ID: 1034858641

View in Genome Browser
Species Human (GRCh38)
Location 7:154577367-154577389
Sequence CCAGGAGAGACTGCTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 7, 3: 67, 4: 565}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034858632_1034858641 15 Left 1034858632 7:154577329-154577351 CCAGGCCTGTGCAGGTGGGAGCT 0: 1
1: 0
2: 0
3: 33
4: 395
Right 1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG 0: 1
1: 0
2: 7
3: 67
4: 565
1034858634_1034858641 10 Left 1034858634 7:154577334-154577356 CCTGTGCAGGTGGGAGCTGGAAG 0: 1
1: 0
2: 5
3: 37
4: 329
Right 1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG 0: 1
1: 0
2: 7
3: 67
4: 565
1034858627_1034858641 24 Left 1034858627 7:154577320-154577342 CCCTGAGAGCCAGGCCTGTGCAG 0: 1
1: 0
2: 4
3: 48
4: 444
Right 1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG 0: 1
1: 0
2: 7
3: 67
4: 565
1034858628_1034858641 23 Left 1034858628 7:154577321-154577343 CCTGAGAGCCAGGCCTGTGCAGG 0: 1
1: 0
2: 4
3: 39
4: 391
Right 1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG 0: 1
1: 0
2: 7
3: 67
4: 565
1034858626_1034858641 25 Left 1034858626 7:154577319-154577341 CCCCTGAGAGCCAGGCCTGTGCA 0: 1
1: 0
2: 4
3: 44
4: 345
Right 1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG 0: 1
1: 0
2: 7
3: 67
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034858641 Original CRISPR CCAGGAGAGACTGCTGGTGC AGG Intronic
900165614 1:1243243-1243265 CCAGGAGTGGCTGCTGGGGCTGG + Intronic
900399527 1:2467339-2467361 CCAGCAGAGGCTGCTGGGCCCGG + Intronic
900508081 1:3039571-3039593 CAAGGGGCGACTGCTGGTGTTGG + Intergenic
900569479 1:3351301-3351323 CCAGGAGAGACTTCTGATTGAGG + Intronic
900625393 1:3606207-3606229 CCAGGAGAGGCTGCTGGTCCTGG - Intronic
900698518 1:4028054-4028076 CCAGGACAGGCTGTTGGGGCTGG - Intergenic
901870812 1:12138330-12138352 CCTGGAGAGCCTGCCGCTGCAGG + Exonic
902087978 1:13877813-13877835 CCGGGAGACACTGGTGCTGCTGG - Intergenic
902254396 1:15178219-15178241 CCAGGAGACAGTCCTGGTGGAGG + Intronic
902381665 1:16055665-16055687 CCTGGAGACACTGCTGGGGGTGG - Exonic
902733714 1:18386368-18386390 CCAGGAGATGCAGCTGCTGCCGG - Intergenic
903130573 1:21277057-21277079 CCAGGAGCAGGTGCTGGTGCTGG - Intronic
903136991 1:21315887-21315909 TCAGGAAAGAGTGCTGGTTCTGG + Intronic
903186697 1:21633302-21633324 CCAGGACAGGCGGCTGGGGCAGG - Intronic
903330435 1:22594396-22594418 CCAGGTGAGACCGATGCTGCTGG - Intronic
903458693 1:23506089-23506111 CCAGGTGATACTGCTGCTGCTGG + Intergenic
903552704 1:24169180-24169202 GCACGTGAGATTGCTGGTGCTGG + Intronic
904298801 1:29541046-29541068 TCAGGAGAGACTGGATGTGCGGG - Intergenic
904419549 1:30382772-30382794 CCAGGAGCATCTGCTGGGGCGGG + Intergenic
904995364 1:34627412-34627434 ACAGGAGAAACTGATGATGCAGG + Intergenic
905340000 1:37271878-37271900 CCAGGCCACACTGCTGGTGCAGG + Intergenic
905402569 1:37714409-37714431 CCAGGACAGGCTGCAGGTGTGGG - Intronic
905588477 1:39141371-39141393 CCAGGAGATGCTGATGCTGCTGG + Intronic
906192713 1:43908390-43908412 CCAGGTGATACTGGTGCTGCTGG - Intronic
906568169 1:46815150-46815172 CCAGGAGATACCACTGGTGGTGG - Exonic
906733868 1:48105695-48105717 ACAGGGGAGATAGCTGGTGCAGG - Intergenic
907222059 1:52914400-52914422 CCAGGAGAGAAGCCTGTTGCAGG + Intronic
910800386 1:91139017-91139039 CCAGGGGACACAGCTGATGCGGG + Intergenic
911110035 1:94174077-94174099 CCAGGAGGCACTGCTGCTGAGGG + Exonic
913190297 1:116407691-116407713 CCAGGTGATACTGATGCTGCTGG - Intronic
915334206 1:155131128-155131150 ACAGGAGACAGTGATGGTGCAGG + Intronic
915492515 1:156259025-156259047 GCAGGAGAGCCTGCTGCAGCAGG - Exonic
915847905 1:159287577-159287599 GCACTAGAGAATGCTGGTGCTGG - Intergenic
917112983 1:171570908-171570930 CCAGGTGATGCTGATGGTGCTGG - Intronic
917481306 1:175414576-175414598 CCCGGAGACACCTCTGGTGCTGG - Intronic
918311672 1:183289664-183289686 CCAGGACAGGCTGCTGTGGCTGG - Intronic
920670612 1:208001355-208001377 CCAGGTGAAGCTGCTGTTGCTGG - Intergenic
921482547 1:215679429-215679451 CCAGGAGAGACTGGAGGTAAAGG + Intronic
922486361 1:225976103-225976125 CAGGGAGAGACTGCTGGGGAAGG - Intergenic
923221591 1:231899343-231899365 CCAGGAGACACAGATGCTGCTGG + Intronic
924030298 1:239879316-239879338 CCAGGAGATTCTGCTGCTGCTGG + Intronic
924164264 1:241265541-241265563 CCAGGCAAGACGGCTGGGGCTGG + Intronic
1062928804 10:1338958-1338980 CCAGCCGAGGCTGCTGGTGTTGG - Intronic
1063614863 10:7592824-7592846 CCAGGAAGGACTGAAGGTGCCGG + Intronic
1063699624 10:8371791-8371813 TCAGGGGCCACTGCTGGTGCTGG + Intergenic
1065334016 10:24636319-24636341 CCAGGTGATACTGATGCTGCTGG - Intronic
1065918031 10:30368432-30368454 GCAGGAGAGGCTGCAGGAGCTGG - Intronic
1067074883 10:43172118-43172140 CCAGGAAAGACTGTTGGGGGTGG - Intronic
1067205234 10:44207133-44207155 CCAAGGGAGACAGCAGGTGCAGG - Intergenic
1067225571 10:44373809-44373831 CCAGGTGGGACTGCTGGAGGTGG + Intronic
1067287581 10:44918072-44918094 CAAGGAGAGACAGCTTGTGTGGG + Intronic
1067529423 10:47059713-47059735 CCCCGAGAGAATGCTGGAGCAGG + Intergenic
1067558518 10:47288484-47288506 GCAGGAGAAATTGCTGGTGTAGG + Intergenic
1068943534 10:62705165-62705187 CCAGGTGATACTGGTGCTGCTGG - Intergenic
1069239783 10:66124734-66124756 CAAAGAGAGACAGCTTGTGCAGG + Intronic
1069559161 10:69417423-69417445 CCAGGTGATACTGATGCTGCTGG + Intergenic
1069862546 10:71480666-71480688 CCAGGAGCCACTGCTGGGGCTGG + Intronic
1070960297 10:80494601-80494623 CCAGGATAGTCTGCTGTTCCTGG + Intronic
1071048809 10:81419957-81419979 CCAGGTGATACTGATGCTGCTGG + Intergenic
1071271313 10:84010138-84010160 GCAAGAGAGAGTGCTTGTGCAGG + Intergenic
1071509809 10:86254366-86254388 CCAGGAGATGCTGGTGCTGCTGG - Intronic
1071707412 10:88013972-88013994 CCAGGAGATGCTGATGCTGCTGG + Intergenic
1072483232 10:95829496-95829518 TAAGGAGATACTGCTGGGGCTGG + Intronic
1073077561 10:100834013-100834035 CAAGGAGAGACAGTGGGTGCAGG + Intergenic
1073541200 10:104317363-104317385 CCAGGAGATACTGCAGCTGCTGG - Intronic
1073561201 10:104498512-104498534 CCAGGAAGGACTGCAGGGGCAGG - Intergenic
1073606573 10:104901594-104901616 CCTGGAGAGACTGTAGGTGAGGG - Intronic
1074156344 10:110803528-110803550 CCAGGAGATGCTGCTGCTGGTGG + Intronic
1074885889 10:117693324-117693346 CCAGGTGATACTGATGTTGCTGG + Intergenic
1075317703 10:121465880-121465902 CCAGGAGGAGATGCTGGTGCTGG + Intergenic
1076106703 10:127829045-127829067 CCAGGAAAGAATGCTGGGCCAGG + Intergenic
1076173848 10:128348628-128348650 CCAGTAAAGACGGCTGGAGCTGG + Intergenic
1076749745 10:132536938-132536960 CCAGGGGAGGGGGCTGGTGCGGG - Intergenic
1076757156 10:132578629-132578651 CCAGGAGAGTGTGCGGGGGCTGG + Intronic
1076757188 10:132578747-132578769 CCAGGAGAGTGTGCAGGGGCTGG + Intronic
1077082324 11:729562-729584 GAAGGAGGGTCTGCTGGTGCTGG + Intergenic
1077247014 11:1544599-1544621 CCAGGAGAGGGAGCTGGAGCAGG - Intergenic
1077258059 11:1598008-1598030 ACAGGAGCCACAGCTGGTGCAGG + Exonic
1078067928 11:8090104-8090126 CCAGGAGCCCCTGATGGTGCAGG + Exonic
1079467167 11:20741986-20742008 CCAGAAGACACTGATGCTGCAGG + Intronic
1079666625 11:23113873-23113895 CCAGGTGAGATAGCTGGTCCAGG + Intergenic
1079759576 11:24311290-24311312 CCAGGAGAGACAGACAGTGCAGG - Intergenic
1079935729 11:26614079-26614101 CCTGGGGATACTGCTGCTGCAGG + Intronic
1080845304 11:36021572-36021594 TCAGGAGAGAGTGATGGTGGTGG + Intronic
1081443241 11:43102822-43102844 CCAGGTGATGCTGCTGCTGCTGG - Intergenic
1081657481 11:44867117-44867139 CCAGGAGATGCTGGTGATGCTGG - Intronic
1081744837 11:45465547-45465569 CAAGGAGAGAGTGCAGGTGATGG - Intergenic
1082283260 11:50294503-50294525 CCAGGTGATACTGATGCTGCTGG - Intergenic
1082878903 11:58018464-58018486 CCAGGTGATGCTGCTGCTGCAGG + Intergenic
1083162982 11:60867177-60867199 CCTGGAGAGCCTGTTGGGGCAGG + Intergenic
1083185787 11:61017217-61017239 GCAGGAGGGACAGCTGGGGCTGG + Intronic
1083602243 11:63955975-63955997 CCAGGAGAGACTGCCAGAGTTGG - Exonic
1085651390 11:78271973-78271995 CCAAGAGAGAGAGCTTGTGCAGG - Intronic
1085799203 11:79572533-79572555 CCAGGAGATGCTGATGCTGCTGG + Intergenic
1087839939 11:102910116-102910138 CCAGGGGACACTGGTGTTGCTGG - Intergenic
1088356974 11:108954451-108954473 CCAGGTGACACTGATGCTGCTGG - Intergenic
1088544435 11:110945662-110945684 AGAGGAGAGGCTGCTGGTGGTGG - Intergenic
1089181616 11:116587140-116587162 CAAGGACAGAATGCTGGTGAAGG + Intergenic
1089337399 11:117734589-117734611 TCAGGAGAGAATGGGGGTGCAGG - Intronic
1089527928 11:119108827-119108849 CAAGGAGAGATTGCTGGGTCAGG - Intronic
1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG + Intronic
1090255718 11:125282560-125282582 CCAGGTGATGCTGCTGGTACAGG + Intronic
1090780443 11:130002396-130002418 CCAGGAGGGCCTGCTGGAGGGGG + Intronic
1091181749 11:133611180-133611202 CCTCAAGAGACTGCTGGTGAGGG - Intergenic
1091475654 12:769606-769628 CCAGGAGAAATTGCTGCTGCAGG - Intronic
1091837352 12:3595173-3595195 CCTGGGGAGGCTGCTGGGGCAGG + Intergenic
1092209789 12:6638796-6638818 GGAGGAGAGCCTGCTGGTGGAGG + Intronic
1092444370 12:8540182-8540204 CCAGGGGCTACTGCTGCTGCTGG + Intronic
1095632829 12:44398312-44398334 GCAGCAGACACTGCTGGAGCTGG + Intergenic
1096849892 12:54428735-54428757 TCTGGGGAGACTGCTGGTGAGGG - Intergenic
1097796784 12:63871063-63871085 CCAGGTGAGACTGATGCTGTAGG + Intronic
1099474205 12:83088092-83088114 CCAGGTGAGGCTACTAGTGCTGG - Intronic
1099725050 12:86415129-86415151 CCAGGAGAGACTTGAGGTCCCGG - Intronic
1100557163 12:95706978-95707000 CCAGGTGATGCTGATGGTGCTGG + Intronic
1100559560 12:95734433-95734455 CCAGATGAGGCTGATGGTGCTGG + Intronic
1100618048 12:96247035-96247057 CCGGGAGAGCCTTCTGCTGCAGG + Exonic
1100709143 12:97235336-97235358 CCAGGAAGGTATGCTGGTGCTGG + Intergenic
1100980125 12:100157040-100157062 CCAGGTGAAGCTGCTGGAGCTGG - Intergenic
1100981558 12:100166486-100166508 GGAGGAGAGGCTGCTGGAGCTGG - Intergenic
1101747517 12:107554743-107554765 CCAGGTGAGGCTGTTGCTGCTGG + Intronic
1102926211 12:116828347-116828369 CCAGGCGATGCTGATGGTGCTGG + Intronic
1102995450 12:117346605-117346627 CCAGGTGATGCTGCTGGTGCTGG - Intronic
1103874912 12:124119673-124119695 CCTGGTGAGACTGGTGCTGCCGG - Intronic
1103992715 12:124809959-124809981 CAAAGAGAGGCTGCTGGTGGTGG - Intronic
1104846694 12:131850613-131850635 CCAGAGGAGCCTGCTGGGGCAGG - Intronic
1104966146 12:132509582-132509604 CCAGGAGGGACCGCAGGCGCCGG - Intronic
1105855320 13:24366547-24366569 GCAGGGGAGACTGCTGGAGGGGG - Intergenic
1106639003 13:31563319-31563341 CCAGAAGTAACTCCTGGTGCTGG + Intergenic
1107574255 13:41699979-41700001 CCAGGAGAGGCTAATGCTGCTGG + Intronic
1108074618 13:46666956-46666978 CCAGGAGAGAGTGCCAGTGCGGG + Intronic
1108096620 13:46908489-46908511 CCAGCAGAGATTGATGCTGCAGG + Intergenic
1108235800 13:48403749-48403771 CCAGGTGATACTGATGCTGCTGG + Intronic
1108258409 13:48632487-48632509 CCAGGTGACACTACTGCTGCTGG + Intergenic
1108484769 13:50912379-50912401 CCAAGAGATACTGATGCTGCTGG + Intronic
1108790986 13:53969091-53969113 CCAGGAGAGACTCCTGCTTGGGG + Intergenic
1108882783 13:55141764-55141786 CTAGGTGATACTGCTGCTGCTGG + Intergenic
1109513797 13:63414524-63414546 CCAGGTGATACTGTTGCTGCTGG + Intergenic
1109624620 13:64958619-64958641 CCAGGCGGCACTGCTTGTGCAGG + Intergenic
1109728462 13:66377381-66377403 CCAGGTGATACTGCTCTTGCTGG + Intronic
1111325688 13:86694013-86694035 CAAAGAGAGAGTGCTTGTGCAGG + Intergenic
1112410740 13:99161336-99161358 GCAGGCGAGACAGCTTGTGCAGG + Intergenic
1113109348 13:106805574-106805596 CCAGGAGAGACTGTTTCTCCTGG + Intergenic
1113941750 13:114022022-114022044 CGTGCACAGACTGCTGGTGCTGG - Intronic
1113986932 13:114324857-114324879 CCAGGAGACACAGATGGAGCAGG - Exonic
1114418205 14:22558091-22558113 CCAGGAGAGAAGGCTAGTGAGGG - Intronic
1114798265 14:25741048-25741070 CCATGAGAGAGAGCTTGTGCAGG + Intergenic
1115376514 14:32682845-32682867 CTAGGAGATACTGCTGCTGGTGG - Intronic
1115424617 14:33243518-33243540 CCAGGTGATACTGCTGCTGCTGG + Intronic
1117668459 14:58081224-58081246 CCAGGAGAGACTGATGCTGCTGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118490858 14:66258207-66258229 CCAGGGGAAACTGGTGGTGCTGG + Intergenic
1119400253 14:74358137-74358159 GCAGCAGAGAGGGCTGGTGCCGG - Exonic
1121282849 14:92711706-92711728 CCAGGTGGTACTGCTTGTGCAGG + Exonic
1121314480 14:92952974-92952996 CAAGGAGGGGCTGCTGGGGCTGG - Intronic
1121456089 14:94039717-94039739 CCAGGAGATGCTGATGCTGCTGG + Intronic
1121554905 14:94829128-94829150 CCAGGTGAGGCTGCAGGGGCTGG - Intergenic
1122314510 14:100817844-100817866 CCAGGAAAGGCTGGTGGTGGAGG + Intergenic
1122716131 14:103698145-103698167 CCAGGAGAGCCTGGGGGTGGGGG - Exonic
1122844326 14:104482985-104483007 GCAGGGGAGACTGCTGGAGGTGG - Intronic
1122946301 14:105011815-105011837 CCAGGAGCGACTGCCGCTGCAGG + Exonic
1123728979 15:23129451-23129473 CCAGGTGAGGCTGCAGGAGCTGG - Exonic
1123747143 15:23326916-23326938 CCAGGTGAGGCTGCAGGAGCTGG - Intergenic
1123762177 15:23441559-23441581 GGAGGAGAGACTGCGGGAGCAGG - Exonic
1124223769 15:27871413-27871435 CCAGCAGAGGCTCCTGGTGTGGG - Intronic
1124360701 15:29034842-29034864 CCAGGTGACACTGATGCTGCTGG + Intronic
1124545912 15:30626364-30626386 CCAGTTGAGCCTGCTGGGGCTGG + Exonic
1124718504 15:32090601-32090623 TCAGGAGGGACTGCTGCTGCAGG - Intronic
1124779430 15:32615751-32615773 CCAGTTGAGCCTGCTGGGGCTGG + Exonic
1125507581 15:40275950-40275972 CCTGGAGCGGATGCTGGTGCGGG + Exonic
1125723775 15:41857641-41857663 CCAGGAGCGACTGGAGGAGCTGG - Exonic
1125740021 15:41955990-41956012 GGAGGAGAGACTGCTGGGGAGGG + Intronic
1125973774 15:43933481-43933503 CCAGGTGATGCTGCTGTTGCTGG + Intronic
1126679492 15:51189669-51189691 CCACGAGAGACTGCAGCTTCTGG - Intergenic
1126878773 15:53072225-53072247 TGAGAAGAGACAGCTGGTGCAGG + Intergenic
1127263014 15:57339428-57339450 ACAAGAGAGACAGCTGGTGGTGG - Intergenic
1127267191 15:57371866-57371888 CCAGGAGAGGCTGCTGGCTGTGG + Intergenic
1127757840 15:62110471-62110493 GATGGAGAGACTGCTGTTGCAGG - Intergenic
1127772524 15:62243162-62243184 CCAGGTGAAGCTGCTGGAGCTGG - Intergenic
1127774440 15:62254246-62254268 GCAGGAGAGGCTGCTGGAGCTGG - Intergenic
1127903309 15:63357332-63357354 CCAGGTGATGCTGCTGCTGCTGG + Intronic
1128214267 15:65923438-65923460 CCAGGAGCCACTGGTGCTGCTGG + Intronic
1129029746 15:72609610-72609632 ACAGGAGAGGCTGCGGGAGCAGG + Intergenic
1129029754 15:72609652-72609674 GGAGGAGAGACTGCTGGAGCAGG + Intergenic
1129029756 15:72609670-72609692 GCAGGAGAGACTGCTGGAGCAGG + Intergenic
1129029772 15:72609748-72609770 GAAGGAGAGGCTGCTGGAGCAGG + Intergenic
1129570067 15:76672073-76672095 CCAGGAGAAACTGCTGGGAAAGG + Intronic
1130116306 15:81007558-81007580 CTACTAGACACTGCTGGTGCTGG + Intronic
1130166207 15:81461537-81461559 CCAGGAGAGCCTCCTGATGCAGG - Intergenic
1130259583 15:82344794-82344816 GCAGGAGAGGCTGCTGGAGAGGG - Exonic
1130269099 15:82434392-82434414 GCAGGAGAGGCTGCTGGAGAGGG + Exonic
1130281650 15:82524215-82524237 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1130281664 15:82524293-82524315 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1130281678 15:82524371-82524393 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1130281707 15:82524524-82524546 GCTGGAGAGGCTGCTGGAGCTGG + Intergenic
1130434806 15:83887055-83887077 CCAGGAGATGCTGATGCTGCAGG - Intronic
1130473020 15:84240377-84240399 GCAGGAGAGGCTGCTGGAGAGGG + Exonic
1130473033 15:84240455-84240477 GCAGGAGAGGCTGCTGGAGAGGG + Exonic
1130473047 15:84240533-84240555 GCAGGAGAGGCTGCTGGAGAGGG + Exonic
1130480434 15:84354442-84354464 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1130480447 15:84354520-84354542 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1130480461 15:84354598-84354620 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1130491250 15:84433161-84433183 GCAGGAGAGGCTGCTGGAGAGGG - Intergenic
1130491264 15:84433239-84433261 GCAGGAGAGGCTGCTGGAGAGGG - Intergenic
1130491277 15:84433317-84433339 GCAGGAGAGGCTGCTGGAGAGGG - Intergenic
1130502833 15:84511961-84511983 GCAGGAGAGGCTGCTGGAGAGGG - Intergenic
1130502847 15:84512039-84512061 GCAGGAGAGGCTGCTGGAGAGGG - Intergenic
1130502860 15:84512117-84512139 GCAGGAGAGGCTGCTGGAGAGGG - Intergenic
1130595318 15:85245055-85245077 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1130595332 15:85245133-85245155 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1130883275 15:88073143-88073165 CCAGGTGAGGCTGATGCTGCTGG - Intronic
1131316921 15:91347401-91347423 CCAGGAAACACTGATGCTGCTGG - Intergenic
1131403439 15:92144798-92144820 CCAGGAACGAGTGCCGGTGCTGG - Intronic
1131816445 15:96225991-96226013 CCAGGTGATAGTGCTGCTGCTGG - Intergenic
1131819274 15:96255737-96255759 CCAGGTGACACTGATGCTGCAGG - Intergenic
1132312945 15:100870407-100870429 CCAGGTGGGGGTGCTGGTGCTGG - Intergenic
1134193963 16:12144093-12144115 CCAGGTGACACTGATGCTGCTGG + Intronic
1135493623 16:22932254-22932276 CCAGGTGATACTGATGATGCTGG - Intergenic
1135685742 16:24497122-24497144 CCAGGGGAGGCTGATGTTGCTGG + Intergenic
1135793471 16:25420035-25420057 CCAGGTGAGAAAGCTGCTGCAGG - Intergenic
1136086932 16:27891982-27892004 CCAGGTGAGTCCGGTGGTGCTGG - Intronic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1136451727 16:30357627-30357649 CCAGGGGTGACTCCTGGTGATGG - Exonic
1136913730 16:34162908-34162930 CCAGGAGGGCCTCCTGGTGTTGG + Intergenic
1137706901 16:50541860-50541882 CCAGGTGAGGCTGATGGTGCTGG - Intergenic
1138008525 16:53358070-53358092 GCAGAGGAGACTGCTGGGGCAGG - Intergenic
1139483255 16:67242389-67242411 CCAGGACAGACAGCTGGGGGTGG - Intronic
1140036875 16:71377894-71377916 CCAGGTGATACTGATGCTGCCGG - Intronic
1141569507 16:84925627-84925649 CCAGGTGAGGCTGCTGCTTCTGG - Intergenic
1141880329 16:86854233-86854255 CCAGAAGAGTCTGCTGCTGCCGG - Intergenic
1141982198 16:87557457-87557479 CCAAGAGTGTCTGCTGGTGCAGG + Intergenic
1142003150 16:87675508-87675530 CCAGCAGACACTGCTGCAGCCGG + Intronic
1142284985 16:89167985-89168007 ACAGGAGGGGCTGCTGGTGGGGG - Intergenic
1142521462 17:507710-507732 ACAGAAGAGGCTGCTGGGGCCGG - Intergenic
1143195416 17:5072618-5072640 GCAGGAGGCACTGGTGGTGCTGG - Intergenic
1143305893 17:5946407-5946429 CAAAGAGAGACAGCTTGTGCAGG - Intronic
1143835254 17:9686846-9686868 TGAGGATAGACTGCTGGAGCTGG - Exonic
1144308831 17:13993806-13993828 CCAAGAGATGCTGCTGGTCCAGG + Intergenic
1144508101 17:15850645-15850667 GCAGGAGAGACAGCAGCTGCTGG - Intergenic
1144712046 17:17407690-17407712 CCAAGGTAGTCTGCTGGTGCTGG - Intergenic
1144807210 17:17976031-17976053 GCTGGAGAAACTCCTGGTGCAGG - Intronic
1145163363 17:20590120-20590142 GCAGAAGAAACAGCTGGTGCAGG + Intergenic
1145172221 17:20668283-20668305 GCAGGAGAGACAGCAGCTGCTGG - Intergenic
1145749052 17:27342154-27342176 ACAGGAGACCCTGCTGGTTCTGG + Intergenic
1145973568 17:28971263-28971285 CCAGGTGAGGCTGCTGATGCTGG - Intronic
1146016946 17:29241395-29241417 CCATGAGGGGCTGCTGCTGCAGG - Intergenic
1146637670 17:34518352-34518374 CCAGGTGATGCTGCTGGTGCTGG + Intergenic
1147392021 17:40115344-40115366 CCAGGTGATACTGAAGGTGCTGG + Intergenic
1147662268 17:42123042-42123064 CCCGGAGGAACTGGTGGTGCAGG + Exonic
1148019157 17:44542179-44542201 GGAGGAGAGGCTGCTGGAGCTGG - Intergenic
1148028476 17:44604408-44604430 CCAGGCGATGCTGCTGGTGCTGG - Intergenic
1149986778 17:61353418-61353440 CCAGGTGATGCTGCTGCTGCTGG + Intronic
1150212290 17:63447809-63447831 CCAGGAGAGACTCCTGCTGAGGG + Intergenic
1151189089 17:72384815-72384837 CCAGGCGATGCTGATGGTGCTGG - Intergenic
1151576415 17:74954503-74954525 CCAAGAGAGGGTGCTGGGGCAGG + Intronic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1152200494 17:78943121-78943143 CAAGAAGAGGCTGATGGTGCAGG + Intergenic
1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG + Exonic
1152751303 17:82063650-82063672 ACTGGAGACACTGCTGGTTCTGG - Intronic
1152926028 17:83088168-83088190 CCTGCAGAGGCGGCTGGTGCAGG - Intronic
1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG + Intergenic
1153759404 18:8316206-8316228 CCAGTAGAGACTGCAGGAGCTGG - Intronic
1153917999 18:9762777-9762799 GGAGGAGAGAGTGGTGGTGCGGG + Intronic
1155306126 18:24480379-24480401 CAAGGAGAGAGAGCTTGTGCAGG + Intergenic
1155350136 18:24898099-24898121 CCAAGAGTGAGTGCTGGAGCTGG + Intergenic
1156060080 18:33063492-33063514 CCAGGAAAGCATGCAGGTGCTGG - Intronic
1156326048 18:36076407-36076429 CCAGCAGAGACTTCTGGTTTGGG + Intergenic
1156371213 18:36473106-36473128 CCAGGAGAAGCTGGTGGTGCTGG - Intronic
1156758256 18:40555172-40555194 CCAGGAGAGGGGGCTGGTACTGG - Intergenic
1157294581 18:46433434-46433456 GCAGGAGGTATTGCTGGTGCAGG - Exonic
1157475792 18:48022642-48022664 CCAGGAGACACTGGTGGAGAGGG + Intergenic
1157834804 18:50890893-50890915 CCAGGAGGCACTGCTGGACCAGG + Intronic
1157921500 18:51717680-51717702 CCGGGAGATACTGATGCTGCTGG - Intergenic
1158497984 18:57973952-57973974 CCAGGTGATACTGCTGGCCCTGG - Intergenic
1158857386 18:61556467-61556489 CCAGGAGATGCTGATGCTGCTGG + Intergenic
1158978551 18:62736205-62736227 CCAGGAGAGGCTGATGGTGCTGG - Intronic
1160507229 18:79434068-79434090 CCAGGCGAGGCTGGTGCTGCTGG - Intronic
1160662174 19:306268-306290 CCGGCGGAGGCTGCTGGTGCGGG + Exonic
1161124086 19:2546300-2546322 CCTGGAGAGGCTGCAGGTGCAGG - Intronic
1161222904 19:3126205-3126227 CCAGGGGACAAGGCTGGTGCAGG + Intergenic
1161314093 19:3609850-3609872 TCAGGACAGGCTGCTGGGGCAGG - Intergenic
1161574808 19:5049379-5049401 TCAGGGGAGACAGCTGGGGCGGG + Intronic
1161807591 19:6454043-6454065 GCAGGAGACACTGCATGTGCAGG - Exonic
1162087118 19:8255603-8255625 CCAGGAGAGACAGCTGGGGCTGG - Exonic
1162818571 19:13209899-13209921 CCAGGAGAGCAAGCTGGGGCAGG - Intronic
1163189855 19:15669705-15669727 CCAGGAGAGACCACTGGTCCTGG - Intergenic
1164156439 19:22600328-22600350 GGAGGAGAGGCTGCTGGAGCTGG + Intergenic
1164535495 19:29083920-29083942 CCAGGGGACACTGTTGATGCCGG + Intergenic
1164680622 19:30131549-30131571 ACAATGGAGACTGCTGGTGCGGG + Intergenic
1166375703 19:42325766-42325788 CCAGGAGAGACTCCTCCAGCCGG - Intronic
1166476656 19:43131597-43131619 CCAGGTGAGCCTGCTGCTCCAGG + Intronic
1167112711 19:47471587-47471609 CCAGGAGGGACTGAAGGTGTTGG + Intronic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1168200484 19:54811764-54811786 CCAGGAGATAGTGCTGGCACTGG - Intronic
1168567204 19:57435238-57435260 CCAGAAGACACTGCGGGGGCAGG + Intronic
1168689576 19:58368669-58368691 CCAGGAGAGGCTGCAGGCGACGG - Exonic
925082114 2:1078559-1078581 CAGGGAGAGACTGCAGGTGCCGG + Intronic
925180530 2:1814300-1814322 CCTGGAGGGCCTCCTGGTGCAGG - Intronic
925675478 2:6357248-6357270 ACAGGAGAGGCTGATGGTGTGGG - Intergenic
925683525 2:6448173-6448195 CCAGGAGGGACTGAGGCTGCTGG - Intergenic
925775837 2:7334962-7334984 CCAGGAGTGACGGCAGCTGCAGG + Intergenic
926021424 2:9499055-9499077 CCAGGTGATGCTGCTGCTGCTGG + Intronic
926192115 2:10736171-10736193 CCAGGTGATACTGATGCTGCGGG + Intronic
926699627 2:15795137-15795159 CCAGGTGATACTCCTGCTGCTGG - Intergenic
927651962 2:24918744-24918766 CCACGAGACCCTGCTGGTGCTGG - Exonic
927937100 2:27082291-27082313 CCAGGAGCTGCAGCTGGTGCTGG - Exonic
927939316 2:27093809-27093831 CCAGGAGAGAGTTCTGGACCAGG + Intronic
927998114 2:27500635-27500657 CCAGGTGACACTGATGTTGCTGG - Intronic
928364781 2:30692255-30692277 CCAGGGAAGACTGCGGGTGGGGG - Intergenic
928612181 2:33001416-33001438 CCAGGTGGGACTGATGCTGCTGG + Intronic
929877321 2:45807692-45807714 CCAGGTGAGGCTGATGCTGCTGG - Intronic
931445938 2:62327337-62327359 CCAAGAGAGAGAGCTTGTGCAGG + Intergenic
931746298 2:65294399-65294421 ACAGGATAGAGTGCTGGAGCTGG - Intergenic
931758517 2:65395517-65395539 CCATGAGAGACAGGTGATGCGGG - Intronic
932053961 2:68425951-68425973 CCAGGGGATGCTGCTGGTGGTGG - Intergenic
932277762 2:70464125-70464147 CCAGGAGAGCCTGCTGCAGTAGG - Intronic
932616250 2:73233448-73233470 CCCGGAGAGTATGCTGGGGCGGG - Intronic
933600282 2:84321930-84321952 CCAGGAGATGCTGATGCTGCTGG + Intergenic
934102588 2:88666994-88667016 CCAGGAGAGCCTCTTGGCGCAGG + Intergenic
934953000 2:98592096-98592118 CCAGGAGGAACTGCTGGTCTTGG - Intronic
935006146 2:99079440-99079462 CCAGGTGATGCTGATGGTGCTGG - Intronic
935433640 2:103004525-103004547 CCAAGAGAGGCTGCAGGTGGAGG - Intergenic
936083628 2:109452214-109452236 CCAGCACAGTCTGCTGGTGCAGG - Intronic
936246828 2:110835870-110835892 CCAGGGGAGACTGATACTGCTGG + Intronic
936327618 2:111519302-111519324 CCTAGAGAAACTGCTGGTGGAGG - Intergenic
936491808 2:112978651-112978673 CCAGGAGACGCTGATGGTGGAGG + Exonic
936891720 2:117378473-117378495 CCTGGAGAAACTGCTGTTCCAGG + Intergenic
937028957 2:118722151-118722173 CCTGGAGGGACTGGTGGTGGAGG - Intergenic
939560039 2:143721142-143721164 CCAGGTGCCACTGCTGCTGCTGG + Intronic
941357245 2:164509657-164509679 CCAGGTGATACTGATGCTGCTGG - Intronic
941376193 2:164733983-164734005 CCAGCAGATACTGATGCTGCTGG - Intronic
941389569 2:164894989-164895011 CCAGGTGATGCTGCTGCTGCTGG - Intergenic
941861372 2:170284369-170284391 CCATGAGAGACTGCTGCTTTTGG - Intronic
942061228 2:172230403-172230425 CCAGGAGAGGCTGGTCATGCTGG - Intergenic
942388232 2:175464214-175464236 TCTGGCGAGGCTGCTGGTGCAGG - Intergenic
943558873 2:189437410-189437432 CCAGGTGACACTGCTGTTGCTGG + Intergenic
943717827 2:191171807-191171829 CAAGGAGAGCATGCTGGGGCAGG - Intergenic
944995289 2:205287134-205287156 ACAGGGCAGACTGCTGGTGAAGG - Intronic
945028511 2:205642280-205642302 CCAGGTGATATTGCTGCTGCTGG - Intergenic
945200074 2:207272445-207272467 AGGGGAGAGACTGGTGGTGCTGG - Intergenic
945643404 2:212460079-212460101 CAAGGAGAGAGAGCTTGTGCAGG - Intronic
945850346 2:214998756-214998778 CCAGGTGATACTGATGCTGCTGG + Intronic
946968994 2:225070830-225070852 CCATGAGAATCTGCTGGCGCTGG + Intergenic
947424207 2:229968509-229968531 CCAGGCTAGAATGCTGTTGCAGG + Intronic
947866332 2:233400364-233400386 CTAGGAGAGAGTGGTGATGCAGG + Intronic
947915296 2:233828653-233828675 CCAGGAGAAGCTGCTGAAGCCGG + Exonic
948058713 2:235028281-235028303 CCAGGACAGCCTGCAGTTGCAGG - Intronic
948358566 2:237400644-237400666 CCAGGAGAGACATCTGGTCCTGG - Intronic
948372041 2:237495687-237495709 CCAGGGGTGACTGGTGGTCCAGG - Intronic
948581415 2:238989479-238989501 CCCCGAGAGGCTGCTAGTGCAGG + Intergenic
948720243 2:239894735-239894757 CAAGGAGAGAATGTTGGTGAGGG - Intronic
948843279 2:240670133-240670155 CCAGGAGAGACCTCTGGAACAGG + Intergenic
948924153 2:241083143-241083165 CCAGGAGAGCCTGCTGGGGATGG + Intronic
949021255 2:241742600-241742622 CCAGGAGTCCCTCCTGGTGCTGG + Intronic
949055537 2:241926378-241926400 CCAGGAAAGTCTGTTGGTGAAGG + Intergenic
1168875608 20:1170141-1170163 CCAGGTGATGCTGCTGTTGCTGG - Intronic
1168966538 20:1901883-1901905 CCAGGAGGGACGGCTGGAGCAGG + Intronic
1169329398 20:4704720-4704742 CCAGGTGATACTGATGCTGCTGG + Intergenic
1169541286 20:6602348-6602370 CCATGAGAAAATGCTGGTGATGG + Intergenic
1170355250 20:15485412-15485434 CCAGGAAAACCTGCTGGGGCAGG - Intronic
1170597190 20:17814984-17815006 CCAGGAGGTACTGATGTTGCTGG + Intergenic
1170792975 20:19522763-19522785 CCAGGAGAGGCTGCTCCTGCAGG + Intronic
1171969479 20:31554826-31554848 CCAGGTGAGCCTGCTGGTGTGGG + Exonic
1172179613 20:32993832-32993854 CCAGGTGATACTGATGATGCAGG + Intronic
1172328807 20:34059408-34059430 CCAGGATGGACAGCTGCTGCAGG - Intronic
1172784278 20:37456238-37456260 CCTGGAGCAACTGCTGGTGCTGG + Intergenic
1172968919 20:38859267-38859289 CGGGGAGTGACTGCTAGTGCGGG + Intronic
1173199123 20:40941213-40941235 CCAGGTGACACTGATGCTGCTGG + Intergenic
1173338014 20:42128798-42128820 CCGGGTGAGGCTGCTGGTGCTGG - Exonic
1173431239 20:42988671-42988693 CCAGGAGAGACAGTGGCTGCAGG + Intronic
1173476248 20:43361847-43361869 CCAGGTGACACTGCTGCTGCTGG + Intergenic
1173670953 20:44798591-44798613 CCATGAGTATCTGCTGGTGCCGG + Intronic
1173994869 20:47330209-47330231 CCAGGAAAGACAGATGCTGCAGG + Intronic
1174630305 20:51951360-51951382 CCAGTAGAGTCAGCTGATGCAGG + Intergenic
1174715030 20:52748407-52748429 CCAGGAGAGGCTGATGGCCCTGG - Intergenic
1175215995 20:57391948-57391970 CCGGGAGAGGCGGCAGGTGCGGG - Intronic
1176098064 20:63353272-63353294 CCTGGAGTGGCCGCTGGTGCTGG - Intronic
1178603287 21:34013499-34013521 CCAGGTGACACTGCTGCTGCTGG - Intergenic
1178948224 21:36966058-36966080 CCAGGAGAGACAGCTGTGGCGGG - Intronic
1179141813 21:38732499-38732521 TCAGGAGAGAGTGCAGGTGAGGG - Intergenic
1179299107 21:40090533-40090555 TCAGGTGAGGCTGCTGCTGCTGG - Intronic
1179535558 21:42049314-42049336 CCAGGTGACACTGATGTTGCTGG + Intergenic
1179591552 21:42412451-42412473 AGGGGAGAGACTGCTGGTGAAGG + Intronic
1179593143 21:42424461-42424483 CCTGGAGAGACTGGTGATGGAGG + Intronic
1180108600 21:45637034-45637056 CCGGCACAGACTGCGGGTGCAGG - Intergenic
1181405058 22:22678482-22678504 CCAGGTGAGGCTGCTGCTGCTGG + Intergenic
1181408213 22:22700127-22700149 CCAGGTGAGGCTGCTGCTGCTGG + Intergenic
1181413531 22:22743439-22743461 CCAGGTGAGGCTGCTGCTGCTGG + Intronic
1181420994 22:22798900-22798922 CCAGGTGAGGCTGATGCTGCTGG + Intronic
1181466801 22:23114792-23114814 GCAGGAGGGAATGCTGGAGCCGG - Intronic
1181556137 22:23672642-23672664 CAAGGAAAGACTGCAGGGGCTGG + Intergenic
1181997624 22:26895299-26895321 CCAGGAGAGAGGGCAGCTGCTGG + Intergenic
1182067856 22:27443116-27443138 CCAGGTGAAACTGATGCTGCTGG - Intergenic
1182287165 22:29255291-29255313 CCAGCTGAGCCTGCTGCTGCAGG - Intronic
1182869585 22:33634342-33634364 CCAGGCGACACTGCTGCTGCCGG + Intronic
1183206754 22:36424760-36424782 GGAGGAGAGAGTGCTGGAGCAGG - Intergenic
1184093639 22:42305178-42305200 CCAGGAGGCAGTGCTGGAGCTGG - Intronic
1184327281 22:43798388-43798410 CCAGGAGATGCTGGTGCTGCTGG + Intronic
1184786945 22:46676559-46676581 CCAGGAGAGACCTGTGGTGACGG + Intronic
1184813198 22:46851456-46851478 GCCCGAGAGCCTGCTGGTGCCGG + Intronic
1185139045 22:49090091-49090113 ACATGAGAGACTGCTGGGGTTGG + Intergenic
1185233939 22:49700191-49700213 TCAGGAGAGACTGCAGGAACTGG - Intergenic
1185305560 22:50113556-50113578 TGAGGATAGACTGCTGGTGGGGG - Intronic
1185331803 22:50255338-50255360 CCTGGAGAAGATGCTGGTGCTGG - Exonic
1185367587 22:50444005-50444027 GCAGAAGAGACTGCTGGGGTGGG - Exonic
949597619 3:5564532-5564554 CCAGGTGATACTGATGCTGCTGG - Intergenic
949783534 3:7716027-7716049 AGAGGAGAGCCTGGTGGTGCAGG - Intronic
950234670 3:11308308-11308330 CTAGGAGCAAATGCTGGTGCTGG - Intronic
950525321 3:13519607-13519629 ATTGGAGAGACTGCTGGGGCTGG + Intergenic
950711325 3:14814804-14814826 ACAGGAAAGACTGCAGGTGCTGG - Intergenic
951440308 3:22715137-22715159 CCAGGAGATGCTGCTACTGCTGG + Intergenic
951501567 3:23393425-23393447 CCAGGTGATACTGATGCTGCTGG - Intronic
951584482 3:24201401-24201423 CCAGGAGATGCTGATGCTGCAGG - Intronic
951657713 3:25028156-25028178 CCAGGAGACATTGCTGGTCTAGG - Intergenic
951667330 3:25142002-25142024 TCAGGTGAGACTGATGCTGCTGG - Intergenic
951999148 3:28765415-28765437 CTAGGTGAGACTGATGTTGCTGG + Intergenic
952446267 3:33384054-33384076 CCATGAGAGGCTGCGGGTACTGG + Exonic
952736422 3:36695797-36695819 CCTGGATAGACTGCTGGCCCAGG + Intergenic
952740411 3:36728918-36728940 ACAGGAGATGCTGATGGTGCTGG - Intronic
952742437 3:36747807-36747829 CCAGGTGATACTGATGCTGCTGG - Intergenic
952853651 3:37749945-37749967 CCAGGAGATGCTGCTGCTGCTGG - Intronic
952952186 3:38533844-38533866 CCTGCAGTGACTGCTGATGCTGG + Intronic
953032329 3:39186901-39186923 CCAGCAGGGGCTGCTGGTGCAGG - Exonic
953404362 3:42653330-42653352 CCAGGAGATACTGCTGCAGCTGG + Intergenic
954660460 3:52224273-52224295 CCAGGAGAGACAGCGGGTGCAGG + Exonic
955106821 3:55906476-55906498 CCAGGTGATGCTGCTGCTGCTGG - Intronic
955976544 3:64485627-64485649 CCAGGAGATGCTGCTACTGCTGG - Intergenic
956162186 3:66366854-66366876 CCAGGCCACACAGCTGGTGCGGG - Intronic
956642578 3:71428882-71428904 CCAGGAGGCACTGCTGAAGCCGG + Intronic
956837111 3:73104410-73104432 CCAGGAGAGACATTTGGGGCTGG - Intergenic
957357754 3:79114068-79114090 GCAGGAAAGACAGCTTGTGCAGG - Intronic
958078405 3:88713072-88713094 CCTGGAGTGACTGTTGGTACAGG + Intergenic
958609728 3:96410072-96410094 GCAGGAGAGACAGCTTGTGAAGG + Intergenic
958731831 3:97968158-97968180 CCAGGAGACACCGCGGGTCCAGG - Intronic
959593824 3:108107295-108107317 CCAGGTGACACTGATGCTGCTGG + Intergenic
959645436 3:108694532-108694554 CAAGGAGAGAGAGCTTGTGCAGG + Exonic
960088980 3:113619676-113619698 CCAGGATAGAATGGTGTTGCTGG + Exonic
960403716 3:117234530-117234552 CCAGGAGATACTGATTGTTCTGG + Intergenic
960590937 3:119364662-119364684 CCAGGAGATGCTGATGCTGCTGG + Intronic
961305919 3:125959109-125959131 CCAGGCGTGACTGTTGGGGCTGG - Intergenic
961387594 3:126531150-126531172 CCAGGTGAGGCTGCGGCTGCTGG - Intronic
962806295 3:138929879-138929901 CCAGGAATGACTGCTGGCCCAGG - Intergenic
965641492 3:170833503-170833525 CCAGGAGATATTGATGCTGCTGG - Intronic
965661039 3:171042252-171042274 CTGGGAGAGCCTGCTGATGCTGG + Intergenic
965725614 3:171712195-171712217 CAGGGAGAGGCTGCTGCTGCTGG + Intronic
966159332 3:176951360-176951382 CCAGCTGAGACTGCTGATACAGG - Intergenic
967268013 3:187708355-187708377 AAAGTAGAAACTGCTGGTGCCGG + Intronic
967611042 3:191506518-191506540 GCAAGAGAGAGTGCTTGTGCAGG + Intergenic
968049092 3:195641992-195642014 GCAGGGGAGAGGGCTGGTGCTGG + Intergenic
968092695 3:195908796-195908818 GCAGGAGGGACAGGTGGTGCGGG - Intronic
968259653 3:197310269-197310291 CATGGAGAGAAGGCTGGTGCAGG + Intergenic
968768790 4:2489864-2489886 CCAGCTGAGACTTCTGTTGCTGG - Intronic
968797360 4:2716415-2716437 CCAGGAGACGCTGCTGGCCCAGG - Intronic
969526739 4:7707660-7707682 CCAGGAGGGACTGGTTCTGCTGG + Intronic
969534544 4:7747785-7747807 CATGGAGAGACAGGTGGTGCAGG + Intergenic
970321333 4:14878484-14878506 CCAGGTGACACTGATGCTGCTGG + Intergenic
972206068 4:36774179-36774201 ACAGGACAGATTGCAGGTGCAGG + Intergenic
972725448 4:41743301-41743323 CCAGGTGATACTGATGCTGCTGG + Intergenic
973712637 4:53644705-53644727 CAAGGAGGCCCTGCTGGTGCTGG - Intronic
975526200 4:75353078-75353100 CCCAGAGAGACTGCTGCTGAGGG + Intergenic
976149883 4:82081222-82081244 CCTGGAGAGACTGCTTCTCCCGG + Intergenic
977832398 4:101609087-101609109 CAAGAAGAGACAGCTTGTGCAGG - Intronic
978291601 4:107148526-107148548 CCAGGAAAGACTGATACTGCTGG - Intronic
978553280 4:109950743-109950765 TGAGGAGAGACAGCTGGTGAAGG - Intronic
979466210 4:121041414-121041436 GCAGAAGAGACTGCTGGGGTCGG - Intronic
979712037 4:123791156-123791178 CCAGGAGATGCTGATGCTGCTGG + Intergenic
980174182 4:129324884-129324906 TCAGGAGAGACAGCAGGTACGGG + Intergenic
981797692 4:148615793-148615815 CCAGCAGAGACTACTAGTGAGGG + Intergenic
982038984 4:151376159-151376181 CCAGGTGACACTGATGCTGCTGG - Intergenic
984491344 4:180438492-180438514 CCAGGTGACACTGCTGGGGCTGG - Intergenic
985168776 4:187126219-187126241 GCAGGAGAGGCTGCGGATGCTGG - Intergenic
985564020 5:606346-606368 CCAGGAAGGACTGGTGGGGCTGG - Intergenic
985694104 5:1330309-1330331 GCAGACGAGCCTGCTGGTGCTGG - Exonic
985762540 5:1757664-1757686 CCAGAAGAGACTGCTGGCATGGG - Intergenic
985902352 5:2806430-2806452 CCAGGAGAACCTGCTTGGGCAGG + Intergenic
986642379 5:9884709-9884731 CCAAGAGTGACTGCTGTTGCTGG - Intergenic
987385841 5:17328531-17328553 CCAGGTGATGCTGCTGCTGCTGG + Intergenic
987601947 5:20083773-20083795 CAAAGAGAGATTGCTTGTGCAGG + Intronic
987620927 5:20337972-20337994 CAAAGAGAGAGTGCTTGTGCAGG + Intronic
989133551 5:38130831-38130853 CCAGGAGAGGCTGCTAGGTCAGG - Intergenic
990168250 5:53018442-53018464 CCAGGAAGGATTCCTGGTGCTGG + Intronic
990330340 5:54719477-54719499 GCAGGAGGCACTGCTGGTGCTGG - Intergenic
991684096 5:69166109-69166131 CCAATAGAGACTCCTGGCGCTGG - Intergenic
992174790 5:74139471-74139493 GCATGGGATACTGCTGGTGCTGG + Intergenic
992200975 5:74383618-74383640 GGAGGAGAGACTGCAGATGCAGG - Intergenic
993574729 5:89587019-89587041 TCAGGACTCACTGCTGGTGCTGG - Intergenic
995067372 5:107877391-107877413 CCAAGAGAGACGGCGGGTGGGGG + Intronic
996533591 5:124552148-124552170 CCAGGAAATACAGTTGGTGCTGG - Intergenic
997633941 5:135390677-135390699 ACAGCATTGACTGCTGGTGCTGG - Intronic
998307858 5:141096704-141096726 CAAGCAGAGGCTGGTGGTGCTGG + Exonic
998315027 5:141174743-141174765 CAAGCAGAGGCTGGTGGTGCTGG + Exonic
998315604 5:141179945-141179967 CAAGCAGAGGCTGGTGGTGCTGG + Exonic
998316144 5:141184467-141184489 CAAGCAGAGGCTGGTGGTGCTGG + Exonic
998977838 5:147667968-147667990 CCAAGAGACACAGCTGGTGGAGG - Intronic
999880516 5:155858768-155858790 CCAGGTGATACTGATGCTGCTGG - Intergenic
1001134377 5:169090316-169090338 TCATGAGAGACTGGTGGTGGAGG - Intronic
1001156729 5:169278814-169278836 GCAGGAGAGGCTGGTGGTGATGG - Intronic
1001431539 5:171666454-171666476 CCAGCAGAGACAGCTGCTGCGGG + Intergenic
1001827577 5:174758184-174758206 CCAGGTGACACTGATGCTGCTGG + Intergenic
1002204501 5:177553763-177553785 CCAGGAGACACAGCTGCTGAGGG + Intronic
1003121406 6:3321798-3321820 CTAGGAGAGAACACTGGTGCAGG + Intronic
1003123052 6:3333743-3333765 CCAGGTGAGGCTGCTGCTGCAGG - Intronic
1003217230 6:4125485-4125507 CAAGGAGGCACTGCTGGTGGTGG - Intronic
1003236969 6:4303395-4303417 CCAGCAGAGACTGTTGGGGCTGG - Intergenic
1003513641 6:6801679-6801701 CCAGGCGTGGCTGCTGGTGAGGG - Intergenic
1003569646 6:7247544-7247566 CTAGGAGAGGGTGCTTGTGCTGG + Intronic
1003633173 6:7807245-7807267 CCAGGAGATGCTGATGCTGCTGG - Intronic
1004145848 6:13065366-13065388 CCAGGAGGGACTGGTGGTCTCGG + Intronic
1005670281 6:28098915-28098937 CCAGGAGATACAGCTGGGCCAGG - Intergenic
1005887171 6:30106028-30106050 CCAGAAGAGACTCCTTTTGCAGG + Intronic
1006175205 6:32117313-32117335 CCAGGAGAGACAGGTAGGGCGGG - Exonic
1006314293 6:33280851-33280873 CCAGAGGGGACTGCTGGTGGCGG - Exonic
1006502121 6:34465853-34465875 CCAGGCAAGACTGCTGGGGCAGG + Intergenic
1007516720 6:42418594-42418616 CCAGGTGATGCTGCTGGTGCAGG + Intronic
1007748104 6:44055569-44055591 CCAAGAGACTCTGCTGTTGCTGG - Intergenic
1008284052 6:49627755-49627777 GCAGGTGAGAGAGCTGGTGCAGG + Intronic
1008740970 6:54607882-54607904 CCAGGTGATGCTGATGGTGCTGG - Intergenic
1011416211 6:87122616-87122638 CCTGGAGATGCTGCTGGCGCTGG - Intergenic
1011594141 6:88999943-88999965 CCAGGAGATACAGCTGGGTCAGG - Intergenic
1011906096 6:92370006-92370028 CCAGGTGATACTGATGTTGCAGG - Intergenic
1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG + Intronic
1015029462 6:128576816-128576838 CCAGGAGATGCTGATGCTGCTGG - Intergenic
1015454476 6:133410691-133410713 ACAGGAGGGACTGCTGCTGCAGG - Intronic
1016878428 6:148886560-148886582 CCAAGAGATACTGATGCTGCCGG - Intronic
1017159244 6:151349906-151349928 ACAGGAGAGAATGAAGGTGCAGG + Exonic
1017453650 6:154578005-154578027 CCATGAGAAACTGCTGGGGGTGG + Intergenic
1017552543 6:155524573-155524595 CCAGGAGATGCTGATGCTGCTGG - Intergenic
1017951656 6:159140367-159140389 CCAGGTGAGGCTGATGCTGCTGG + Intergenic
1019096854 6:169588714-169588736 CCAGGTCAGGCTGCTGCTGCTGG + Intronic
1019383516 7:740589-740611 CCAGGAGGGACTGGCGGAGCTGG + Intronic
1019787103 7:2983997-2984019 CAAGGAGGGACTGCTCGTTCAGG + Intronic
1020016485 7:4834801-4834823 CCAGGAGCAGCTGCTGGCGCCGG + Exonic
1022310812 7:29194534-29194556 CCAGGAGAGGGTGCGGGAGCTGG + Exonic
1022429621 7:30303722-30303744 CCAGGAGATGCTGATGCTGCTGG - Intronic
1022463348 7:30633197-30633219 CCAGGGGATACTGATGCTGCTGG - Intronic
1022528020 7:31050912-31050934 CCAGGAGAGCTTCCTGGTGGAGG - Intergenic
1023221415 7:37922955-37922977 TGTGGAGAGACTGCTGGTCCAGG + Intronic
1023623502 7:42095269-42095291 CCAGATGAGGCTGCTGCTGCTGG + Intronic
1023876484 7:44289060-44289082 CCACAACAGACTGCTGGTGCAGG + Intronic
1024112835 7:46164024-46164046 CCAGTAGAGGCTGATGTTGCTGG - Intergenic
1024633614 7:51268965-51268987 CCAGAAGACACAGCTGGAGCTGG + Intronic
1024996087 7:55274068-55274090 TCATCAGAGGCTGCTGGTGCTGG + Intergenic
1025206561 7:56996493-56996515 CTAGGAGGCAGTGCTGGTGCTGG + Intergenic
1025259089 7:57405142-57405164 CCAGGAAAGACCCCGGGTGCAGG - Intergenic
1025609762 7:63068012-63068034 CCAGGAAAGACCCCGGGTGCAGG + Intergenic
1025665377 7:63580434-63580456 CTAGGAGGCAGTGCTGGTGCTGG - Intergenic
1026387006 7:69860223-69860245 CAAGGAGAGACAGCTAGTGAGGG + Intronic
1026402366 7:70027497-70027519 CCAGGTGATGCTGCTGCTGCTGG - Intronic
1026461405 7:70618378-70618400 CAGGGAGAGACTGCTGGAGAGGG - Intronic
1026738896 7:72966127-72966149 GCAGGTGAGCCTGCTGGAGCTGG - Exonic
1026821598 7:73553287-73553309 TCAGGAGAGACACCTGCTGCTGG + Intronic
1027104837 7:75398942-75398964 GCAGGTGAGCCTGCTGGAGCTGG + Exonic
1027176275 7:75905827-75905849 CCAGGTGAGGCTGCTGCTCCTGG + Intronic
1027202631 7:76073140-76073162 CCAGGAGATGCTGTTGGGGCGGG + Intergenic
1027436586 7:78171418-78171440 CCATGAGAGTCTGATGCTGCAGG + Intronic
1027440399 7:78213224-78213246 CCAGGTGAGGCTGATGCTGCAGG - Intronic
1028243192 7:88446012-88446034 CCAGGAGATACTGATGCTGCTGG - Intergenic
1028754167 7:94416420-94416442 CCAGGTGAGAGTGGTGCTGCCGG + Exonic
1028754299 7:94417784-94417806 CCAGGAGAGAGGGGTGCTGCTGG + Exonic
1029414708 7:100435708-100435730 CCTGGTGAGCCTGCAGGTGCCGG - Exonic
1029483101 7:100824614-100824636 CGAGCAGAGGCTGCTGGTGTGGG + Intronic
1029532041 7:101131912-101131934 CCAGCTGACACGGCTGGTGCTGG + Exonic
1029576437 7:101406603-101406625 CCAGGAGTACCTGCTGGGGCAGG - Intronic
1030506732 7:110433954-110433976 CCAGGTGATACTGATGTTGCTGG + Intergenic
1030560236 7:111076190-111076212 CCAGGAGACATTGGTGGTGCTGG - Intronic
1030868894 7:114732383-114732405 CAAGGAGAGAGAGCTTGTGCAGG - Intergenic
1031126428 7:117778519-117778541 CCAGGTGATACTGATGCTGCTGG - Intronic
1032015860 7:128380163-128380185 ACAGGAGAGACTGGTAGTGGGGG + Intergenic
1032878062 7:136059044-136059066 ACAGGAGAGGGTTCTGGTGCAGG + Intergenic
1032965522 7:137093142-137093164 CCAGGAATGAGTCCTGGTGCAGG - Intergenic
1033956202 7:146851578-146851600 CAAGGAGAGAGTCCTGGAGCAGG - Intronic
1033980794 7:147162956-147162978 CCTGGAGAAGCTGCTGGTCCAGG - Intronic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1035827769 8:2662923-2662945 TCAGGAGAGGATGCTGATGCTGG + Intergenic
1036682634 8:10886577-10886599 CCTGCAGAGATTGGTGGTGCAGG + Intergenic
1036772150 8:11586674-11586696 CCAGGAGAGACGGATGGATCCGG + Intergenic
1037727831 8:21497891-21497913 CCAGGAGAGAATCCTGGAGCAGG + Intergenic
1037799439 8:22024501-22024523 CCAGGTGAGGCTGATGATGCCGG - Exonic
1037813167 8:22098446-22098468 CCAGGAGAACCTGCTGCTCCTGG + Exonic
1038280402 8:26159072-26159094 CCAGGAAAGGCTGCAGCTGCAGG - Intergenic
1038682252 8:29679632-29679654 CTAGGAGAGTCTCCTGGTGGGGG - Intergenic
1038763947 8:30410281-30410303 CCAGGAGAGGCTGAGGTTGCAGG - Intronic
1040443815 8:47473046-47473068 CCTGGAGAGAGTGCAGGGGCTGG - Intronic
1041762558 8:61382753-61382775 CCAGGAGATGCTGCTGCTGCTGG + Intronic
1045662176 8:104449443-104449465 CCAGGTGACGCTGCTGATGCTGG - Intronic
1046298209 8:112249444-112249466 CCAGGTGAAACTGCTGCTGCCGG + Intronic
1046714621 8:117554029-117554051 CCAGGTGAGGCTGATGATGCTGG - Intergenic
1046819776 8:118622106-118622128 CCAGGAGAGATTGCTCGGCCTGG - Intergenic
1047004808 8:120609470-120609492 TCAGAAGAGACTGCTGCTGCTGG + Intronic
1048340176 8:133532815-133532837 CCAGAAGAGTCCGCAGGTGCTGG + Intronic
1049207827 8:141371595-141371617 CCGGGAGGGATTGCTGGTGGAGG + Intergenic
1049301151 8:141871552-141871574 GCAGGTGAGAGTGCTGGTGGTGG + Intergenic
1049380739 8:142314562-142314584 CCAGAAGAGGCTGCCGGGGCCGG + Intronic
1049578367 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG + Intergenic
1051658446 9:19404639-19404661 CCAGGGGATGCTGCTGCTGCTGG + Intergenic
1053422397 9:37987812-37987834 CCAACACAGGCTGCTGGTGCCGG + Intronic
1054702336 9:68425399-68425421 CCAGGAGCTATTGCTGGTGATGG + Intronic
1055931422 9:81563365-81563387 CCAGGAGACATTTCTGCTGCTGG + Intergenic
1057566348 9:96169120-96169142 CCAGGTGAGGCTGATGCTGCTGG + Intergenic
1058981672 9:110176173-110176195 CCTGGAGATGCTGCTGCTGCTGG + Intergenic
1059157873 9:112005857-112005879 GGAGGAGAGATTGCAGGTGCAGG + Intergenic
1059249635 9:112877115-112877137 CCAGGTGATGCTGCTGCTGCTGG + Intronic
1059393356 9:114014825-114014847 CCAGGTGATACTGATGTTGCTGG + Intronic
1059952971 9:119487000-119487022 CCAGGTGATGCTGCTGCTGCTGG - Intergenic
1061006231 9:127929792-127929814 CCAGGCGAGACTGCTTGTCTCGG + Exonic
1061063101 9:128260620-128260642 GGAGGAGAGGCTGCTGGAGCTGG - Exonic
1061065882 9:128277032-128277054 GGAGGAGAGATGGCTGGTGCTGG - Intronic
1061478552 9:130884991-130885013 CCTGCAGAGGCTGCTGGTGGGGG - Exonic
1061543283 9:131289744-131289766 CCCGGAGGCTCTGCTGGTGCAGG + Exonic
1061713876 9:132506473-132506495 CCAGGAGCGCCAGCTGCTGCCGG - Intronic
1061799756 9:133107329-133107351 CCAGCCCAGACTGCTGGGGCAGG - Intronic
1062021331 9:134320804-134320826 ACAGGAGAGACTGCTGTTGCAGG - Intronic
1062352554 9:136146228-136146250 CCAGGGGTGGCTGCTGGGGCTGG - Intergenic
1062436794 9:136549970-136549992 CCAGGGGTGCCTGCAGGTGCTGG + Intergenic
1062653061 9:137588270-137588292 CCAGGAGGGACTGCTAAGGCAGG + Intronic
1185954322 X:4472741-4472763 CCAGAGGAAACTGCAGGTGCTGG - Intergenic
1186470830 X:9821042-9821064 CCAGGGGATACTGATGCTGCTGG - Intronic
1186610001 X:11129777-11129799 CCAGGAGATGCTGATGCTGCTGG + Intergenic
1186616963 X:11199327-11199349 CCAGGCGATACTGATGCTGCTGG - Intronic
1187568354 X:20475387-20475409 CCAGGTGGGACTGATGCTGCTGG + Intergenic
1187717552 X:22118256-22118278 CCAGGTGCGACTGCTGCTGCTGG + Intronic
1187927075 X:24260353-24260375 CCAGGTGAAACTGATGCTGCTGG + Intergenic
1187991171 X:24874724-24874746 CCAGGTGATACTGCCGCTGCTGG - Intronic
1188612997 X:32122240-32122262 CCAGGTGATACTGATGCTGCTGG - Intronic
1188833664 X:34931521-34931543 CCAGGAGTGAGTCCTGGTGCAGG - Intergenic
1191668851 X:63730614-63730636 CCAGGTGATACTGATGCTGCTGG + Intronic
1191911876 X:66160345-66160367 CCAGGGGATGCTGCTGCTGCTGG - Intergenic
1191955777 X:66641080-66641102 CCAGGTGATATTGATGGTGCTGG + Intergenic
1193603206 X:83534352-83534374 CCAGGAGTGAGTACTGGTGTGGG - Intergenic
1193917164 X:87379422-87379444 CAAGGTGAGACTGATGGTGGTGG + Intergenic
1195869413 X:109470642-109470664 TCAGGTGACACTGCTGCTGCTGG - Intronic
1196084614 X:111671856-111671878 CCAACAGAGACTTCTGGTTCTGG - Intronic
1197379568 X:125722589-125722611 CAAAGAGAGAGTGCTTGTGCAGG - Intergenic
1197970484 X:132110189-132110211 CCAGGTGAGACCGATGCTGCTGG + Intronic
1199656429 X:149999577-149999599 CAGAGAGAGGCTGCTGGTGCTGG + Intergenic
1200714364 Y:6520635-6520657 GCAGGAGACAGTGCTGGTGTTGG + Intergenic
1200839534 Y:7766567-7766589 CCAGGAGATGCTGATGATGCTGG + Intergenic
1201019459 Y:9640521-9640543 GCAGGAGACAGTGCTGGTGTTGG - Intergenic
1201460934 Y:14223539-14223561 CCAGGAGAGACTTCTAGATCAGG + Intergenic
1202367003 Y:24172459-24172481 GCAGGAGAGGCTGCTGGAGAGGG + Intergenic
1202503778 Y:25497664-25497686 GCAGGAGAGGCTGCTGGAGAGGG - Intergenic