ID: 1034860474

View in Genome Browser
Species Human (GRCh38)
Location 7:154590898-154590920
Sequence CCTTGTCGAGGCCATCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860474_1034860484 29 Left 1034860474 7:154590898-154590920 CCATAATGATGGCCTCGACAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
1034860474_1034860481 24 Left 1034860474 7:154590898-154590920 CCATAATGATGGCCTCGACAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data
1034860474_1034860480 23 Left 1034860474 7:154590898-154590920 CCATAATGATGGCCTCGACAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1034860480 7:154590944-154590966 CACCCACTGGACCACAGTGATGG No data
1034860474_1034860479 10 Left 1034860474 7:154590898-154590920 CCATAATGATGGCCTCGACAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860474 Original CRISPR CCTTGTCGAGGCCATCATTA TGG (reversed) Intronic
916313774 1:163425471-163425493 CCTTATCGAGGCAATCAATGGGG + Intergenic
918861679 1:189834972-189834994 CCTTGTATAGGGCATCTTTACGG + Intergenic
919904543 1:202069144-202069166 GCTTCTAGAAGCCATCATTATGG - Intergenic
1075479132 10:122764381-122764403 CCTTGTGGAGGCTCTCATTTAGG + Intergenic
1076188656 10:128467872-128467894 CCTTGTGGAGGCCAGAATTCCGG + Intergenic
1080254759 11:30277665-30277687 CCTTTTCGAGGCCATATATATGG + Intergenic
1083748038 11:64745877-64745899 CCTAGTCTAGGCCCTCATTATGG - Intergenic
1089736077 11:120551032-120551054 CCTTCTCAAGGCCTTCATTCTGG - Intronic
1100079097 12:90825881-90825903 GCTTATGGAGGCCATCATTCTGG - Intergenic
1100810371 12:98331281-98331303 CATTGTAGAGCCCAACATTAAGG - Intergenic
1102621215 12:114196286-114196308 CCTTTTCAAGGGAATCATTAAGG + Intergenic
1107399137 13:40051757-40051779 CTGTGTCAAGGCCATCCTTAGGG + Intergenic
1107460506 13:40597532-40597554 CCTTGTTGAAGCCATGACTAAGG - Intronic
1112829961 13:103437254-103437276 TCTTGTCCAGGCCATCATTTAGG - Intergenic
1125769111 15:42153382-42153404 GATTGTAGAGGCCATCATGATGG - Intronic
1126807776 15:52369613-52369635 CCTTGTTGAAGCCTGCATTAAGG - Intronic
1138884908 16:61064875-61064897 CTTTATCCAGTCCATCATTATGG - Intergenic
1140671794 16:77286896-77286918 CCTTGGGGAAGCCATCCTTATGG - Intronic
1140795393 16:78432863-78432885 CATTGTCCAGCCCATCATAAAGG + Intronic
1154498525 18:14980625-14980647 CCTTGACGAGGCCCTCACTGTGG + Intergenic
1160359534 18:78261099-78261121 GCTTGTCCAGGCTATCCTTATGG - Intergenic
1165134852 19:33661438-33661460 CCTTGTGGAGGTCACCTTTATGG + Intronic
925178683 2:1802526-1802548 CCTGGCCGAGGTCATCATTCTGG - Intronic
925764343 2:7216337-7216359 CCTGGTCTATGCCATCGTTAGGG - Intergenic
935924393 2:108051771-108051793 CCTTGTCATTTCCATCATTATGG + Intergenic
935949529 2:108316241-108316263 CCTAGTCAAGGGCATCAATAGGG + Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
948207242 2:236168662-236168684 CCTTGTCGAGGCCACCTCGAAGG + Intergenic
1178227632 21:30741735-30741757 TCTTGGAGAGGTCATCATTAAGG + Intergenic
951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG + Intronic
952276462 3:31882110-31882132 CCTTGCCGGGGCCATAAGTAGGG - Intronic
954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG + Exonic
955359282 3:58259026-58259048 CCTTGACGAGGCCATGAGAAGGG - Intronic
955767932 3:62364458-62364480 CCTTGTTGATTCCATCATTGAGG - Intergenic
957416133 3:79908057-79908079 CCTAGTCAAGGCCAAAATTAAGG - Intergenic
964261786 3:154847823-154847845 CCTTGTCCAGGCCATTTTAAAGG - Intergenic
964851746 3:161103353-161103375 CCTTGTAAAGGGCATTATTATGG + Intronic
964874304 3:161348396-161348418 CTTTCTCAAGGCCATCATTAAGG - Intronic
976777412 4:88721500-88721522 CATTGCCGAGGCCAGCAATAGGG - Intergenic
980243349 4:130204034-130204056 CCCTTTCAAGGCCAGCATTAAGG - Intergenic
982207943 4:153011176-153011198 CCTTGTAGAGGGCATCTTTGGGG + Intergenic
988695138 5:33614307-33614329 CATTGTCAAGGCCATCTTTCTGG + Exonic
1010375969 6:75170773-75170795 CCTTGTTTAGTCCATCTTTAAGG + Intronic
1015029250 6:128574540-128574562 CCTTGTCCTGGCTATTATTATGG + Intergenic
1016560922 6:145394517-145394539 CCTTGGAGAGGAAATCATTAAGG - Intergenic
1021401400 7:20213532-20213554 CTTTATCCAGTCCATCATTATGG - Intronic
1021404819 7:20252836-20252858 CATTGCCAAGGCCAACATTAAGG - Intergenic
1021868836 7:24983442-24983464 CCTTGTAGCAGACATCATTATGG + Intergenic
1031665806 7:124480966-124480988 CATTCTCGGGGCCATCATTCTGG + Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1040598822 8:48864904-48864926 CCTGGTCGAGGCCATCAGGCTGG + Intergenic
1052099571 9:24428815-24428837 CCTACTCAAGGACATCATTACGG + Intergenic