ID: 1034857358

View in Genome Browser
Species Human (GRCh38)
Location 7:154564084-154564106
Sequence CTCGAAGCCCTGACTGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034857358_1034857361 13 Left 1034857358 7:154564084-154564106 CCAGGTACAGTCAGGGCTTCGAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1034857361 7:154564120-154564142 GGTCATCTGTGTCAAGTAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 113
1034857358_1034857360 -8 Left 1034857358 7:154564084-154564106 CCAGGTACAGTCAGGGCTTCGAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1034857360 7:154564099-154564121 GCTTCGAGGAGTAGAGAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034857358 Original CRISPR CTCGAAGCCCTGACTGTACC TGG (reversed) Intronic
902382206 1:16058038-16058060 CTGGGAACCCTGCCTGTACCTGG - Exonic
903968273 1:27102928-27102950 CTCGAAGCCTTGCCTGTGTCCGG + Intronic
904247640 1:29199099-29199121 GTCGCAGCCCTCTCTGTACCTGG + Intronic
905087532 1:35395131-35395153 CCAGAAGCACTGACTTTACCTGG - Intronic
905732203 1:40304829-40304851 CTCGAGGCCCTGGCTCTCCCTGG + Exonic
908160081 1:61398283-61398305 CTCAAGGCCCTGACTAGACCAGG - Intronic
908581439 1:65521353-65521375 CTCAAAGGCCTGACAGAACCAGG + Intronic
909150669 1:71999700-71999722 CTCGGAGCCTTGACTTTACATGG + Intronic
910757207 1:90706539-90706561 CCTGAAGCGCTGTCTGTACCCGG + Intergenic
913444659 1:118937926-118937948 CAGGCAGCCCTGTCTGTACCAGG + Intronic
920298769 1:204975845-204975867 CTCTCAGCCCTGACTGAACCTGG + Intronic
921436294 1:215127191-215127213 CGTGAAGCACTGCCTGTACCAGG - Intronic
1062805688 10:417919-417941 ATCGAAGCCCTGACAGGAACAGG - Intronic
1062805717 10:418033-418055 ATCGAAGCCCTGACAGGAACAGG - Intronic
1062805759 10:418216-418238 ATCGAAGCCCTGACAGGAACAGG - Intronic
1062810412 10:459323-459345 CTCGAACCCCTGAGGGTCCCTGG + Intronic
1063365628 10:5488627-5488649 CTGGCAACTCTGACTGTACCCGG - Intergenic
1064309395 10:14198490-14198512 CTCAAAGCCCTCACTTTCCCTGG - Intronic
1067731435 10:48814468-48814490 CTCCATGCCCTGCCTGTAGCTGG - Intronic
1069605892 10:69738358-69738380 GACCAAGCCCTGCCTGTACCTGG + Intergenic
1071259515 10:83907309-83907331 CTCGGACCCCTGACTGTATCTGG - Intergenic
1075392864 10:122105515-122105537 CTCTGAACTCTGACTGTACCTGG + Intronic
1076828213 10:132981109-132981131 CTGGCAGCCCTGGCTGTCCCAGG - Intergenic
1080461058 11:32455324-32455346 CTGGAAGACCTGACTTTATCTGG + Intergenic
1085037866 11:73310488-73310510 CTGGAAGCCCTGACTGGGCAGGG + Exonic
1085305666 11:75484368-75484390 CTGGAAACCTTGGCTGTACCTGG + Intronic
1096501861 12:52069061-52069083 CTCGAAGCCCTGTCTGCTCTGGG + Intergenic
1097050511 12:56220511-56220533 CTCAAACCTCTGACTGTAGCCGG - Intronic
1110167517 13:72461041-72461063 CTCTAAGCCCTGAGTCTTCCAGG - Intergenic
1110940476 13:81342605-81342627 TCTGAACCCCTGACTGTACCTGG - Intergenic
1113627335 13:111856773-111856795 CCCGAGGCCCTGAGTGCACCCGG + Intergenic
1113681568 13:112248277-112248299 CTGGCAGTCCTGACTGTCCCTGG - Intergenic
1115175591 14:30558688-30558710 TTAAAAGCCCTGACTGTGCCGGG + Intergenic
1116377357 14:44220503-44220525 CCCCAATCCCTGACTGTATCTGG + Intergenic
1116585451 14:46697482-46697504 TTCGAATCTCTGACTGTTCCGGG + Intergenic
1122717568 14:103704861-103704883 CTCTAAGCACTGACTATGCCAGG + Intronic
1124790493 15:32721345-32721367 TTTGAAGCCCTTACTGTGCCAGG - Intronic
1125725937 15:41868200-41868222 CTCGAAGCTCTTCCTGGACCTGG + Exonic
1127387271 15:58476681-58476703 CCAGAAGCCCTGACTCTGCCAGG + Intronic
1133287128 16:4695761-4695783 CCCGAGGCCCTGACTGTCCCTGG - Exonic
1139593368 16:67945091-67945113 CTCGTCGCCCTCACTGTTCCTGG + Exonic
1145980765 17:29010118-29010140 CTGGCATCCCTGACTGTTCCAGG - Intronic
1147866799 17:43558406-43558428 TGCAAAGCCCTGACTGTTCCAGG - Intronic
1152549313 17:81021401-81021423 GTGGAAGCCCAGACTGTCCCTGG - Intergenic
1163747588 19:19057466-19057488 CTCGAAGCCCATCCTGGACCTGG + Exonic
1167070943 19:47221669-47221691 CTCCCAGCCCTGCCTGTCCCGGG - Exonic
927640364 2:24841820-24841842 GTCAGAGCCCTGACTTTACCTGG - Intronic
930373381 2:50533136-50533158 CTCTAAGCACTGAGTGTTCCAGG + Intronic
932263608 2:70347008-70347030 CAGGCAGCCCTGCCTGTACCAGG + Intergenic
932336621 2:70935448-70935470 CTCCTTGCCCTGACTATACCTGG - Intergenic
932738450 2:74272832-74272854 TTGGAAGCCTTGACTGTACCTGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933409901 2:81912014-81912036 CTCGAATCTTTGACTGTGCCTGG + Intergenic
937430768 2:121836180-121836202 CTCGAAGCCCTCCCTGCCCCAGG + Intergenic
948429574 2:237911264-237911286 CTCGCAGCTCTGTCTGCACCAGG - Intronic
948566750 2:238892113-238892135 CTCGGGACCCTGACTGTACATGG + Intronic
1170656700 20:18293403-18293425 CTGGAAGCCCTTACACTACCTGG - Intronic
1175462287 20:59160514-59160536 CACTTAGCCCTGAGTGTACCAGG + Intergenic
1175888888 20:62307376-62307398 CTGGGGGCCCTGACTGGACCTGG + Exonic
1178423512 21:32460693-32460715 CATGAAGCCCTGACCCTACCTGG - Intronic
1182438573 22:30347482-30347504 CTCCAACCACTGTCTGTACCTGG + Intronic
1183086281 22:35489275-35489297 CTGGAACCCCTGGCAGTACCTGG + Intergenic
1183329050 22:37209575-37209597 CACTGAGCCCTGACTGTGCCAGG + Intronic
1185272831 22:49936535-49936557 CTCCAAGCCTTGGCTGCACCCGG - Intergenic
949344309 3:3062430-3062452 CTGGCAGCCCTCTCTGTACCAGG + Intergenic
951981508 3:28572166-28572188 CTAGAAGCACTGGCTTTACCTGG + Intergenic
967811838 3:193767105-193767127 CTCTAAGTCCTCACAGTACCTGG + Intergenic
968790209 4:2655099-2655121 CTCGAAGCCAGGACTGGACAAGG - Intronic
988947883 5:36224781-36224803 CCCACAGCCATGACTGTACCTGG - Intronic
989998232 5:50861045-50861067 ATGGAAGCCCTGACTCTACTAGG + Intergenic
997691417 5:135829975-135829997 ATCGAAGCCTTGAATGTCCCAGG - Intergenic
1001788277 5:174432510-174432532 CTCGGTGCCATGACTGGACCAGG + Intergenic
1004808641 6:19233668-19233690 CTGGGAGCCCTGTCTGTAACAGG + Intergenic
1007114068 6:39330914-39330936 CTCGGAGCCCTGGCAGTCCCTGG + Exonic
1007772509 6:44202745-44202767 CTCTAACCCCTGACTCTTCCTGG - Intergenic
1017910941 6:158792429-158792451 CTCAAACTCCTGACTGTGCCTGG + Intronic
1026465149 7:70647361-70647383 CTGCAAGCCCTGAATGTGCCTGG + Intronic
1027846987 7:83392605-83392627 CTCGAGACCCTTACTGTGCCTGG - Exonic
1032313902 7:130815922-130815944 CTGGAAGCCCTCTCTGCACCAGG - Intergenic
1034857358 7:154564084-154564106 CTCGAAGCCCTGACTGTACCTGG - Intronic
1051842280 9:21412574-21412596 GTCCATGCCTTGACTGTACCTGG - Intronic
1057923825 9:99124319-99124341 CTCATAGCCCACACTGTACCTGG + Intronic
1062630296 9:137460273-137460295 CTGGAAGCCCTGACTTCCCCGGG - Exonic
1195357145 X:104049415-104049437 CTCGAATCCCTGCCTCTGCCGGG - Intergenic
1195520441 X:105822837-105822859 CTCGAAGCCATGGCGGGACCTGG + Exonic