ID: 1034860477

View in Genome Browser
Species Human (GRCh38)
Location 7:154590910-154590932
Sequence GGCCATCTCATTCCTTGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860477_1034860480 11 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1034860480 7:154590944-154590966 CACCCACTGGACCACAGTGATGG No data
1034860477_1034860481 12 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data
1034860477_1034860479 -2 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data
1034860477_1034860484 17 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860477 Original CRISPR GGCCATCTCATTCCTTGTCG AGG (reversed) Intronic
900261525 1:1732783-1732805 GGCCACCTCATACCCTGTTGCGG - Intronic
902145166 1:14392592-14392614 GGCCACATCATTCTTTGTTGTGG + Intergenic
902311248 1:15583485-15583507 GGCCAGATGATTCCGTGTCGCGG + Intronic
902672803 1:17986584-17986606 GGCCAGATCATTCTTTGTGGAGG - Intergenic
911517275 1:98881996-98882018 GGCCAGATCATTCTTTGTTGTGG + Intergenic
911848263 1:102782463-102782485 GGCCCTCTTATTTCTTGTCTTGG - Intergenic
913657657 1:120976529-120976551 TCCCATCTCATTCCATGTCCTGG + Intergenic
914009008 1:143759611-143759633 TCCCATCTCATTCCATGTCCTGG + Intergenic
914340906 1:146759784-146759806 GTCCATTTCCTTCCTTGTCAAGG - Intergenic
914647636 1:149668263-149668285 TCCCATCTCATTCCATGTCCTGG + Intergenic
918372094 1:183870672-183870694 GGTCAGATCATTCCTTGTTGGGG - Intronic
923038690 1:230303692-230303714 GGCCTTCTCATGCCTGGTGGGGG + Intergenic
1063248987 10:4253540-4253562 GGTCTTATCGTTCCTTGTCGTGG - Intergenic
1063409100 10:5823154-5823176 GGCCAGGTCATTCTTTGTCGTGG + Intronic
1068831575 10:61501745-61501767 GGCCAGATCATTCTTTGTGGAGG + Intergenic
1069090030 10:64189109-64189131 GGCCAGATAATTCCTTGTTGTGG + Intergenic
1072415219 10:95241574-95241596 GGCCATATGAGTCCTTGTTGTGG - Intronic
1074900498 10:117812433-117812455 GGTCATCTCATTCCTACTCCTGG + Intergenic
1081953380 11:47066453-47066475 GGACATCTCATTCCATCTCGGGG - Intronic
1085383591 11:76142200-76142222 TGCCATCTCATCCCCTGTGGGGG + Exonic
1089026277 11:115273816-115273838 AGCCATCTCATTCTTTCTCCAGG - Intronic
1089759088 11:120709829-120709851 GGCCATTTTATTCCTTGTCCAGG - Intronic
1092856573 12:12679711-12679733 GGCCAGATAATTCTTTGTCGTGG - Intronic
1104231405 12:126888251-126888273 GGCCAGCTAATTCTTTGTCGGGG - Intergenic
1107141334 13:37000927-37000949 TGCCATTTCCTTCCTCGTCGAGG + Intronic
1107996940 13:45870442-45870464 GGCCATGGCATTCCTGGTAGAGG + Intergenic
1108086567 13:46799326-46799348 GGCCAGATGATTCTTTGTCGTGG + Intergenic
1112239184 13:97664186-97664208 GGCCAGATCATTCTTTGTCGTGG + Intergenic
1118686309 14:68295120-68295142 TGCCCTCTCATTCCTTCTCAAGG + Intronic
1119346933 14:73933368-73933390 GGCCACCTAATTCTTTGTTGAGG - Exonic
1121899897 14:97684401-97684423 GGCCCTTTCATTCCTGGTCCAGG + Intergenic
1122393220 14:101404848-101404870 GGCCAGATCATTCTTTGTGGTGG - Intergenic
1124130711 15:26983200-26983222 GGCCTTCTCATCCCTTATCAAGG + Intronic
1126070364 15:44860597-44860619 GAACATCTGAGTCCTTGTCGTGG + Intergenic
1126087671 15:45024520-45024542 GAACATCTGAGTCCTTGTCGTGG - Intronic
1132120131 15:99169064-99169086 GGGCATCTCTTTCCTTCTCTGGG + Intronic
1133397899 16:5462879-5462901 GGCCAGATTATTCTTTGTCGTGG - Intergenic
1133580146 16:7136925-7136947 GGCCCTTTCATTCCTCGTCATGG + Intronic
1133710144 16:8393471-8393493 GGCCAAATAATTCCTTGTTGTGG + Intergenic
1133728664 16:8559834-8559856 GGGGATCTCAGTCCTTGTCCTGG - Intergenic
1134816709 16:17211862-17211884 GGCCAGATAATTCCTTGTTGTGG + Intronic
1135053806 16:19213976-19213998 GGCCAGACCATTCCTTGTTGAGG + Intronic
1138383301 16:56618355-56618377 GGCCATGTCATTCCCTCTCCAGG + Intergenic
1139343958 16:66290086-66290108 GGCCAGATCATTCTTTGTTGTGG - Intergenic
1139993379 16:70957622-70957644 GTCCATTTCCTTCCTTGTCAAGG + Intronic
1140286493 16:73607324-73607346 GCCGATCTCATTCCTTTTTGAGG + Intergenic
1142250683 16:88990426-88990448 CTCCCTCTCATGCCTTGTCGTGG + Intergenic
1143028140 17:3952999-3953021 GACCAGATCATTCTTTGTCGGGG - Intronic
1145689813 17:26728454-26728476 GGCCAACTCTCTCCTTGTCTTGG + Intergenic
1147144358 17:38476752-38476774 GGCCAGATAATTCCTTGTTGGGG + Intronic
1149542003 17:57474431-57474453 GGCCAGATGATTCTTTGTCGTGG + Intronic
1151199516 17:72457456-72457478 GGCCAGATCATTCTTTGTGGTGG + Intergenic
1152109886 17:78352202-78352224 GGACAGCTCTTTCCTTGTCATGG - Intergenic
1158137398 18:54223298-54223320 GGCCAGATCATTCTTTGTTGTGG + Intronic
1158559022 18:58498368-58498390 GGCCAGCTCCCTCCTTGTCATGG - Intronic
1160101428 18:75923206-75923228 GGCCAGATCATTCTTTGTTGTGG + Intergenic
1160966985 19:1750992-1751014 GGGGATCTCACTCCTTGTAGAGG - Intergenic
1162243494 19:9378748-9378770 GGCCATCTCATTCAGGGTCATGG - Intronic
925725708 2:6868980-6869002 GTGCACCTCATTCATTGTCGGGG + Intronic
928949570 2:36802693-36802715 GGCACTCTCGTTCCTTGACGAGG + Intronic
930105687 2:47637535-47637557 GGCAATCTCATTTCTTCTCATGG + Intergenic
931289936 2:60863502-60863524 GGCCCTTTCATTCCTTGCCTGGG + Intergenic
932821355 2:74904140-74904162 GGCCAGGTAATTCTTTGTCGGGG + Intergenic
933531357 2:83516704-83516726 GGCCAGCTAATTCTTTGTTGTGG - Intergenic
933648872 2:84833050-84833072 GGCCTTCTGCTTCCTTCTCGGGG - Intronic
935085306 2:99838878-99838900 TGCCAGCTCATTCCTTGTCCTGG + Intronic
935620996 2:105129410-105129432 GGCCATATAATTCTTTGTTGTGG - Intergenic
937428019 2:121815920-121815942 GCCCATCACCTTCCCTGTCGAGG - Intergenic
939372971 2:141326721-141326743 GGCCAGATAATTCCTTGTTGTGG - Intronic
1174912629 20:54623266-54623288 GGCAAGCTCATTCTTTGTCGAGG - Intronic
1176725622 21:10430127-10430149 GGCTAGCTAATTCCTTGTCACGG + Intergenic
1178581207 21:33839925-33839947 GGCCAGATCATTCTTTGTTGCGG - Intronic
1181921083 22:26320923-26320945 GGTCAGCTCATTCTTTGTGGTGG - Intronic
1182110337 22:27718567-27718589 CTCCATCTCATTCCTTTGCGTGG - Intergenic
1183364953 22:37401981-37402003 GGCCTTCTGATTCCTTATCTGGG - Intronic
1185398719 22:50605200-50605222 GGCCACCTCATGCCATGTCCTGG - Intronic
949844297 3:8354253-8354275 GGCCAGATAATTCCTTGTGGGGG + Intergenic
950348968 3:12328306-12328328 GCCCCTCTCATTCCTGGTGGGGG + Intronic
952674817 3:36015290-36015312 GGCCAGATCATTCTTTGTCGGGG + Intergenic
955357228 3:58241146-58241168 GGCCATATAATTCTTTGTTGTGG - Intronic
955373456 3:58373753-58373775 TGCCATCTCATCCCCTGACGTGG + Intronic
956334019 3:68143516-68143538 GGCCAGATAATTCCTTGTCGTGG + Intronic
956488177 3:69743093-69743115 GGCCAGATAATTCCTTGTTGTGG + Intronic
964414837 3:156436239-156436261 GGACATCTCATTCCTTTTTATGG + Intronic
964597529 3:158453075-158453097 GGCCATCTTATTCTTTTTAGTGG + Intronic
970460438 4:16269580-16269602 AGCCATCTGATACCTTGTCAAGG + Intergenic
970907303 4:21230686-21230708 GGACATCTCATTCCTTTTTATGG + Intronic
973603253 4:52562165-52562187 GGCCACCTCTTTCCTTGAGGTGG + Intergenic
974339396 4:60594740-60594762 TGCCTTCTCTTTCCTTTTCGTGG + Intergenic
976688822 4:87846171-87846193 GGCCTGCCCATTCCTTCTCGTGG + Exonic
982879626 4:160696372-160696394 GGACATCTCATTCTTTCTCAGGG - Intergenic
985781224 5:1872796-1872818 GACCATGTCCTTCCTTCTCGGGG - Intergenic
997600423 5:135134942-135134964 GGCCATGCCATGCCATGTCGTGG + Intronic
1001704443 5:173731629-173731651 GGCCAGGTCATTCTTTGTTGTGG - Intergenic
1003962636 6:11223117-11223139 GGCCAGGTCATTCTTTGTGGTGG - Intronic
1005676406 6:28159947-28159969 GGCCAGATCATTCTTTGTTGTGG - Intergenic
1006362681 6:33595546-33595568 GGCCAGCTCATTCCTTGTCATGG - Intergenic
1011467488 6:87673475-87673497 GGCCAGATCATTCTTTGTCGTGG - Intergenic
1012816406 6:104027782-104027804 AGCCATTTCATTCCTTCTTGTGG + Intergenic
1013054092 6:106566277-106566299 GGACACCTCACTCCTTGTCTTGG + Intronic
1017086099 6:150714449-150714471 GGCCATCTCAGTTCATGTCATGG + Intronic
1017591165 6:155979365-155979387 GGCCACTGCATTCCTTCTCGTGG - Intergenic
1019864915 7:3698670-3698692 GGCCAGCTCATTTCTTGGTGAGG + Intronic
1021131826 7:16921161-16921183 GGGCATCTGATTCCTTCTGGAGG + Intergenic
1023217339 7:37877686-37877708 GGCCAGATCATTCTTTGTCCAGG + Intronic
1031380162 7:121075997-121076019 GGGCGTCTCAGTCCTTGTGGGGG - Intronic
1031984836 7:128157392-128157414 GGCCAGATAATTCTTTGTCGTGG + Intergenic
1033111008 7:138576146-138576168 GGCCAGATAATTCCTTGTTGTGG - Intronic
1034860477 7:154590910-154590932 GGCCATCTCATTCCTTGTCGAGG - Intronic
1035610890 8:963157-963179 GGCCATCTCCTTCCTGGGTGTGG - Intergenic
1042495354 8:69449692-69449714 GACCTTCTCAGTCCTTGTCTTGG - Intergenic
1047420700 8:124705799-124705821 GGCCAGATAATTCTTTGTCGTGG + Intronic
1055461777 9:76526601-76526623 GGGCATCTCTGTCCTTTTCGTGG + Intergenic
1058673524 9:107380701-107380723 GGCCATTTCATTCTATGTCATGG - Intergenic
1059642037 9:116226825-116226847 TGCCATCTAATTCATTGTAGCGG - Intronic
1060791560 9:126488985-126489007 GGCCATCTGTGTCCTTGTGGGGG - Intronic
1186608237 X:11112907-11112929 GGCCAGCTGATTCTTTGTTGGGG - Intronic
1186888952 X:13941191-13941213 GGCCAGATCATTCTTTGTTGTGG - Intergenic
1187203383 X:17157639-17157661 GGCCAGATCATTCTTTGTTGTGG - Intergenic
1188072621 X:25735875-25735897 GCAGATATCATTCCTTGTCGAGG - Intergenic
1189181169 X:39005813-39005835 GGCCATTTCATTGCTTCTTGTGG + Intergenic
1191109766 X:56795301-56795323 GACCATCTCATTCATTTTCTGGG - Intergenic
1197594895 X:128452908-128452930 TGCCATTTCATTGCTTGTGGAGG - Intergenic
1198213301 X:134534881-134534903 GGCCATCTTAATCCTTTTCCTGG - Intergenic