1096634854 12:52951673-52951695 AGGTGTGGGAGGGAGGCAGACGG + Intronic
1096712099 12:53465077-53465099 AGGAGTGGGAGAGGGGAAGAGGG - Intronic
1096945567 12:55404719-55404741 TGGTGAGGGAGTGGAGAAAAGGG + Intergenic
1098072388 12:66689819-66689841 AGGTCTGGGAGTGGGGGAAATGG - Intronic
1098444779 12:70555285-70555307 ATGTGTGGGGGTGGAGGAGGGGG + Exonic
1098932441 12:76435390-76435412 AGGTTGGGGAGTGGAGGAAATGG + Intronic
1101764336 12:107684222-107684244 GGGTGTGGAAGTGGAGAAGTGGG + Intergenic
1101859290 12:108469548-108469570 TGGTGGGGCAGTGGAGTGGATGG - Intergenic
1102212635 12:111138380-111138402 AGGGGTAGGGGTGGAGGAGAGGG + Intronic
1102301395 12:111774162-111774184 GGGTGGGGGAGTGGGGCAGAGGG + Intronic
1102588956 12:113942966-113942988 AGGGGAGGGAGTGCAGGAGAGGG - Intronic
1102591995 12:113963380-113963402 GTGTGTGGTAGTGGAGTTGAGGG + Intronic
1103445945 12:120995270-120995292 AGTTGAGTGAGTGGAGTGGATGG - Intronic
1103445948 12:120995293-120995315 AGTAGAGGGAGTGGAGTAGATGG - Intronic
1103553286 12:121751179-121751201 AGGTGTGGGTGTGGGGTATGGGG - Intronic
1104178751 12:126357791-126357813 AGGGGAGGGAGGGGAGGAGAGGG + Intergenic
1104370508 12:128219988-128220010 AGGGGAGGGAGTGGAGGGGAGGG + Intergenic
1105322879 13:19345216-19345238 AGGTTTGGGAATGGGGGAGAAGG + Intergenic
1105819778 13:24069971-24069993 AGATGTGGGAGTGCGGTAGAGGG + Intronic
1105843080 13:24272338-24272360 AGGTGAGGGACTGCTGTAGAGGG - Intronic
1106539606 13:30678183-30678205 AGGGGTGGGGGTGGAGGGGAGGG + Intergenic
1106693261 13:32142941-32142963 AGGATTGGGACAGGAGTAGAGGG + Intronic
1106776201 13:33012330-33012352 AGATGTGGGAGTGGAGGGGTGGG + Intergenic
1106900881 13:34353909-34353931 AGGGGAGGGAGTGGAGCACAGGG - Intergenic
1107269195 13:38594348-38594370 AAGTGTGGGAGAGGAGAAGATGG - Intergenic
1107619555 13:42212177-42212199 AGGAATGGGAGGGGAGCAGATGG - Intronic
1108066123 13:46579034-46579056 GGTGGTGGGAGTGAAGTAGAGGG + Intronic
1108358581 13:49649855-49649877 ATGTGTGTGAGTGGAGTATAGGG + Intergenic
1108492693 13:50997225-50997247 AGGAGTAGAAGTGGAGGAGATGG - Intergenic
1108547291 13:51508561-51508583 GGGGGTGTGTGTGGAGTAGAGGG - Intergenic
1108813301 13:54257642-54257664 CAGTGTGGAAGTGGAGGAGAAGG - Intergenic
1109461310 13:62662342-62662364 AGGTATGGGAGTGGATCACATGG + Intergenic
1109664185 13:65508809-65508831 TGGGGTGGGAGTGGATTATAGGG + Intergenic
1110399863 13:75077356-75077378 GGGTGTGAGAGTGGAGAATAGGG - Intergenic
1110424780 13:75354673-75354695 AGGTGTGGGCGTGTAGGGGATGG + Intronic
1110927348 13:81170751-81170773 AGGTATGGCTTTGGAGTAGAAGG - Intergenic
1110935936 13:81289113-81289135 AGGTGTGAGTGAGGAGTTGAAGG + Intergenic
1111041718 13:82757504-82757526 ATGTCTGGGTGTGGAGCAGAGGG - Intergenic
1111979283 13:95000486-95000508 AGGCGTGTGAGTGGAAGAGACGG + Intergenic
1112897914 13:104323782-104323804 TGGGGTGGGAGTGGAGAACAAGG - Intergenic
1112966585 13:105203936-105203958 AGGGGTGGGAGGGTAGGAGAGGG + Intergenic
1114258445 14:21021449-21021471 AGGTGTGGGCATGAAGGAGAGGG + Intronic
1114390266 14:22300472-22300494 AGGTGTGGCAGTGGTGCAGAGGG - Intergenic
1114547536 14:23513555-23513577 GGGTCTGGGAGGGGAGAAGAGGG + Intergenic
1115596333 14:34913083-34913105 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1116802147 14:49454189-49454211 AGGGATAGGAGTGGAGTAAAGGG - Intergenic
1118928537 14:70217066-70217088 GGGTGAGGGAATGGAGTGGAGGG + Intergenic
1119057636 14:71439295-71439317 AGGAGTGGTAGTGAAGAAGACGG - Intronic
1119923407 14:78468860-78468882 TGGTGTGGGAGTGAGGGAGAGGG + Intronic
1120378107 14:83735079-83735101 GGGTCTGGGAGTGAAGGAGATGG + Intergenic
1121202951 14:92135181-92135203 TAGTGAGGGAGTGGAGTAGGTGG + Intronic
1121703262 14:95972814-95972836 AAGTGTTGGACTGGACTAGAGGG - Intergenic
1122093568 14:99355151-99355173 AAGTGTGGGAGTGGAGGACATGG - Intergenic
1122254174 14:100464604-100464626 GGGTGTGGGAGATGAGGAGAGGG - Intronic
1123111052 14:105866980-105867002 AGGTGGGGGAGTGAGGAAGAGGG + Intergenic
1124437746 15:29665065-29665087 AGGTGTGGGAGAGGATGGGAGGG - Intergenic
1125102668 15:35932944-35932966 ATATGTGGGAGTGGAGCAGTAGG + Intergenic
1125310613 15:38374669-38374691 AGGAATGGGAGTGCAGGAGAGGG - Intergenic
1126048295 15:44664384-44664406 AGGTGAGAGACTGCAGTAGAAGG - Intergenic
1126909033 15:53399092-53399114 AGCTGTGGGAGTGGGGTGGGGGG + Intergenic
1127396389 15:58546940-58546962 AGGTGTTGGAGTGGGGGAGGTGG - Intronic
1127682181 15:61308666-61308688 AGGACTGGGGGTGGAGAAGAAGG - Intergenic
1127698025 15:61470757-61470779 AGGTCTAGGAGTGGAGTGGATGG + Intergenic
1127871354 15:63076486-63076508 AGGTGGGGGAGTGGAGGTGCAGG - Intergenic
1128290830 15:66477098-66477120 AGGGGTTGGAGAGGAGGAGAAGG - Intronic
1128682710 15:69663173-69663195 AGGTGTGGTAGTGGAAGAGTCGG + Intergenic
1129326916 15:74805043-74805065 CAGTGTGAGAGTGGAGGAGAGGG + Intergenic
1129608908 15:77038030-77038052 GGGAGTGGGTGTGGAGGAGAGGG + Intergenic
1130017707 15:80200470-80200492 TGGAGTGGGAGTGGGGTGGAGGG + Intergenic
1130069443 15:80634195-80634217 AGGAGTGGGAATGGAGCTGAGGG + Intergenic
1130287898 15:82570962-82570984 AGGTGGGGGAGGGGAGTTAAGGG - Intronic
1130708183 15:86253081-86253103 AGGTGGGGGAGTAGAGTGGGAGG + Intronic
1131074383 15:89486175-89486197 AGGTGTGGGTGTGGAGTGTTAGG - Intronic
1131098748 15:89672034-89672056 AGGTGTGAGAGGGAAGCAGATGG + Intronic
1131868823 15:96740524-96740546 AGGGGAGGGAATGGAGTAGAAGG - Intergenic
1132178238 15:99732813-99732835 AGGCGTGGGCGGGGAGTAGGGGG - Intronic
1132953043 16:2575574-2575596 AGGTGTGGCAGAGGAATCGAGGG + Intronic
1132961308 16:2624594-2624616 AGGTGTGGCAGAGGAATCGAGGG - Intergenic
1133485529 16:6215098-6215120 AGGAGAGGGAGAGGAGTAGAGGG + Intronic
1133696133 16:8264575-8264597 AGAAGTGGGAGTGGAGTGGAGGG + Intergenic
1136106725 16:28035456-28035478 ATGTGAGGGAGATGAGTAGATGG - Intronic
1136191412 16:28617329-28617351 AGGTGTGGGAGTGGGGATCAAGG - Intronic
1136986339 16:35108953-35108975 AGGTGTGGGATTGCTGTAGCTGG + Intergenic
1137244590 16:46691991-46692013 AGTAGCGGGAGTGGAGTAGGGGG - Intronic
1137701825 16:50503067-50503089 AGGGGTGGGGGTGGGGTTGAGGG + Intergenic
1137832617 16:51558366-51558388 AGGGGTAAGAGTGGAGGAGAAGG + Intergenic
1138667707 16:58586282-58586304 AGGTGTGGGGGTGGGGGAGGGGG + Intronic
1139475168 16:67199426-67199448 AGGTGGGGCAGTGGGGCAGATGG - Intronic
1139676294 16:68526258-68526280 AGGGATGGGAGAGGAGGAGATGG - Intergenic
1139956690 16:70696729-70696751 TGGTGTGGGGGTGGGGGAGAAGG - Intronic
1140272647 16:73480537-73480559 AGGTGTGGGGATGGAGTGGCAGG + Intergenic
1140528250 16:75641845-75641867 AGCTGTGGGTGTGGAATTGAGGG - Intronic
1140711422 16:77681478-77681500 AGAAGTGGGAGTGGAGTTCAAGG - Intergenic
1141024090 16:80527828-80527850 AGGTGTAGGGGTGGAACAGAGGG - Intergenic
1141185490 16:81784164-81784186 TGGTATGGGTGTGCAGTAGAGGG + Intronic
1141998395 16:87649051-87649073 GGGTGTGGCAGTGGAGACGAGGG + Intronic
1142287771 16:89178377-89178399 TGATGTGGGAGAGGAGGAGATGG + Intronic
1142411495 16:89919296-89919318 GGCTGTGGGGGTGGAGTTGAGGG - Exonic
1143555149 17:7655266-7655288 TGGGGTAGGAGTGGAGTAGGAGG + Intronic
1143611726 17:8021847-8021869 GGGTGAGGAGGTGGAGTAGATGG - Intergenic
1144877798 17:18411448-18411470 AGGAGGGGGAGGGGAGAAGAGGG - Intergenic
1145154423 17:20532941-20532963 AGGAGGGGGAGGGGAGAAGAGGG + Intergenic
1145281010 17:21467031-21467053 AGGAGAAGGAGTGTAGTAGATGG - Intergenic
1145713778 17:26999882-26999904 AGGTGTGGGAGTTCCTTAGAAGG + Intergenic
1146670845 17:34736489-34736511 AGGAGAGGGAGAGGAGGAGAGGG + Intergenic
1146705503 17:34998170-34998192 TGGTGTGAGAGTGGAGAAGGTGG - Intronic
1147776813 17:42907715-42907737 AGGTGTGGGAGCGGGCTAGGGGG - Intronic
1148454055 17:47801427-47801449 AGGTGTGGGAGTGGCAGAGCTGG + Intergenic
1148454896 17:47805897-47805919 TGGGGTGGGAGTGGGGGAGAGGG + Intergenic
1148749132 17:49934718-49934740 GGGGGTGGGACTGGGGTAGAGGG + Intergenic
1149778515 17:59377742-59377764 AGGTGTGGGAGAGGAGCTTATGG + Intronic
1149779774 17:59388158-59388180 TGGTGTGGGGGCGGAGAAGAGGG - Intronic
1150412454 17:64956637-64956659 AGTTTTGAAAGTGGAGTAGAGGG - Intergenic
1150799439 17:68268986-68269008 AGTTTTGAAAGTGGAGTAGAGGG + Exonic
1150976910 17:70097785-70097807 AGGTGAAGGAGCAGAGTAGAAGG - Intronic
1152301043 17:79495486-79495508 AGGTGGGGGAGGGGTGCAGAGGG + Intronic
1152301056 17:79495514-79495536 AGGTGGGGGAGGGGTGCAGAGGG + Intronic
1152369715 17:79878711-79878733 AGGGGTAGGTGTGGAGCAGAGGG - Intergenic
1152879241 17:82806065-82806087 AAGTGTGGTCCTGGAGTAGAGGG - Intronic
1153944696 18:10008543-10008565 GGGTGGGTGAGTGGAGTAGATGG - Intergenic
1155551667 18:26972021-26972043 AGGTGTGGCAGGGGTGTGGAGGG + Intronic
1155965484 18:32031821-32031843 AGCTGTGGTAGTGGAATAAAAGG + Intronic
1156003946 18:32418368-32418390 AGGTGTGTGGGATGAGTAGAGGG - Intronic
1157617280 18:48994744-48994766 AGGGGTGGGGGAGGAGTAAAGGG - Intergenic
1157915988 18:51664361-51664383 AGGTCTGGGCTTGGAATAGAAGG - Intergenic
1158642980 18:59219486-59219508 GGGTATGGGAGTGGAGAGGAGGG + Intergenic
1160384636 18:78487812-78487834 AGGTGTGGGCGTGGAATCGGAGG - Intergenic
1160819794 19:1052569-1052591 AGGAGTAGGAGGGGAGCAGAAGG + Intronic
1161068367 19:2248976-2248998 AGGTGTGGGCCTGGAGGAGGAGG - Intergenic
1163153364 19:15427664-15427686 AGGTAAGGGAGTGGAGGAGCGGG + Intronic
1163260813 19:16188797-16188819 AGGTGAGGGAATGAAGGAGAAGG + Intronic
1163397741 19:17074099-17074121 AGCTGTGGGGGTGCAGGAGAGGG + Intronic
1164292229 19:23879116-23879138 AGGAGTAGGAGTGGAGAAGAAGG + Intergenic
1164897617 19:31890963-31890985 AGGTCTGGGAGTGGAGAAGTGGG + Intergenic
1166676922 19:44746504-44746526 AGGTCTGAGAGAGAAGTAGATGG - Intergenic
1166925231 19:46262165-46262187 GGGGGTGGAAGTGGAGTAGACGG + Intergenic
1167429018 19:49443621-49443643 AGGTGTGAGGGTGGAGCAGATGG + Intergenic
925075832 2:1014892-1014914 AGGGGTGGGAGTTGAGGAGATGG + Intronic
925465049 2:4099748-4099770 AGGGGTGGGAATGGACTGGAAGG - Intergenic
925507491 2:4584309-4584331 AGGTGGGGGAGTGGAGAAGTGGG - Intergenic
925627252 2:5853534-5853556 ATGTGAGGGAGTAGTGTAGAGGG + Intergenic
925969403 2:9096218-9096240 AAGTGAGGGAGGGGAGGAGAAGG + Intergenic
926048085 2:9724763-9724785 AGATGTGGGAGTGGAACAGCTGG - Intergenic
926094603 2:10073094-10073116 CTGTGTGGGAGTGGTGCAGATGG + Intronic
926237172 2:11054692-11054714 AGGTGTGTGGGTGGGGTGGAGGG - Intergenic
926434129 2:12821442-12821464 AGCTGTGGCAGTGGAGTAGGTGG - Intergenic
926636742 2:15188351-15188373 AGGAGTGGGGGTGGAAGAGAGGG - Intronic
926788568 2:16546028-16546050 AGGTGTGGGACTAAAGAAGAAGG + Intergenic
927053267 2:19349965-19349987 AGGTTTGCGGGTGGTGTAGACGG - Intergenic
928205065 2:29278155-29278177 GGGTGTGGGAGTGCAGTGCAGGG + Intronic
928320476 2:30279238-30279260 AGGGGTGGGAGGGTAGAAGAGGG - Intronic
929535833 2:42783660-42783682 AGGTGTGGGAGAGCAGGAAAAGG + Intronic
929774862 2:44923222-44923244 AGGAGTGGGTAGGGAGTAGAGGG - Intergenic
930084105 2:47480324-47480346 AGGTAAGGGAGGGGAGGAGAGGG - Intronic
934011733 2:87826533-87826555 ATGTGGGGGAGTGAAGTAGGAGG + Intergenic
934522198 2:95026484-95026506 CGGGGTGGGGGTGGAGGAGATGG + Intronic
934614698 2:95763906-95763928 AGCTGTGGGAGTTGTGGAGATGG + Intergenic
934646206 2:96060589-96060611 AGCTGTGGGAGTTGTGGAGATGG - Intergenic
934734993 2:96685629-96685651 GGGTGTGGGTGTGGGGTAGCAGG - Intergenic
934839609 2:97616672-97616694 AGCTGTGGGAGTTGTGGAGATGG - Intergenic
935115943 2:100136312-100136334 AGATGTGGGAGAGGTGGAGAAGG + Intronic
936134806 2:109881525-109881547 GGGGGTGGGAGGGGAGTTGATGG - Intergenic
936209891 2:110489960-110489982 GGGGGTGGGAGGGGAGTTGATGG + Intergenic
936429082 2:112445215-112445237 GGGGGTGGGAGGGGAGTTGATGG + Intergenic
936556425 2:113501809-113501831 AGCTGGGGGTGGGGAGTAGATGG - Intergenic
937071248 2:119065417-119065439 AGGTTTGGGGGTGGTGAAGATGG - Intergenic
937670581 2:124533513-124533535 TGATGTGGGTGTGGAGGAGAGGG + Intronic
937894627 2:126969408-126969430 TGGGGTGGGAGTGGGGTTGATGG + Intergenic
937943106 2:127304781-127304803 AGGTGTGGGGGTGGAGGGTATGG - Exonic
938250588 2:129812890-129812912 AGGTGTGGGAGGGGAGGAAGAGG - Intergenic
938746981 2:134288835-134288857 AGGTGTGGGAGTAGGGGAGAGGG - Intronic
939723164 2:145680392-145680414 AGGTGTCCCAGTGGAGAAGAGGG - Intergenic
940666422 2:156616056-156616078 GGGTGTGGCAGTGGAGAACAGGG + Intergenic
940669348 2:156648834-156648856 AGGAGTGGGAGGGGAGGGGAGGG - Intergenic
940900159 2:159119342-159119364 AGGTGGGGGAGTTGGGAAGATGG + Intronic
941291298 2:163678918-163678940 ATGTGTGTGAGTGGGGTAGTAGG - Intronic
942439888 2:176021432-176021454 AAGTCTGGGAGTGGAGTAATTGG + Intergenic
944260372 2:197669532-197669554 AGATGTGGGTGGGGAGTGGACGG + Intronic
944306538 2:198186233-198186255 GGGGGTGGGAGTGGGGGAGAAGG - Intronic
944580371 2:201126990-201127012 GGGTGTGGGTGTGGAAAAGAAGG + Intronic
944780912 2:203015453-203015475 TGGGGTGGGGGTGGAGTAGTTGG - Intronic
945128162 2:206536432-206536454 AGGGGTGGGAGTGGGGTGGTGGG + Intronic
946713784 2:222532603-222532625 AGGTGTGGGAAGGGAGGAGCTGG - Intronic
947009189 2:225547089-225547111 TTGTGTGGGAGGGGAGGAGAGGG - Intronic
947138301 2:226996706-226996728 ATCTTTGGGAGTGGAGTACATGG + Exonic
947817626 2:233048709-233048731 AGGAGTGGGTGGGGAGGAGAGGG + Intergenic
948145218 2:235703540-235703562 AGGAGGGGGAGGGGAGAAGAGGG - Intronic
948433916 2:237939249-237939271 AGGGGTGGGGGTGGAGGGGATGG + Intergenic
948586567 2:239023714-239023736 AGCTGTTGGAGTGGAGGAAAGGG - Intergenic
948813564 2:240498471-240498493 AGCTGTGGGGGTGGAGCTGAGGG + Intronic
948813576 2:240498506-240498528 AGCTGTGGGGGTGGAGCTGAGGG + Intronic
948813587 2:240498540-240498562 AGCTGTGGGGGTGGAGCTGAGGG + Intronic
1169069378 20:2713630-2713652 AGGTTTGTCAGTTGAGTAGAAGG + Intronic
1169282481 20:4279478-4279500 AGGTGCAGGAGTGGAGTGGGTGG - Intergenic
1169933648 20:10859781-10859803 ATGAGTGCGAGTGGAGAAGAGGG - Intergenic
1170588540 20:17753666-17753688 AGGGTAGGGAGGGGAGTAGAAGG - Intergenic
1171420203 20:25012773-25012795 AGGTGTAGGAGTGAAGGAGGAGG + Intronic
1172550411 20:35794691-35794713 AGCTCTGGGACAGGAGTAGAGGG - Intronic
1172993013 20:39049898-39049920 GGGGGTGGGACTGGACTAGAAGG + Intergenic
1173396785 20:42687695-42687717 AGGTGGGGGAGGGGAGTGAAGGG - Intronic
1173430409 20:42982745-42982767 GGGTGTGGGAGAGGAGCAGAGGG - Intronic
1173465214 20:43275518-43275540 AGATCAGGGAGTGGAGTAGGGGG - Intergenic
1173850350 20:46213968-46213990 AGGTGTGGGAGTGCTGATGAGGG + Intronic
1173855121 20:46245359-46245381 AGAGGAGGGTGTGGAGTAGAGGG - Intronic
1174089528 20:48035988-48036010 AGGTGTGGGAGTGGGGAGAATGG + Intergenic
1175132509 20:56800275-56800297 AGGTGTGAGTGTGGAGGAAATGG - Intergenic
1175364512 20:58443098-58443120 AGTTGTGGCAGTGGAGGTGAAGG + Intronic
1175569923 20:60010714-60010736 AGGTTGGGGAGAGGAGGAGATGG + Intronic
1175893583 20:62326263-62326285 AGCTGTGAGAGGGGAGAAGACGG + Intronic
1176890003 21:14304005-14304027 GGGGGTGGGAGCGGAGCAGAAGG - Intergenic
1177628061 21:23690349-23690371 AGGTGTAGCAGTGGAGCAAAAGG - Intergenic
1177853568 21:26377139-26377161 AGGTCTGGAGGTGGAGTAGGTGG - Intergenic
1178538849 21:33432575-33432597 AGGTGAGGGTGGGGGGTAGAGGG + Intronic
1179982993 21:44906074-44906096 AGGTGTGGTGGTGCAGCAGATGG - Intronic
1179983463 21:44908259-44908281 AGGGGAGGGGGTGGAGAAGAAGG - Intronic
1180785053 22:18542502-18542524 AGGTGAGGAAGAGGAGGAGATGG - Intergenic
1180842474 22:18965781-18965803 AGGAGTGGGTGGGGAGTGGAAGG - Intergenic
1181059012 22:20273075-20273097 AGGAGTGGGTGGGGAGTGGAAGG + Intronic
1181112272 22:20609218-20609240 AGGGGTGAGACTGGAGGAGAAGG - Intergenic
1181128636 22:20716535-20716557 AGGTGAGGAAGAGGAGGAGATGG - Intronic
1181241956 22:21481856-21481878 AGGTGAGGAAGAGGAGGAGATGG - Intergenic
1181442823 22:22945891-22945913 AGGTGTAGGAATTGAGAAGATGG - Intergenic
1181516717 22:23418307-23418329 AGCTGTGGGAGCAGAGCAGAGGG - Intergenic
1181571770 22:23771814-23771836 AGGTGTCTGAGTGGAGTACTGGG - Intronic
1182572277 22:31248333-31248355 AGGGGTGGGACTGAAGAAGAAGG + Intronic
1183498057 22:38161690-38161712 AGGTGTGTGCATGGGGTAGAGGG + Intronic
1183567339 22:38625065-38625087 AGGTGGGGGAGGGGACTAGGAGG + Intronic
1185156849 22:49198190-49198212 AGGTGAGGGAGGGGAGTACGGGG + Intergenic
949375905 3:3390259-3390281 AGGTTTGAGAATGGAGGAGAAGG - Intergenic
949442803 3:4101480-4101502 AGATCTGGGGGTGGAGAAGATGG + Intronic
950533453 3:13566445-13566467 AGGTGGGGGCATGGAGGAGATGG - Intronic
950817874 3:15726078-15726100 AGATGGGGGAATGGAGTAGTTGG - Intronic
951598895 3:24350332-24350354 AGGTTTGGGAGTGAAGTTGCTGG - Intronic
952378912 3:32789365-32789387 AGGTGTAGGAGTGGATAAGAGGG + Intergenic
952534791 3:34298015-34298037 AGGAGTGGGAGGGGAGCATATGG + Intergenic
953715143 3:45311301-45311323 GGGTTTGGGCGGGGAGTAGAGGG + Intergenic
953747366 3:45585463-45585485 AGATGTGGGTATGGAGTAGGTGG - Intronic
953882132 3:46696075-46696097 GGGTGTGGGAGTGGTGTGGGTGG - Intergenic
953896039 3:46802490-46802512 ATATGTGGGAGTGGAATGGATGG - Intronic
954115867 3:48466557-48466579 AGGGGAGGGAGTGGGGTAGGGGG - Intronic
954992171 3:54850878-54850900 ATATGTGGGAGTGGATGAGATGG + Intronic
957310229 3:78509670-78509692 ATGTGTTGCAGTAGAGTAGATGG - Intergenic
957472542 3:80678063-80678085 AGGTGGCAGAGTGGAGTAAAAGG + Intergenic
957862246 3:85969087-85969109 AGGTGTGGGAGTGTGGAACAAGG - Intronic
958112822 3:89172032-89172054 TGGTGGGGGAGTAGAGAAGAAGG - Intronic
958265509 3:91433259-91433281 AGGTGAGGGACTGGAGGAGGGGG - Intergenic
958694819 3:97513677-97513699 GGGGGTGGGAGTGGGGTAGGGGG + Intronic
958709901 3:97705268-97705290 AGGTGTGAGAGAGGAGGGGATGG - Intronic
959084100 3:101833345-101833367 GGGTGTGGAAGGGGAGGAGAAGG - Intronic
960576214 3:119232570-119232592 AGATGTGGGAGAGAGGTAGAAGG - Intronic
960611244 3:119556660-119556682 AGGTGTGAGAGAGAGGTAGAGGG - Intronic
960975950 3:123174189-123174211 AGGTGGAGCAGTGGAGCAGAGGG + Intronic
961431819 3:126889137-126889159 TGGTGTCGGGGTGGACTAGAAGG + Intronic
961486985 3:127223513-127223535 AGATGTGGGAGGGGTGCAGACGG + Intergenic
961541748 3:127604830-127604852 GAGTCTGGGAGGGGAGTAGAAGG + Intronic
961714790 3:128850851-128850873 AGGTGTGGGGGTGGGAAAGAGGG - Intergenic
962278032 3:134030255-134030277 AGGTGGGTGAGTGGAGGGGATGG + Intronic
962338311 3:134558803-134558825 GGGTGTAGGAGTGGAGGTGAGGG - Intronic
962464102 3:135640919-135640941 AGCAGCTGGAGTGGAGTAGAGGG - Intergenic
962685079 3:137839837-137839859 CGGGGTGGGGGTGGAGTGGATGG + Intergenic
962747111 3:138405051-138405073 AGCCGTGGGAGTGGAGAGGATGG - Exonic
964118785 3:153161938-153161960 AGCTGTGGGAGTGGTGGACAAGG - Intergenic
964302291 3:155302001-155302023 ATGTGTGTGATTGGACTAGATGG - Intergenic
964620391 3:158715382-158715404 AGGTGTGGGAGTGGGATGTAGGG + Intronic
965793548 3:172414188-172414210 AAGTGTAGGAATGGAGAAGAGGG + Intergenic
966223178 3:177570517-177570539 ACTTGTGTGAGTGGAGTGGAGGG + Intergenic
966239499 3:177740572-177740594 AGGTGTGAGAGTGGGGGAGATGG + Intergenic
967980308 3:195061484-195061506 TGGTGTGGGATTGTAGTACAAGG + Intergenic
968571126 4:1341271-1341293 TGGTGTGGATGTGGAGCAGATGG - Intergenic
969328193 4:6456027-6456049 AGGTGTGTGGGTGGGGTAGGGGG - Intronic
969370323 4:6727648-6727670 AGGAGGGGGAGGGGAGGAGAAGG - Intergenic
969642337 4:8406339-8406361 AGGAGTGGGTGTGGGGAAGAGGG + Intronic
970756083 4:19428734-19428756 AGGTGAGTGAGTGCAGGAGATGG + Intergenic
971073752 4:23124984-23125006 TGGTGTGGGTGTGAAGGAGATGG + Intergenic
971751100 4:30649176-30649198 AGATCTGAGAGTGGAGTAGAAGG - Intergenic
972789485 4:42357298-42357320 AGGGGAGGGAGGGGAGAAGAAGG + Intergenic
972790267 4:42364991-42365013 AGGAGAGGGAGGGGAGAAGAGGG - Intergenic
972871264 4:43301847-43301869 TGGTGTGGGTGTGGAGAAAAGGG - Intergenic
972959166 4:44430841-44430863 AGGTGGGGAGGTGGAGTAAAAGG - Intronic
974003349 4:56532010-56532032 AGGTGTAGGAAGCGAGTAGATGG - Intronic
975288716 4:72651070-72651092 AGTTTTTGGAGTGGAGTAGAAGG + Intergenic
975640588 4:76496175-76496197 AGGTGTGTGAGTGAATTGGAGGG + Intronic
975740363 4:77423713-77423735 AGGTGTTGGTGTTGAGTACACGG - Intronic
976117114 4:81739605-81739627 AGGGGCAGGTGTGGAGTAGAAGG + Intronic
978130988 4:105196989-105197011 AGGTGTGGGAGTCGAGTAGTTGG + Intronic
978563173 4:110054831-110054853 AGGGAGGGGAGTGGAGTGGAGGG + Intronic
979551554 4:121996841-121996863 AGGTGTGGGATGGGAGCAGATGG - Intergenic
980969958 4:139558430-139558452 ACGTGTGGGAGTGAAGGAGAGGG + Intronic
980990572 4:139735432-139735454 AGGGCTGGGAGTGGGGTAGGGGG + Intronic
981254393 4:142644272-142644294 AGGAGTGGGGGAGGAGGAGAAGG + Intronic
981647749 4:147019286-147019308 AGGTGTGGAAGTGGACCAGCTGG + Intergenic
981774921 4:148355444-148355466 CAGTGTGGGAGTGGGGTAGAGGG - Intronic
984200963 4:176720795-176720817 AGGTGGGGGAGTGCAGTGGCAGG - Intronic
985236805 4:187884042-187884064 AGGTGTGGGGGTGCAGTCAAGGG - Intergenic
985957805 5:3277537-3277559 AGGGGAGGGAGGGGAGAAGAGGG + Intergenic
986227903 5:5834067-5834089 AAGGGTGGGAGTGGAGGTGAGGG + Intergenic
986752128 5:10796685-10796707 AGGTCTGGGGGTGGGGTACAGGG - Intergenic
988642881 5:33060809-33060831 AGGTGTGGGTGAGTAGTGGAAGG + Intergenic
988798375 5:34673739-34673761 AGGGGTGGGAATGGGGTTGAGGG - Intronic
989478829 5:41904466-41904488 TGGTGAGGGAGCGGAGGAGAGGG + Exonic
990457959 5:56005958-56005980 AGGGGTGGGGGTGGGGTAGGGGG + Intergenic
990727098 5:58768085-58768107 AGGAATGGGGCTGGAGTAGAAGG + Intronic
990782895 5:59386072-59386094 AGGTGTGAGAATGGAAGAGAAGG - Intronic
990907638 5:60820819-60820841 AGGGGAGGAAGTGGAGTTGAAGG - Intronic
991250531 5:64556019-64556041 AGGTGTAGAAGTAGAGTTGATGG + Intronic
991291578 5:65038032-65038054 AGGTGAGGAAGTGGGTTAGAGGG - Intergenic
991922743 5:71672970-71672992 TGGTGAGGGTGTGGAGAAGAGGG - Intergenic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG + Intronic
994838208 5:104884800-104884822 GGGTGCGGGAGTGGGGTAGGTGG + Intergenic
995561462 5:113386449-113386471 AGGTGGGGGAGGGGAGTGCAGGG - Intronic
995821336 5:116236680-116236702 GGGGGTGGGAGATGAGTAGATGG + Intronic
996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG + Intergenic
997192304 5:131948462-131948484 AGATTTGGAAGTGGAGTAGGGGG - Intronic
997308651 5:132860711-132860733 ACCTGTGGGGGTGGAGTGGAGGG + Intergenic
997359793 5:133287804-133287826 ATGTGTGTGATTGGAGTAAAGGG - Intronic
997691766 5:135832141-135832163 AGGTGGAGGTGTTGAGTAGAGGG + Intergenic
998155932 5:139787297-139787319 GGGCGTGGGGGTGGAGTGGAGGG - Intergenic
998403935 5:141863139-141863161 AGGTGTGGGAGTGATGGAGCAGG - Intronic
998786253 5:145711987-145712009 GGGTTTGGGATTTGAGTAGAGGG - Intronic
999112934 5:149137812-149137834 AGGTGTGGGAATGGTGGGGAGGG - Intergenic
999498798 5:152126044-152126066 GGGGGTGGGAGTGGAGCAGAGGG - Intergenic
999789456 5:154925289-154925311 AAGTGGGGGACTGGAGTGGAGGG + Intronic
999925705 5:156374008-156374030 AGGGGCGGGAGTGGAGTCAACGG + Intronic
1000360812 5:160445389-160445411 GGGTGTGGGAGGGGAGGATAGGG + Intergenic
1001198832 5:169697775-169697797 AGAAGTGGGAGTGTAGGAGAGGG - Intronic
1001232973 5:170005568-170005590 AGGTGTTGGTGGGGAGAAGAGGG + Intronic
1001438291 5:171718164-171718186 AGGTGGGGGAGGGGTGTGGAGGG - Intergenic
1001655416 5:173345231-173345253 AGGTTGGGGAGGGGAGTGGAGGG - Intergenic
1001704360 5:173731047-173731069 ATGTGTGGGAGGGCAGGAGATGG - Intergenic
1002190872 5:177476887-177476909 AGGTCTGGGAGTGGAGTCGGGGG + Intergenic
1002702267 5:181132743-181132765 AGAGGTGGGTGGGGAGTAGACGG + Intergenic
1003142536 6:3483288-3483310 AGGTGAGGGAGTGGAGATTAGGG + Intergenic
1003350635 6:5314342-5314364 GTGTGTGGGGGTGGAGGAGAGGG + Intronic
1004162760 6:13229473-13229495 GGGGGTGGGAGTGGAGGTGAGGG - Intronic
1004279439 6:14268507-14268529 AAGTGTTGGAGGGGAGGAGAAGG + Intergenic
1005765210 6:29004779-29004801 GGGAGTGGGAGAAGAGTAGAAGG - Intronic
1005847151 6:29790985-29791007 AGGTGAGGAAATGGAGCAGAGGG + Intergenic
1005875106 6:30005342-30005364 AGGTGAGGAAAAGGAGTAGAGGG + Intergenic
1006748262 6:36360455-36360477 AGGGGTGGGGGTGGAATTGAGGG - Intronic
1007117329 6:39352176-39352198 AGGTGGGGAAGAGGAGTATAAGG - Intronic
1007322553 6:41038251-41038273 AGGTGGGGGTGTGGTGTAGTGGG - Intronic
1007371356 6:41428444-41428466 GGGTGGGGGTGTGGGGTAGAGGG - Intergenic
1007394675 6:41570670-41570692 AGGTGAGGGAGGGAAGAAGAGGG - Intronic
1007430374 6:41773043-41773065 AGGCCTGGGACTGGAGTTGAGGG - Intronic
1008989856 6:57589397-57589419 AGGTGAGGGACTGGAGGAGGGGG + Intronic
1009178439 6:60487941-60487963 AGGTGAGGGACTGGAGGAGGGGG + Intergenic
1010256609 6:73765286-73765308 AGCTGTGGGAGTGGAGAGGATGG + Intronic
1010709815 6:79161029-79161051 AGGTATGGGAGTACAGAAGAAGG - Intergenic
1010840464 6:80643754-80643776 GGGTGTGGGAGTGGGGGAGAGGG - Intergenic
1012750295 6:103152820-103152842 AGGTGGGGGAATGGAGCACAAGG + Intergenic
1013015283 6:106155414-106155436 AGGTGTGGAAGGGAAGTAAAAGG - Intergenic
1013649755 6:112182630-112182652 AGGAGTAGAAGTGGAGGAGATGG + Intronic
1014058853 6:117047984-117048006 AGATGTGGCTCTGGAGTAGATGG - Intergenic
1014105137 6:117552728-117552750 ATGTGTGGGAGTGGTTTAAATGG - Intronic
1015410923 6:132892977-132892999 AGGTATGGTAATGGAGTGGATGG - Intergenic
1015676190 6:135752327-135752349 TGGTGTGGGTGTGGAGAAAAAGG + Intergenic
1016376864 6:143430224-143430246 GAGTGTGCGAGTGGAGTGGAGGG - Intronic
1016420815 6:143881077-143881099 ATGAGTGGGAGTGGGGTGGAAGG - Intronic
1016861391 6:148722000-148722022 GGGAGAGGGAGTGGAGAAGAAGG - Intergenic
1017408697 6:154147075-154147097 AGGTGGGGAAGGGGAGCAGAAGG + Intronic
1017788294 6:157774228-157774250 AGGTGGAGGAGTGGAGGAGGTGG + Intronic
1017788301 6:157774245-157774267 AGGTGGGGGAGTGGAGGAGGTGG + Intronic
1018373718 6:163191720-163191742 CTGAGTGGGAGTGGAGAAGATGG - Intronic
1018531516 6:164768839-164768861 AAGGGTGGGAGAGGAGTGGAGGG - Intergenic
1018942835 6:168320557-168320579 ATGTGTGGGGGTGCAGGAGAGGG - Intergenic
1018974427 6:168554516-168554538 AGGGGTGGGGGTGGAGAGGAGGG + Intronic
1021025217 7:15658362-15658384 CGGTGTTTGACTGGAGTAGAGGG + Intronic
1021585342 7:22201830-22201852 AGGTTTGGGAGTGGGATGGAGGG + Intronic
1021919983 7:25475158-25475180 AGGTTGGTGAGTGCAGTAGATGG + Intergenic
1023242958 7:38168527-38168549 AGGGGTGAGAATGGAGGAGAAGG - Intergenic
1023632710 7:42179744-42179766 AGGTGAGGGAGTGGGGAATATGG + Intronic
1023900701 7:44476293-44476315 AGGTGTGTGAGTGCTATAGAAGG + Intronic
1024076213 7:45819101-45819123 AGGGGTTGGAGAGGAGCAGAAGG + Intergenic
1024755936 7:52531423-52531445 AGGTGTGGCAGTGATGTACAGGG - Intergenic
1024869661 7:53948406-53948428 AGGAGTGGGAGAGGACTGGAAGG + Intergenic
1025059992 7:55797932-55797954 GGGAGTGGGAGGGGAGTAGGAGG - Intronic
1026452763 7:70543801-70543823 AGGTATGGGAGTGCTGTAGTAGG + Intronic
1026487606 7:70834948-70834970 AGGTGGGGGAGTGGGGGAGCAGG + Intergenic
1027224160 7:76233599-76233621 AGGTGTGGGAGTGGAAAAGAGGG + Intronic
1028342608 7:89740685-89740707 AGGTGTGTTAGGGGAGGAGATGG - Intergenic
1028394134 7:90348629-90348651 AGGGGTGGGGGTGGAGGAGGTGG + Intronic
1028713136 7:93933877-93933899 ATATGTGGGAGTGGGGTTGAAGG + Intergenic
1029347569 7:99989646-99989668 AGGTGTGGGGCAGGAGGAGAGGG + Intergenic
1030349383 7:108466803-108466825 AGGTGTGGGGGTGCATTTGAAGG - Intergenic
1030557346 7:111043064-111043086 TGGAGTGGGAGTGTAGTATATGG - Intronic
1031671520 7:124552986-124553008 AGGTGGGTGAGTGGAGTTTAGGG + Intergenic
1031791376 7:126109047-126109069 TGGTGAGGGTGTGGAGTAAAAGG + Intergenic
1033275217 7:139966862-139966884 AGGGGTGGGGGAGGGGTAGAAGG - Intronic
1033362417 7:140647037-140647059 AGGTGTGGGATAGGAGTGGGAGG + Intronic
1034053804 7:148013133-148013155 TGGTGTGGGGGTGGAGAAAAAGG - Intronic
1034337461 7:150332795-150332817 AGGTGTGGGAGTGGGGTGGTGGG + Intronic
1034422213 7:150996004-150996026 AGGGGTGGGATGGGAGCAGAGGG - Intronic
1034775881 7:153826187-153826209 GTGTGTGGGATTGGAGTAGATGG + Intergenic
1034857310 7:154563722-154563744 AGGTGTGGGAGTGGAGTAGAAGG + Intronic
1034994471 7:155569579-155569601 AGGTGTGAGAGTGGAGGGGCTGG - Intergenic
1035035710 7:155892597-155892619 TGGTGTGGAAGTGGTGAAGATGG + Intergenic
1035035741 7:155892731-155892753 TGGTGTGGAAGTGGTGAAGATGG + Intergenic
1035074308 7:156168500-156168522 AAGTATTGGAGTGGAGTGGACGG - Intergenic
1035615852 8:1000851-1000873 AGGTGTGGGGGGAGAGGAGAGGG + Intergenic
1035666984 8:1386550-1386572 AGATGTGAGAGTGGAGTAAGAGG + Intergenic
1036642681 8:10593853-10593875 TGGGGTGGGGGTGGAGTAAATGG - Intergenic
1036784530 8:11677182-11677204 AGGTGGGGGAGGGGAGGGGAAGG + Intronic
1037459815 8:19097491-19097513 ATGTGTTGGAGTGGAGCAGAAGG - Intergenic
1037534321 8:19810703-19810725 AGGTCTAGGAGAGGAGTAGGTGG + Intergenic
1037733020 8:21545088-21545110 GGTTCTGGGAGTGGAGGAGATGG - Intergenic
1037790499 8:21935686-21935708 TGGTGTAGTAGTGTAGTAGAAGG + Intronic
1037838588 8:22228736-22228758 AGGGGTGGGGGTGGAGAGGACGG + Intronic
1038477926 8:27881520-27881542 AGATGGGGGAGGGGAGAAGAGGG + Intronic
1039232031 8:35459017-35459039 ATGTGTGGGAGTGGAGGTCAAGG - Intronic
1039435358 8:37556173-37556195 AAGTGTGGGTGTGGAGGGGAAGG - Intergenic
1039436642 8:37564105-37564127 AGGTGTGGCTGTGGAGGAAATGG - Intergenic
1039509693 8:38081096-38081118 AGGTGGGGGAGTGGAGAGGGAGG - Intergenic
1040770525 8:50970028-50970050 GGGTGTGGGAGTGGTGGGGAGGG - Intergenic
1040790606 8:51224465-51224487 GGGCATGGGAGTGGAGGAGAGGG - Intergenic
1042231666 8:66561403-66561425 AGGTTAGGGAGTGAAGGAGAAGG + Intergenic
1042299280 8:67258979-67259001 AGATATGGGAGTAGAGTATATGG - Intronic
1042872146 8:73408988-73409010 AGGTGTGTGTGTGTGGTAGAGGG - Intergenic
1043647659 8:82541272-82541294 TGGTGAGGGAGAGGAGAAGATGG + Intergenic
1044972955 8:97637809-97637831 TGGTGAGGGAGTGAAGAAGAGGG - Intergenic
1045491283 8:102671282-102671304 AGGAGTGGGAGAGGAGAAGTGGG - Intergenic
1046031224 8:108785948-108785970 AGGTGTGTGTGTGGAGGAGTGGG - Intronic
1046895124 8:119463767-119463789 AGCGGTGGGAGTGGGGGAGATGG - Intergenic
1047727676 8:127698270-127698292 AGGTCTGGGGGTGGAGTGGGAGG - Intergenic
1048010667 8:130452898-130452920 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1048842367 8:138577249-138577271 ATGGGTGGGATTGGAGTAGATGG - Intergenic
1048887883 8:138923198-138923220 AGGTGTGGGTCTGGAGGGGAGGG - Intergenic
1048971770 8:139649093-139649115 AGGTGTGGGAGGGGAGGCCACGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049337596 8:142094654-142094676 AGGTGTGGGAGCGGAGGAGCAGG - Intergenic
1049896596 9:115528-115550 AGCTGGGGGTGGGGAGTAGATGG + Intergenic
1049913656 9:295274-295296 GGGTCTGGGAGTGGGGAAGAGGG + Intronic
1051642740 9:19238573-19238595 AGGAGGGGGAGGGGAGGAGAGGG - Intronic
1052209864 9:25891582-25891604 AGGTGTGAGTGTGGAGGGGAGGG - Intergenic
1052273167 9:26648957-26648979 AGGTGGGGGAGTGGAGGGAAGGG - Intergenic
1053436417 9:38078058-38078080 AGGTGAGGGTGTGGAGAAAAGGG - Intergenic
1053739219 9:41123485-41123507 AGGAGTGGGAGTGGAGGTGGTGG - Intergenic
1053739702 9:41125766-41125788 AGCTGGGGGTGGGGAGTAGATGG + Intergenic
1054688649 9:68305554-68305576 AGCTGGGGGTGGGGAGTAGATGG - Intergenic
1054689133 9:68307837-68307859 AGGAGTGGGAGTGGAGGTGGTGG + Intergenic
1055086924 9:72323876-72323898 AGGAGTCAGAGTGGAGGAGAGGG - Intergenic
1055640413 9:78315011-78315033 AGGTGTGGGAGAGGAGCAGTTGG + Intronic
1056531593 9:87492914-87492936 AGGTGTGGGAGAGGTGCAGGGGG + Intergenic
1056578954 9:87876546-87876568 GGGTGGGGGGATGGAGTAGAAGG - Intergenic
1057483306 9:95462621-95462643 AGGAGAGGGGGTGGAGGAGAAGG + Intronic
1057770812 9:97966319-97966341 ACCTGTGGGAGGGGAGTAGGTGG - Intergenic
1057961851 9:99464759-99464781 AGAGGTGGGGGTGGAGTAGGGGG + Intergenic
1058421716 9:104838889-104838911 AGCTGGGGGAGAGGAGGAGATGG + Intronic
1058611259 9:106778317-106778339 AGGTGTGGGAGTTGAGTTTATGG - Intergenic
1058936199 9:109771893-109771915 TGGGGTGGGAGGGGAGGAGAGGG - Intronic
1060473898 9:123970934-123970956 AGGGAGGGGAGAGGAGTAGAGGG - Intergenic
1062278303 9:135740899-135740921 AGGGGTGGGAGGGGAGGGGAGGG - Intronic
1185870928 X:3664194-3664216 TGGTGTGGAAGTGGAGGAAAGGG - Intronic
1187357981 X:18596318-18596340 AGGTGTGGGGGTGGAGGTGGGGG + Intronic
1187567644 X:20467737-20467759 AGGTGTGTGAGTGGAGAGGTGGG + Intergenic
1187737675 X:22321532-22321554 TGGTGTGAGGGTGGAGGAGAAGG - Intergenic
1190260400 X:48793543-48793565 AGGTGGGGGAGAGGAGAGGAAGG - Intronic
1190463809 X:50705779-50705801 GGGTCTGGGTGTGGAGTAGGGGG - Intronic
1191031596 X:55979739-55979761 TGCTGTGGGAATGGAGAAGAAGG + Intergenic
1191672432 X:63760698-63760720 AGGTGAGGGGGAGGAGGAGAAGG + Intronic
1191790785 X:64969880-64969902 AGGGGTGGGGCTGGAGTTGAGGG + Intronic
1192151426 X:68715099-68715121 AGGTCTGGGAGAGGCCTAGAGGG - Intronic
1192211513 X:69130836-69130858 AGGGGTGGTGGTGGGGTAGAAGG - Intergenic
1192246174 X:69373512-69373534 TGGAGTGGGAGAGGAGGAGAGGG - Intergenic
1192771554 X:74197146-74197168 TGGTGAGGGTGTGGAGAAGAGGG - Intergenic
1192773724 X:74220538-74220560 AGGAGTGGGAGTGGCGAAGAGGG - Intergenic
1193677383 X:84472408-84472430 AGGTGTTGCAGTGAAGTACATGG - Intronic
1194887824 X:99339519-99339541 AAGGGTGGGAGTGGGGTTGAGGG + Intergenic
1195626152 X:107007102-107007124 GGGGGTGGTAGTGGAGCAGAGGG - Intergenic
1195707222 X:107746296-107746318 AGGTCTGGGAGTGCAGAAAAGGG + Intronic
1196103718 X:111873958-111873980 AGGTGTAGGAGTGTGGTGGATGG - Intronic
1196947346 X:120840987-120841009 AGCAGTGGGAGAGAAGTAGAAGG - Intergenic
1197770836 X:130088261-130088283 GGGTCTGTGAGTGGAGGAGATGG + Intronic
1198100273 X:133416176-133416198 GGGGGTGGGAGTGGCGTCGAGGG - Intergenic
1198103719 X:133443246-133443268 CGGAGTGGAAGTGAAGTAGAGGG + Intergenic
1198114118 X:133528481-133528503 AGGGGTGGGAAGGGAGGAGAGGG - Intergenic
1198127175 X:133656991-133657013 TGGTGGGGGAGTGGACGAGATGG - Intronic
1198611189 X:138402444-138402466 AGGTGAGGGAAAGGAGGAGAAGG + Intergenic
1199132751 X:144212014-144212036 ATGTGGGGGAGTGAAGTAGGAGG - Intergenic
1199764717 X:150932686-150932708 AGGTGTGGGGGTGGGGCAGGAGG + Intergenic
1200280199 X:154770697-154770719 TGGTGTGGGAGTGGGGTGGAGGG + Intronic
1201110695 Y:10797213-10797235 ATGGATGGGAGTGGAGTGGAGGG - Intergenic
1201120540 Y:10869410-10869432 ACGTGTTGGAGTAGAGTGGAGGG - Intergenic
1202189121 Y:22222802-22222824 TGGTGAGGGAGTGCAGTGGAGGG + Intergenic