ID: 1034860477

View in Genome Browser
Species Human (GRCh38)
Location 7:154590910-154590932
Sequence GGCCATCTCATTCCTTGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860477_1034860481 12 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC No data
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data
1034860477_1034860480 11 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC No data
Right 1034860480 7:154590944-154590966 CACCCACTGGACCACAGTGATGG No data
1034860477_1034860479 -2 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC No data
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data
1034860477_1034860484 17 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC No data
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860477 Original CRISPR GGCCATCTCATTCCTTGTCG AGG (reversed) Intronic