ID: 1034860473

View in Genome Browser
Species Human (GRCh38)
Location 7:154590897-154590919
Sequence CTTGTCGAGGCCATCATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860473_1034860481 25 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data
1034860473_1034860480 24 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860480 7:154590944-154590966 CACCCACTGGACCACAGTGATGG No data
1034860473_1034860479 11 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data
1034860473_1034860484 30 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860473 Original CRISPR CTTGTCGAGGCCATCATTAT GGG (reversed) Intronic
900834076 1:4986437-4986459 CTTGTCGAGGCCATGAAAAATGG - Intergenic
912791499 1:112656477-112656499 CTTGTCCAGTCCACCATAATGGG - Intronic
1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG + Exonic
1068338358 10:55667575-55667597 CTTCTCGATGCCATCATATTTGG + Intergenic
1083748037 11:64745876-64745898 CTAGTCTAGGCCCTCATTATGGG - Intergenic
1084440461 11:69169876-69169898 CTGGGCCAGGCCATCATTGTGGG - Intergenic
1092792773 12:12084189-12084211 CAAGGCGAGGCCATCATTTTAGG - Intronic
1110998550 13:82145966-82145988 CTTCTCGAGGCCAAAATAATTGG + Intergenic
1112829960 13:103437253-103437275 CTTGTCCAGGCCATCATTTAGGG - Intergenic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1124526102 15:30454518-30454540 CATGTGGATCCCATCATTATAGG + Intergenic
1124772552 15:32553166-32553188 CATGTGGATCCCATCATTATAGG - Intergenic
1125769110 15:42153381-42153403 ATTGTAGAGGCCATCATGATGGG - Intronic
1131521020 15:93115377-93115399 CTTGTCGATGCCAGTATTTTGGG + Intergenic
1138884907 16:61064874-61064896 TTTATCCAGTCCATCATTATGGG - Intergenic
1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG + Intronic
1151858780 17:76742900-76742922 CTTGTCAAGGCCAAAATTTTAGG - Intronic
1156617482 18:38804550-38804572 CTTTTCGAGTCAATAATTATGGG + Intergenic
1162234572 19:9297894-9297916 CTTATCCAGGGCATCTTTATGGG - Exonic
1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG + Intronic
937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG + Intergenic
947930499 2:233960957-233960979 CGTGAGGAGGGCATCATTATAGG - Exonic
1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG + Intergenic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
957528440 3:81408354-81408376 GCTGTCCAGGACATCATTATTGG - Intergenic
961316025 3:126036287-126036309 CTTGTTGATGCCATCCTTACAGG - Intronic
964851747 3:161103354-161103376 CTTGTAAAGGGCATTATTATGGG + Intronic
972892272 4:43573449-43573471 CTTTGCGAGGCCAACATTGTAGG + Intergenic
978569791 4:110124312-110124334 TTTGTCCAGTCCATCATTAGTGG - Intronic
980045765 4:127986726-127986748 CTTGTCCAAGCCATCATAGTGGG + Intronic
980213840 4:129825340-129825362 CTTTTCTAGGTCATCATTCTAGG + Intergenic
984601828 4:181736665-181736687 CTAGTTGAGGCCAGGATTATTGG - Intergenic
990675037 5:58174595-58174617 CTTGTCTAGGACATCATCTTTGG + Intergenic
994653254 5:102556477-102556499 TTTGTCCAATCCATCATTATAGG - Intergenic
1002900334 6:1405436-1405458 CTTGTGGAGTCCATAACTATAGG - Intergenic
1009450630 6:63795993-63796015 CTTGTCCAGGCCATCCTTCAAGG - Intronic
1016425263 6:143929272-143929294 TTTGTTGAGGGCATCATGATAGG + Intronic
1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG + Intergenic
1021401399 7:20213531-20213553 TTTATCCAGTCCATCATTATGGG - Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1036930213 8:12949542-12949564 CTAGTTGAGGCCATCATAAGCGG - Intronic
1040598823 8:48864905-48864927 CTGGTCGAGGCCATCAGGCTGGG + Intergenic
1041328470 8:56696228-56696250 CTTGCCGAGGCAGTCAATATAGG + Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043221435 8:77670857-77670879 CTTGTCCAGTCTATCATTAATGG - Intergenic
1061315139 9:129790726-129790748 CTCGTCGAGGCCATCATAAATGG - Intergenic