ID: 1034860473

View in Genome Browser
Species Human (GRCh38)
Location 7:154590897-154590919
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860473_1034860479 11 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data
1034860473_1034860484 30 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
1034860473_1034860480 24 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860480 7:154590944-154590966 CACCCACTGGACCACAGTGATGG No data
1034860473_1034860481 25 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860473 Original CRISPR CTTGTCGAGGCCATCATTAT GGG (reversed) Intronic