ID: 1034860471

View in Genome Browser
Species Human (GRCh38)
Location 7:154590883-154590905
Sequence CATTATGGGCTGAGATACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860471_1034860475 -8 Left 1034860471 7:154590883-154590905 CCACTGTATCTCAGCCCATAATG 0: 1
1: 0
2: 0
3: 19
4: 329
Right 1034860475 7:154590898-154590920 CCATAATGATGGCCTCGACAAGG No data
1034860471_1034860476 2 Left 1034860471 7:154590883-154590905 CCACTGTATCTCAGCCCATAATG 0: 1
1: 0
2: 0
3: 19
4: 329
Right 1034860476 7:154590908-154590930 GGCCTCGACAAGGAATGAGATGG 0: 1
1: 0
2: 1
3: 7
4: 74
1034860471_1034860479 25 Left 1034860471 7:154590883-154590905 CCACTGTATCTCAGCCCATAATG 0: 1
1: 0
2: 0
3: 19
4: 329
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860471 Original CRISPR CATTATGGGCTGAGATACAG TGG (reversed) Intronic
902923692 1:19682027-19682049 CATTAGAGTCTGACATACAGGGG + Intergenic
903083535 1:20833499-20833521 GATTTTGGGCTGAGACAAAGGGG + Intronic
904171361 1:28593868-28593890 CCTCCTGGGCTGAGACACAGCGG - Exonic
906041309 1:42789700-42789722 CATTCTGGGATGAGATCTAGTGG + Intronic
906226128 1:44123123-44123145 CATTTTGGGCTGGAATACAGTGG - Intronic
906819309 1:48912687-48912709 CATTAGGGGCTTACATACAGGGG - Intronic
907627428 1:56043758-56043780 CATGCTGGGCTGAGGCACAGAGG + Intergenic
907695671 1:56725736-56725758 CATTAGTGTCTGAGATTCAGAGG - Intronic
909138238 1:71829544-71829566 AATTATGGGCTGGACTACAGCGG - Intronic
910560656 1:88586909-88586931 CATATTGGGCTGAGATGCTGGGG - Intergenic
910897576 1:92084671-92084693 TATTAGGGGCTTACATACAGGGG - Intronic
911462980 1:98213944-98213966 GATTTTGGGCTGAGATAATGGGG + Intergenic
911494359 1:98613294-98613316 GATTTTGGGCTGAGATAATGGGG - Intergenic
911699605 1:100936508-100936530 CTTGATGAGCAGAGATACAGAGG - Intronic
912800622 1:112717619-112717641 CACTGTGGCCTGAGATAAAGGGG - Intergenic
913011088 1:114684455-114684477 CAGAATGGGCTGCGATACACAGG - Intronic
913447595 1:118966374-118966396 CATTCTGGGCTTAGAAACACTGG + Intronic
916905186 1:169275577-169275599 GATTTTGGGCTGAGATAATGGGG + Intronic
917068426 1:171123153-171123175 ACATATGGGCTGAGACACAGTGG - Intergenic
918080011 1:181199847-181199869 GATTTTGGGCTGAGACACTGGGG - Intergenic
918856192 1:189759039-189759061 GATTTTGGGCTGAGATAATGGGG - Intergenic
919457100 1:197833371-197833393 GATTTTGGGCTGAGATAGTGGGG - Intergenic
921277817 1:213536860-213536882 TATTAGGGGCTTACATACAGGGG + Intergenic
921518424 1:216127286-216127308 CATTGATGACTGAGATACAGAGG + Intronic
1063330100 10:5149465-5149487 CATTTTTGGCTGAGATAGAAAGG - Intergenic
1065254581 10:23852905-23852927 CATTTTGGGCTGAGACAATGGGG + Intronic
1065537766 10:26731383-26731405 CATAATGGGATCTGATACAGAGG - Intronic
1066291432 10:34017670-34017692 CTTTAGGGGTTAAGATACAGCGG + Intergenic
1066516053 10:36161953-36161975 GATTTTGGGCTGAGATAATGGGG - Intergenic
1069370587 10:67743751-67743773 GATTTTGGGCTGAGATAGTGGGG - Intergenic
1070234062 10:74605135-74605157 GATTTTGGGCTGAGATGCTGGGG + Intronic
1070688478 10:78507504-78507526 CAGCATGGGCTGAGGCACAGAGG - Intergenic
1071066355 10:81640836-81640858 GATTTTGGGCTGAGATAATGGGG + Intergenic
1072194747 10:93107668-93107690 CATTATGTACAGAGAAACAGAGG - Intergenic
1072387849 10:94950437-94950459 GATTTTGGGCTGAGACAAAGGGG - Intronic
1072748607 10:97959736-97959758 TATTAGGGGCTTACATACAGAGG - Intronic
1074221211 10:111440069-111440091 CTTGTTGAGCTGAGATACAGTGG + Intergenic
1074975976 10:118581961-118581983 TATTAGGGGCTTACATACAGGGG - Intergenic
1075072123 10:119326417-119326439 CCTCCTGGGCTGAGAGACAGAGG - Intronic
1077783644 11:5359242-5359264 CATTTTGGGCTGAGACAGTGGGG - Intronic
1078111808 11:8400719-8400741 GATTTTGGGCTGAGATAATGGGG - Intronic
1078370875 11:10743966-10743988 TATTAGGGGCTCACATACAGGGG - Intergenic
1079799458 11:24851004-24851026 CATTTTGGACTGAGATAATGGGG + Intronic
1082147434 11:48687231-48687253 GATTTTGGGCTGAGATAATGGGG - Intergenic
1082155086 11:48800338-48800360 GATTTTGGGCTGAGATAATGGGG + Intergenic
1082311047 11:50648948-50648970 GATTATGGGCTGAGACAATGGGG + Intergenic
1082943473 11:58733319-58733341 CATTTTGGGATCAGATACAAGGG + Intergenic
1083161489 11:60857089-60857111 CATTAGGTGCTGAGATGCTGAGG - Intergenic
1088839107 11:113608191-113608213 GATTTTGGGCTGAGATAATGGGG - Intergenic
1090752026 11:129755032-129755054 GATTTTGGGCTGAGATGAAGGGG - Intergenic
1091357894 11:134951989-134952011 CAGTAGGGGTTGAGACACAGTGG + Intergenic
1093184050 12:15999540-15999562 CATTTTGGGCTGAGAGTCACTGG + Intronic
1093396701 12:18691957-18691979 CATTCTCAGCTGAGATAAAGTGG + Intronic
1093559528 12:20521794-20521816 CATTAGGAGCTTACATACAGTGG + Intronic
1094325308 12:29231501-29231523 CATCATGGTCTGAAATGCAGAGG + Intronic
1094453531 12:30606665-30606687 GATTTTGGGCTGAGATAATGGGG - Intergenic
1095131375 12:38547459-38547481 CATTGTGGCCTGAGGTAAAGAGG - Intergenic
1096927338 12:55163491-55163513 CATTTTGGGCTGAGACAATGGGG + Intergenic
1097604366 12:61734165-61734187 GATTTTGGGCTGAGATAATGGGG + Intronic
1099324561 12:81197915-81197937 CATATTGGGGTGTGATACAGGGG - Intronic
1099962579 12:89410869-89410891 CATTTTGGGCTGAGACAGTGGGG - Intergenic
1103180239 12:118904851-118904873 GATTTTGGGCTGAGATAATGGGG + Intergenic
1105705969 13:22967585-22967607 CCCTGTGTGCTGAGATACAGGGG - Intergenic
1105858870 13:24392569-24392591 CCCTGTGTGCTGAGATACAGGGG - Intergenic
1106479933 13:30129714-30129736 CATTATGCCCTGAGGTAAAGAGG - Intergenic
1107707581 13:43122761-43122783 CACAATGGGGTGAGATACAGAGG - Intergenic
1107817135 13:44254332-44254354 GATTAAGGGCTCACATACAGGGG - Intergenic
1108237229 13:48420636-48420658 GATTTTGGGCTGAGATAATGGGG - Intronic
1108307636 13:49154411-49154433 GATTTTGGGCTGAGACACTGGGG + Intronic
1108974337 13:56419106-56419128 CATTATTGGCTGGGGCACAGTGG - Intergenic
1109839077 13:67899696-67899718 GATTTTGGGCTGAGATGCTGGGG - Intergenic
1109884742 13:68527388-68527410 GATTTTGGGCTGAGATGCTGGGG - Intergenic
1110368768 13:74717941-74717963 CACTATGGGCTGAAAAACAAAGG + Intergenic
1110391237 13:74976950-74976972 GATGATGGCTTGAGATACAGTGG - Intergenic
1110485399 13:76035428-76035450 CATCATGGGCTGATATATAAAGG - Intergenic
1112637158 13:101227650-101227672 CATTGAGGGCTTACATACAGGGG - Intronic
1114712878 14:24796042-24796064 CATTATCTAATGAGATACAGCGG - Intergenic
1114765542 14:25366662-25366684 GATTTTGGGCTGAGATAATGGGG + Intergenic
1115000443 14:28415145-28415167 GATTTTGGGCTGAGATAATGGGG - Intergenic
1115189484 14:30731745-30731767 GATTTTGGGCTGAGATAATGGGG + Intronic
1115554121 14:34530790-34530812 CAGTATGAGGTCAGATACAGTGG + Intronic
1116295328 14:43100224-43100246 CATTAAGGGCTGAGATTCTCTGG - Intergenic
1117636011 14:57744325-57744347 GATTTTGGGCTGAGACAAAGGGG - Intronic
1117792283 14:59353667-59353689 CATTTTGGTCTGACCTACAGGGG - Intronic
1118519043 14:66560633-66560655 GATTTTGGGCTGAGACAAAGGGG + Intronic
1120803062 14:88714232-88714254 CATTTTTGACTAAGATACAGTGG + Intronic
1120935537 14:89892195-89892217 CCTCCTGGGCTGAGACACAGCGG - Intronic
1123176887 14:106428373-106428395 GATTTTGGGCTGAGATAATGGGG - Intergenic
1123391490 15:19878495-19878517 CATTATGTGCTTTGAGACAGTGG + Intergenic
1124191067 15:27576675-27576697 CATTGTTGGTTGAGAGACAGTGG - Intergenic
1126996081 15:54446682-54446704 GATTTTGGGCTGAGATAATGGGG + Intronic
1127452183 15:59127433-59127455 GATTTTGGGCTGAGATACTGGGG + Intergenic
1127471539 15:59294847-59294869 CATCATGGACTAAGATGCAGAGG - Intronic
1127608023 15:60609633-60609655 CATTTTGGGTTGAGATGCGGCGG - Intronic
1127915374 15:63450803-63450825 TATTAAGGGCTTACATACAGGGG + Intergenic
1128416382 15:67450114-67450136 GATTTTGGGCTGAGATGAAGGGG + Intronic
1130216248 15:81973056-81973078 CATAATGGGCTAAGATACAATGG + Intergenic
1130245731 15:82246727-82246749 CATTACGTTTTGAGATACAGTGG + Intronic
1130863694 15:87913706-87913728 CATTAGGGGCTGTAATAAAGTGG + Intronic
1131425366 15:92341474-92341496 TATTAGGGGCTTACATACAGGGG - Intergenic
1136270697 16:29146599-29146621 GATTCTGGACTGAGATTCAGTGG + Intergenic
1136727409 16:32371565-32371587 GATTTTGGGCTGAGACACTGGGG - Intergenic
1137824648 16:51481144-51481166 GATTTTGGGCTGAGACAAAGGGG + Intergenic
1138838967 16:60474439-60474461 TATTAGGGGCTCACATACAGGGG - Intergenic
1138847306 16:60581983-60582005 CATGAGGGGCTGGGATAGAGGGG - Intergenic
1140904556 16:79399245-79399267 CATTATGGGCTGTGCTAAGGAGG + Intergenic
1142074276 16:88108380-88108402 GATTCTGGACTGAGATTCAGTGG + Intronic
1202999024 16_KI270728v1_random:146185-146207 GATTTTGGGCTGAGACACTGGGG + Intergenic
1203130622 16_KI270728v1_random:1682593-1682615 GATTTTGGGCTGAGACACTGGGG + Intergenic
1142532408 17:590269-590291 GATTTTGGGCTGAGATAATGGGG + Intronic
1142936623 17:3339159-3339181 GATTTTGGGCTGAGATGAAGGGG + Intergenic
1152563602 17:81090575-81090597 CATTTTGGGGTGGGAAACAGAGG + Intronic
1153511809 18:5862912-5862934 GATTTTGGGCTGAGATAATGGGG - Intergenic
1154497011 18:14969163-14969185 CAGTAGGGGTTGAGACACAGTGG - Intergenic
1155072575 18:22329342-22329364 CATTAGGGGCTTACATAGAGGGG + Intergenic
1155400548 18:25434481-25434503 CATTATTGACTGTGATTCAGAGG + Intergenic
1156709743 18:39928499-39928521 CATTTTGGGCTGAGACAATGGGG - Intergenic
1157336841 18:46746316-46746338 GATTTTGGGCTGAGATAATGGGG - Intronic
1159126270 18:64228275-64228297 GATTATGGGCTGAGATGATGGGG + Intergenic
1159984453 18:74825441-74825463 GATTTTGGGCTGAGATGCTGGGG - Intronic
1165674645 19:37711342-37711364 TATTTTGGGCAGTGATACAGAGG - Intronic
1167390557 19:49191860-49191882 CATCAGGGACTGAGATACTGAGG + Intronic
929358629 2:41056205-41056227 GATTTTGGGCTGAGATAATGGGG + Intergenic
929395248 2:41514978-41515000 GATTTTGGGCTGAGATAATGGGG + Intergenic
930433740 2:51314597-51314619 GATTTTGGGCTGAGATAATGGGG + Intergenic
931163923 2:59724818-59724840 CAGTTTGGTCTGAGAAACAGTGG + Intergenic
931212928 2:60214649-60214671 CAATATGGGCTGTGATAAATGGG - Intergenic
932990230 2:76777651-76777673 GATTATGGGCTGAGACAATGGGG + Intronic
933066029 2:77797487-77797509 AATAATGGTCTGAGATTCAGAGG - Intergenic
933069941 2:77844536-77844558 GATTTTGGGCTGAGACACTGGGG - Intergenic
933596957 2:84291913-84291935 CATTAGGGGTTGGGAAACAGGGG - Intergenic
934012471 2:87838200-87838222 CTTTATGGGATGAGATAGGGAGG - Intergenic
935720492 2:105974848-105974870 CCTTCTGGGCTCAGGTACAGAGG - Intergenic
939783650 2:146481126-146481148 CATTAAGGGAAAAGATACAGTGG - Intergenic
939870163 2:147517914-147517936 GATTTTGGGCTGAGACAAAGGGG + Intergenic
940253041 2:151700756-151700778 GATTTTGGGCTGAGACACTGGGG + Intronic
940453010 2:153864555-153864577 GATTTTGGGCTGAGACACTGGGG + Intergenic
940644076 2:156372156-156372178 GATTTTGGGCTGAGATGCTGGGG + Intergenic
942386206 2:175446040-175446062 CATTATGCTCTGAAATACATTGG + Intergenic
942504123 2:176623688-176623710 CATTTTGGGCTGAGACAATGGGG + Intergenic
943401124 2:187412052-187412074 CATTAAGGACAGAGATGCAGAGG + Intronic
944335561 2:198529631-198529653 GATTTTGGGCTGAGACACTGGGG - Intronic
946182279 2:217955879-217955901 CATTACAGGCTCAGAGACAGGGG + Intronic
946764636 2:223029198-223029220 TATTATGGGCAGTGATTCAGTGG - Intergenic
948321205 2:237071346-237071368 CACTAAGTGCTGGGATACAGCGG - Intergenic
948368214 2:237472368-237472390 CATTTTAGGCAGAGGTACAGGGG + Intergenic
1171142682 20:22756751-22756773 CATTATGGCATCAGATAGAGAGG - Intergenic
1171522316 20:25785404-25785426 CATCCTGGGCTGGGGTACAGAGG - Intronic
1171530064 20:25847349-25847371 CATCCTGGGCTGGGGTACAGAGG - Intronic
1171554511 20:26070479-26070501 CATCCTGGGCTGGGGTACAGAGG + Intergenic
1171722138 20:28573717-28573739 TATTTTGGGCTGAGATAATGGGG + Intergenic
1171966861 20:31537025-31537047 CAGTATGGGCTGAATTACTGAGG + Intronic
1173750759 20:45474070-45474092 GATTTTGGGCTGAGATAATGGGG + Intronic
1175025073 20:55893491-55893513 TAATATGGGCTGTGAAACAGAGG - Intergenic
1175314016 20:58033319-58033341 CCTTATGGGCTGAGCTAAAGAGG + Intergenic
1175535958 20:59712609-59712631 TATGATGGGCTATGATACAGAGG - Intronic
1176038140 20:63050231-63050253 CACCATGGGCAGAGATGCAGAGG - Intergenic
1176908945 21:14539392-14539414 GATTTTGGGCTGAGATAATGGGG - Intronic
1177005518 21:15667774-15667796 CATGATGGGCTGTGGTCCAGAGG - Intergenic
1177463745 21:21446650-21446672 CATTTTGGGCTGAGATGATGGGG - Intronic
1180128368 21:45807287-45807309 GATTTTGGGCTGAGATAATGGGG - Intronic
1181342315 22:22192065-22192087 GATTTTGGGCTGAGATAATGGGG - Intergenic
1181873495 22:25922052-25922074 CACCATGTGCAGAGATACAGAGG - Intronic
1182420579 22:30246693-30246715 CATTATGGGCTGCACTTCAGAGG + Exonic
1182557566 22:31137482-31137504 CATCATTGGCTGAGATAAAGAGG + Intronic
1182941557 22:34282087-34282109 GATGATGGGCTCAAATACAGAGG - Intergenic
952550204 3:34468201-34468223 GATTTTGGGCTGAGATAATGGGG + Intergenic
953948598 3:47170081-47170103 CAGTGTGGGCTGAGATGCTGAGG - Intergenic
954513464 3:51149231-51149253 GATTTTGGGCTGAGATAATGGGG + Intronic
955072375 3:55582827-55582849 GATCATGTGCTGAGATACTGAGG - Intronic
957700346 3:83702129-83702151 GATTTTGGGCTGAGATAACGGGG + Intergenic
957738467 3:84232135-84232157 GATTTTGGGCTGAGACACTGGGG + Intergenic
958886680 3:99735042-99735064 GATTTTGGGCTGAGATAATGGGG + Intronic
961390176 3:126547891-126547913 CATCATGGAATGAGAAACAGTGG + Intronic
961460038 3:127044316-127044338 CATTCAGGGCTGAGAAGCAGAGG + Intergenic
963689637 3:148482385-148482407 GATTTTGGGCTGAGATGCTGGGG - Intergenic
963691269 3:148505755-148505777 GATTTTGGGCTGAGATGCTGGGG + Intergenic
963734704 3:149006785-149006807 CACTAATGGCTGAGGTACAGAGG - Intronic
964408087 3:156370796-156370818 TATTAAGGGCTCACATACAGGGG + Intronic
964783134 3:160363117-160363139 GATTTTGGGCTGAGATAATGGGG - Intronic
965085131 3:164085521-164085543 GATTTTGGGCTGAGATGAAGGGG + Intergenic
965511334 3:169571090-169571112 GATTTTGGGCTGAGATGAAGGGG - Intronic
966407524 3:179613303-179613325 CATTATAAGCTGAGAGAAAGAGG - Intronic
966841877 3:184096282-184096304 CATTAGGGACAGAGATAAAGAGG + Intergenic
971934908 4:33135319-33135341 CATTATGTTCTGATCTACAGTGG + Intergenic
974111743 4:57533745-57533767 GATTATGGGCTGAGACAATGGGG + Intergenic
975149007 4:71000908-71000930 GATTATGGGCTGAGATGATGGGG + Intronic
975531618 4:75405311-75405333 GATTTTGGGCTGAGATAATGGGG - Intergenic
976028359 4:80719856-80719878 TATTAGGGGCTTAAATACAGAGG - Intronic
977457737 4:97282841-97282863 GATTTTGGGCTGAGATAATGAGG - Intronic
977506245 4:97907116-97907138 GATTTTGGGCTGAGATAATGGGG - Intronic
977629736 4:99229015-99229037 GATTTTGGGCTGAGATAATGGGG + Intergenic
977986579 4:103389626-103389648 CATTTTGGGCTGAGATGATGGGG - Intergenic
978068883 4:104441257-104441279 GATTTTGGGCTGAGATAATGGGG - Intergenic
978275034 4:106939211-106939233 GATTTTGGGCTGAGATAATGGGG - Intronic
978391118 4:108226352-108226374 AACTATGGGCTGAGATCCTGGGG + Intergenic
978937557 4:114396532-114396554 CATCATGGTCTGAGGTACAGGGG - Intergenic
979141461 4:117181281-117181303 CATTTTGGGCTGAGATGATGGGG + Intergenic
979141811 4:117184836-117184858 CATTTTGGGCTGAGATGATGGGG - Intergenic
979587853 4:122442230-122442252 GATTTTGGGCTGAGATAATGGGG + Intergenic
980558371 4:134439036-134439058 CATTTTGGGCTGAGACAATGGGG + Intergenic
980789210 4:137596700-137596722 GATTTTGGGCTGAGATAATGGGG - Intergenic
980813571 4:137914901-137914923 GATTTTGGGCTGAGACAAAGGGG + Intergenic
980998159 4:139801490-139801512 AAACATGGGCTGAGAAACAGTGG + Intronic
981537647 4:145816287-145816309 CCATATGGGCAGAGATAAAGGGG + Intronic
981607418 4:146554826-146554848 GATTTTGGGCTGAGATAATGGGG + Intergenic
981940341 4:150275530-150275552 GATTTTGGGCTGAGATGCTGGGG - Intronic
983137677 4:164104865-164104887 GATTTTGGGCTGAGATAATGGGG - Intronic
983312225 4:166079210-166079232 CCTTATGGGCTGAAATATAGAGG + Intronic
984268737 4:177525198-177525220 CATTTTGGGCTGAGATGATGGGG - Intergenic
984324788 4:178238563-178238585 CATTGTAGAATGAGATACAGAGG - Intergenic
984344566 4:178505994-178506016 CTTCACGGGCTGAGATACTGGGG - Intergenic
984372783 4:178888175-178888197 GATTTTGGGCTGAGATAATGGGG - Intergenic
984903514 4:184606060-184606082 GATTTTGGGCTGAGACAAAGGGG - Intergenic
987833206 5:23125503-23125525 GATTTTGGGCTGAGACACTGGGG + Intergenic
988257833 5:28844762-28844784 CATTTTGGGCTGAGACAATGGGG - Intergenic
988260214 5:28876385-28876407 CATTTTGGGCTGAGACAATGGGG + Intergenic
990005328 5:50938650-50938672 CATTATGGGCAGACAAAGAGGGG + Intergenic
991280460 5:64907555-64907577 GATTGTGGGCTGAGACACTGGGG + Intronic
992689490 5:79228990-79229012 CATCATGGGCTGTGTTAGAGGGG + Intronic
993445839 5:88011361-88011383 GATTTTGGGCTGAGATAATGGGG + Intergenic
994511024 5:100703904-100703926 GATTATGGGCTGAGACAATGGGG - Intergenic
994743571 5:103651304-103651326 CATTATGAGCTGTGATAATGGGG - Intergenic
994877694 5:105446789-105446811 CATTCAGGCCTGAGAAACAGAGG + Intergenic
994911814 5:105919495-105919517 CATTATTTGCTGAGACACTGTGG - Intergenic
995937050 5:117529490-117529512 AATTTTGGGCTGAGACACTGGGG + Intergenic
995951696 5:117721941-117721963 CATCATGGACAGAGATACACTGG + Intergenic
996289311 5:121832857-121832879 CATTCTTGGCAGAAATACAGAGG - Intergenic
996569350 5:124915423-124915445 TATTTTGGGCTGAGATAATGGGG - Intergenic
996906465 5:128606707-128606729 CATTTTGGGCTGAGACAATGGGG + Intronic
996937971 5:128969655-128969677 GATTTTGGGCTGAGATGCTGGGG + Intronic
997726117 5:136121034-136121056 CATTATGGACAGAGCTACAGGGG - Intergenic
998146941 5:139734411-139734433 CATTATGCGCTGAGACAGAGAGG - Intergenic
998289421 5:140899082-140899104 GATTTTGGGCTGAGATAATGGGG + Intronic
999002891 5:147943001-147943023 CATTTTGGGCTGAGACAATGGGG + Intergenic
999009855 5:148024197-148024219 CATTTTGGGCTGAGACAATGGGG - Intergenic
1000935054 5:167297404-167297426 CAATGTGGGCTGAGAAGCAGGGG - Intronic
1005182489 6:23121851-23121873 GATTTTGGGCTGAGATGAAGGGG + Intergenic
1005318434 6:24627534-24627556 GATTATGGTCTGATAAACAGAGG + Intronic
1008556029 6:52673475-52673497 CATTAGGGGCTTACAAACAGAGG - Intronic
1009393607 6:63171211-63171233 GATTTTGGGCTGAGATAATGGGG - Intergenic
1011539050 6:88410621-88410643 GATTTTGGGCTGAGATAATGGGG - Intergenic
1011550024 6:88523098-88523120 GATTTTGGGCTGAGATAATGGGG + Intergenic
1011769187 6:90656417-90656439 TATTCTAGGCTGAGATGCAGAGG + Intergenic
1012552593 6:100477705-100477727 CACTATAGGCTGAGTGACAGAGG + Intergenic
1013242157 6:108256195-108256217 CACTCTAGGCTGAGAGACAGAGG + Intronic
1013388432 6:109656974-109656996 CATTTTGGGGTGAGAAGCAGGGG + Intronic
1013715700 6:112958779-112958801 GATTTTGGGCTGAGATAATGGGG - Intergenic
1014101978 6:117520957-117520979 CAATAGAGGCTAAGATACAGTGG - Intronic
1014707708 6:124767894-124767916 CATCATGTGCTGAAATATAGTGG - Intronic
1014922804 6:127232475-127232497 CATTTTGGGCTGAGATGATGGGG - Intergenic
1015197773 6:130542840-130542862 GATTTTGGGCTGAGATAATGGGG - Intergenic
1016590802 6:145741433-145741455 GATTATGGGCTGAGACAATGGGG + Intergenic
1018117284 6:160599596-160599618 CATTATGGACAGAGTTACCGAGG - Exonic
1019362223 7:610723-610745 CATTAAGTGCTGAGAGAAAGAGG - Intronic
1022243408 7:28534333-28534355 CAGGGTGGGCTGAGACACAGAGG - Intronic
1022505529 7:30906945-30906967 CATGGTGGGCAGAGACACAGAGG + Intergenic
1022655131 7:32312004-32312026 GATTTTGGGCTGAGATAATGGGG - Intergenic
1022672447 7:32468652-32468674 GATTTTGGGCTGAGATAATGGGG - Intergenic
1024796530 7:53028211-53028233 GATTTTGGGCTGAGACACTGGGG + Intergenic
1025121772 7:56310448-56310470 GATTTTGGGCTGAGATGCTGGGG + Intergenic
1026396051 7:69955506-69955528 TATTAGGGGCTTACATACAGGGG + Intronic
1027736585 7:81939954-81939976 GACTATGTCCTGAGATACAGAGG + Intergenic
1028381309 7:90203051-90203073 CATTTTGGGCTGAGACAATGGGG - Intronic
1028633271 7:92959516-92959538 GATTATGGGCTGAGATGAAGGGG - Intergenic
1029528841 7:101112087-101112109 CATTATGGCCTCAGCCACAGTGG + Intergenic
1032651545 7:133884222-133884244 TATTATGGGCTTACATACAGGGG + Intronic
1034445839 7:151113923-151113945 GATGATGGGCTGAGATCAAGTGG - Intronic
1034860471 7:154590883-154590905 CATTATGGGCTGAGATACAGTGG - Intronic
1035067005 7:156113439-156113461 TATTATGGGATTAGATTCAGGGG - Intergenic
1036094484 8:5708665-5708687 GATTTTGGGCTGAGATAATGGGG + Intergenic
1036716712 8:11132032-11132054 CATTCTGTGCTCTGATACAGTGG + Intronic
1037050838 8:14371938-14371960 CAATATGGGCTGACATAAACTGG + Intronic
1037725665 8:21480705-21480727 TATTAGGGGCTTACATACAGGGG - Intergenic
1037782764 8:21882014-21882036 GATTATGGGCTGAGACTGAGGGG - Intergenic
1038126163 8:24675199-24675221 TATCATGACCTGAGATACAGTGG + Intergenic
1039585612 8:38704679-38704701 CAGTGTGGGCTGAGAAGCAGAGG - Intergenic
1041499915 8:58529459-58529481 CATTAAGGGCTTATATACAGGGG + Intergenic
1041805689 8:61846889-61846911 GATTTTGGGCTGAGATAATGGGG + Intergenic
1042458805 8:69038033-69038055 GATTTTGGGCTGAGATAATGGGG + Intergenic
1042647040 8:70998437-70998459 CATTATGGGGTGGGAGAGAGCGG - Intergenic
1042687271 8:71456006-71456028 GATTTTGGGCTGAGATAATGGGG - Intronic
1042844707 8:73158464-73158486 CCTCATGGGCTGAGCCACAGGGG - Intergenic
1043014560 8:74921823-74921845 TATTATGGGCTGGGAGGCAGGGG - Intergenic
1043630992 8:82333263-82333285 CGATATGGACTGAGAAACAGAGG + Intergenic
1044154513 8:88826986-88827008 AATTTTGGGCTGAGATAATGGGG - Intergenic
1044156649 8:88856523-88856545 GATTTTGGGCTGAGATAATGGGG + Intergenic
1045177667 8:99743075-99743097 GATTTTGGGCTGAGATAATGGGG - Intronic
1045870510 8:106921870-106921892 CAATGTGGCCTGTGATACAGAGG - Intergenic
1045973770 8:108108398-108108420 GATTTTGGGCTGAGATAATGGGG - Intergenic
1046205307 8:110986479-110986501 GATTTTGGGCTGAGACGCAGGGG + Intergenic
1046370705 8:113303010-113303032 CATTTTGGGCTGAGATGATGGGG - Intronic
1046957688 8:120078442-120078464 CATTATGTTCGGAGGTACAGAGG - Intronic
1046967049 8:120179288-120179310 GATTTTGGGCTGAGATAATGGGG - Intronic
1047496540 8:125412900-125412922 CATTGTGTGCTGTGTTACAGCGG - Intergenic
1047982540 8:130197972-130197994 TATTAGGGGCTTACATACAGGGG - Intronic
1050146237 9:2570885-2570907 ATTTATGGCCTGAGATACAGGGG + Intergenic
1050774568 9:9243889-9243911 GATTATGGGCTGAGATGATGGGG - Intronic
1051669428 9:19494941-19494963 TATTAGGGGCTCACATACAGGGG + Intergenic
1051816264 9:21109562-21109584 CATTATTGGCTAAGATTCTGGGG - Intergenic
1052719186 9:32153186-32153208 GATTTTGGGCTGAGATAATGGGG - Intergenic
1052893580 9:33726309-33726331 GATTTTGGGCTGAGATGAAGGGG - Intergenic
1053463972 9:38291459-38291481 CTTCATGGGCTGAGATGAAGTGG + Intergenic
1053560105 9:39183436-39183458 CAATATGGGGTGAGGCACAGGGG + Intronic
1053824214 9:42003671-42003693 CAATATGGGGTGAGGCACAGTGG + Intronic
1054135474 9:61416635-61416657 CATTTTGGGCTGAGACAATGGGG + Intergenic
1054137013 9:61435519-61435541 CAATATGGGGTGAGGCACAGTGG - Intergenic
1054606359 9:67183692-67183714 CAATATGGGGTGAGGCACAGTGG - Intergenic
1058096813 9:100871017-100871039 CATTTTGGGCTGAGATGATGGGG - Intergenic
1058560772 9:106226633-106226655 CATCATGAGCAGAGATACAGAGG + Intergenic
1058760073 9:108122057-108122079 CATTATGGGTTTACATACAGGGG + Intergenic
1059865410 9:118508781-118508803 GATTTTGGGCTGAGATAATGGGG - Intergenic
1060052534 9:120387481-120387503 TATTAGGGGCTTACATACAGGGG - Intergenic
1061352190 9:130074141-130074163 GATTATGGGCTGAGAAGCAGAGG - Intronic
1061457474 9:130709502-130709524 CTTTAGGTGCTGAGACACAGTGG - Intergenic
1062489188 9:136796291-136796313 CATAATGGGCTGAGGTTCTGGGG + Intronic
1186743507 X:12542337-12542359 GATTTTGGGCTGAGATAATGGGG - Intronic
1186921655 X:14288501-14288523 GATTTTGGGCTGAGATGAAGGGG + Intergenic
1187292374 X:17967428-17967450 CATTATGGTTTGAGAGACATTGG - Intergenic
1190453445 X:50603242-50603264 CAGGATGGGTTGAGATCCAGGGG - Intronic
1190601139 X:52094040-52094062 GATTTTGGGCTGAGATAATGGGG - Intergenic
1190975929 X:55400772-55400794 GATTTTGGGCTGAGATAATGGGG - Intergenic
1191002010 X:55670218-55670240 GATTTTGGGCTGAGATAATGGGG + Intergenic
1191002786 X:55678957-55678979 CATTTTGGGCTGAGATGATGGGG + Intergenic
1192823900 X:74674239-74674261 GATTTTGGGCTGAGATAATGGGG + Intergenic
1192879579 X:75269008-75269030 GATTTTGGGCTGAGATAATGGGG - Intergenic
1192918667 X:75682410-75682432 GATTTTGGGCTGAGATGAAGGGG + Intergenic
1192919549 X:75692049-75692071 GATTTTGGGCTGAGATGAAGGGG + Intergenic
1193663608 X:84287869-84287891 TATTAAGGGCTTACATACAGGGG - Intergenic
1194416540 X:93619028-93619050 GATTTTGGGCTGAGATAATGGGG + Intergenic
1195991188 X:110683966-110683988 TATTAGGGGCTGACATACAGGGG - Intronic
1196212837 X:113014293-113014315 CATTATGAGCAAAGATGCAGAGG + Intergenic
1196240634 X:113339718-113339740 CATTTTGGGCTGAGACAATGGGG + Intergenic
1196250021 X:113449549-113449571 CATTTTGGGCTGAGACAATGGGG - Intergenic
1197529984 X:127611585-127611607 GATTTTGGGCTGAGACACTGGGG - Intergenic
1197879746 X:131154160-131154182 CATTTTGGGCTGAGACAATGGGG + Intergenic
1198238834 X:134763440-134763462 CATGAGGGGCTGAGGTAAAGTGG - Intronic
1198474109 X:136979017-136979039 AATTTTGGGCTGAGATAATGGGG + Intergenic
1199023346 X:142908645-142908667 GATTTTGGGCTGAGACAAAGGGG + Intergenic
1199132004 X:144200287-144200309 CTTTATGGGATGAGATAGGGAGG + Intergenic
1200323589 X:155215572-155215594 CATTATGTGCGGAGATAAACCGG + Intronic
1200389770 X:155932598-155932620 GATTTTGGGCTGAGATAATGGGG + Intronic
1200882150 Y:8226117-8226139 CATAATGGAATGAAATACAGTGG + Intergenic
1201367269 Y:13221562-13221584 GATTTTGGGCTGAGATGAAGGGG + Intergenic
1201532937 Y:15012244-15012266 GATTTTGGGCTGAGATGCTGGGG + Intergenic
1201933027 Y:19375176-19375198 GATTTTGGGCTGAGATGAAGGGG + Intergenic
1202248908 Y:22849128-22849150 GATTTTGGGCTGAGATAATGGGG + Intergenic
1202401897 Y:24482876-24482898 GATTTTGGGCTGAGATAATGGGG + Intergenic
1202468885 Y:25187207-25187229 GATTTTGGGCTGAGATAATGGGG - Intergenic