ID: 1034860478

View in Genome Browser
Species Human (GRCh38)
Location 7:154590931-154590953
Sequence CCAGTGGGTGACACTGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860478_1034860489 30 Left 1034860478 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG 0: 1
1: 0
2: 4
3: 16
4: 186
Right 1034860489 7:154590984-154591006 GTGTGGACATGGCACTGTGCTGG No data
1034860478_1034860481 -9 Left 1034860478 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG 0: 1
1: 0
2: 4
3: 16
4: 186
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data
1034860478_1034860480 -10 Left 1034860478 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG 0: 1
1: 0
2: 4
3: 16
4: 186
Right 1034860480 7:154590944-154590966 CACCCACTGGACCACAGTGATGG No data
1034860478_1034860486 13 Left 1034860478 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG 0: 1
1: 0
2: 4
3: 16
4: 186
Right 1034860486 7:154590967-154590989 GCGTGGTGAACCAAGAAGTGTGG No data
1034860478_1034860484 -4 Left 1034860478 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG 0: 1
1: 0
2: 4
3: 16
4: 186
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
1034860478_1034860487 19 Left 1034860478 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG 0: 1
1: 0
2: 4
3: 16
4: 186
Right 1034860487 7:154590973-154590995 TGAACCAAGAAGTGTGGACATGG 0: 1
1: 0
2: 1
3: 28
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860478 Original CRISPR CCAGTGGGTGACACTGACTG TGG (reversed) Intronic
902166329 1:14574793-14574815 CCAGTGGAGGAAACTGACAGTGG + Intergenic
902458471 1:16553590-16553612 ACGGTGGGTGACCATGACTGGGG - Intergenic
902493689 1:16854326-16854348 ACGGTGGGTGACCATGACTGGGG + Intronic
903276143 1:22223203-22223225 ACAGTGCCTGCCACTGACTGAGG + Intergenic
903350493 1:22713623-22713645 CCTGAGGGTGACACAGTCTGTGG + Intronic
904410937 1:30324616-30324638 CCACTGGGTGAGTGTGACTGCGG - Intergenic
907289491 1:53403600-53403622 CCAGTGTGTCACACTGACACAGG - Intergenic
913064224 1:115235225-115235247 TCAGGGGTTCACACTGACTGTGG + Intergenic
913542546 1:119835731-119835753 CCAGTGGATCCCACTGTCTGTGG - Intergenic
915567187 1:156721786-156721808 TCACTGGATGACACTAACTGGGG - Intergenic
915661841 1:157411314-157411336 TCTGTGGGAGACAGTGACTGAGG + Intergenic
915795311 1:158725590-158725612 CCACAGAGTGACACTGAGTGTGG + Intergenic
920022618 1:202967161-202967183 CCAGTGGAGGATACTGAATGAGG + Intronic
921059148 1:211567954-211567976 CCTGTGGGAGACACTGAAAGAGG + Intergenic
921102211 1:211938662-211938684 CCAGTGGATGCCTATGACTGAGG + Intergenic
922890446 1:229057972-229057994 CCACTGGGTGACCCAGCCTGGGG - Intergenic
1063709407 10:8462789-8462811 CCAGTGGGAAACACAGAGTGAGG + Intergenic
1065965612 10:30768035-30768057 CCAGGGGGTGCCCCTCACTGGGG - Intergenic
1067055699 10:43048607-43048629 TCAGTGGGTGACCATGACTGTGG - Intergenic
1068455521 10:57249921-57249943 CCGGTGGGTCACTCTGAATGTGG - Intergenic
1069255000 10:66322016-66322038 CTAGTGGGTGAAAATGACAGTGG + Intronic
1072230452 10:93409871-93409893 CCTCTTGGTGACACTGACTTGGG + Intronic
1073167590 10:101470975-101470997 GCAGTGGGTGACAGTGCCTAAGG + Intronic
1073729250 10:106270443-106270465 CCAGTGGATGACCCTAAATGGGG + Intergenic
1074376642 10:112946435-112946457 GCCGTGGGTGACACAGCCTGTGG + Intergenic
1075191691 10:120315408-120315430 CCAATAGATGACACTGGCTGCGG - Intergenic
1075194060 10:120339589-120339611 CCTTTGGGAGACACTGACTTAGG + Intergenic
1075702793 10:124479923-124479945 CCAGTGGGTACGACTTACTGAGG + Intronic
1076428192 10:130382159-130382181 CCAGCGGGTTTCACTGACAGGGG - Intergenic
1076915064 10:133419349-133419371 CCTGTGGGTGACAGTGACTGCGG - Intronic
1077304914 11:1864712-1864734 CCTGTGGGTCTCCCTGACTGTGG - Intronic
1078031600 11:7757551-7757573 TCAGTGGGAGACACTGGCAGAGG + Intergenic
1079868574 11:25766006-25766028 GCACTGGGTGACTCTGACTTTGG - Intergenic
1081766005 11:45610559-45610581 CCAGTGGGGAACACTGGCTTTGG - Intergenic
1081951699 11:47049621-47049643 ACAGTGGGAGACAATGTCTGGGG + Intronic
1083737458 11:64689854-64689876 CCAGTGGGTGCCAAGCACTGGGG - Intronic
1084008785 11:66336463-66336485 CCAGTGAGTAACACTTCCTGAGG + Exonic
1084062386 11:66684864-66684886 GCAGTGGCTGAGACTGGCTGGGG + Intergenic
1084119479 11:67060401-67060423 ACAGAGGGTGACCCTGCCTGGGG + Intronic
1084145366 11:67262349-67262371 CCAGAGCCTGACACTGTCTGGGG + Intergenic
1084679687 11:70659659-70659681 ACCGTGGGTGCCACTGCCTGTGG - Intronic
1087898235 11:103611352-103611374 ACAGTGGGTGAAACTCACAGAGG + Intergenic
1090381233 11:126328938-126328960 CTAGTGACTGACACTGTCTGTGG - Intronic
1091447456 12:552161-552183 CCGGTGAGAGACACTGAGTGGGG + Exonic
1094272554 12:28633029-28633051 CTAGTAGATGCCACTGACTGTGG - Intergenic
1095669911 12:44846939-44846961 CCTGTGGCTGACACTGGCTTCGG - Intronic
1096911169 12:54985424-54985446 CCGGTGGGTGAAAGTGATTGAGG - Intergenic
1102344246 12:112148692-112148714 CCTGTGGATGACCCTTACTGGGG + Intronic
1103893431 12:124256765-124256787 CCTGTGAATGGCACTGACTGTGG + Intronic
1104383462 12:128328338-128328360 TGAGGGGATGACACTGACTGTGG + Intronic
1105983212 13:25539994-25540016 CCAGTGGTTGGGTCTGACTGGGG + Intronic
1110295179 13:73855973-73855995 CCAGAGGGTGACACTATCTAAGG + Intronic
1113128296 13:107005673-107005695 CCTGTGGGTGAAACTGACAGAGG + Intergenic
1113878202 13:113607749-113607771 CCAGTGGGTGGCGGTGACGGGGG + Intronic
1113956994 13:114104371-114104393 CCAGTGGGTGTCTGTGGCTGGGG - Intronic
1114512770 14:23276269-23276291 TCACTGGGTGACACTGACTGTGG + Exonic
1115348371 14:32366439-32366461 CCAGTGGCTGGTAGTGACTGTGG + Intronic
1115427148 14:33273191-33273213 CCAGTGGGAGACAGTGAGTCTGG - Intronic
1117991374 14:61437027-61437049 CCAGTGGGTGACAGTGACACGGG - Intronic
1118440178 14:65804924-65804946 GCAGTGGGTGGCATTGCCTGTGG - Intergenic
1119472511 14:74908800-74908822 CTGGTGGGTGCCACTGAGTGTGG - Intronic
1120008036 14:79382211-79382233 GCAGTGGGTGCAACTGACTGCGG + Intronic
1121348928 14:93157271-93157293 CCAGTCTGGGACAGTGACTGGGG + Intergenic
1121509721 14:94503383-94503405 CCAGTGCCTGACACAGAGTGAGG - Intronic
1122152340 14:99731829-99731851 CCAGTGGCAGACACTGGGTGAGG + Intergenic
1124589353 15:31039813-31039835 CCATTAGGAGACTCTGACTGTGG + Intronic
1130209966 15:81913979-81914001 CCTGTGGGTGGCACTGCCTTAGG + Intergenic
1130305179 15:82708701-82708723 CCAGTGGCTCACACAGATTGTGG + Intronic
1130395398 15:83496742-83496764 CTTGTCGGTGACTCTGACTGTGG + Intronic
1130545878 15:84857492-84857514 CTGGTGGGTGACTCTGAGTGGGG - Exonic
1132062467 15:98703703-98703725 CTAGTGGTCAACACTGACTGTGG + Intronic
1135593368 16:23721481-23721503 CCAGCAGGTGACAATCACTGGGG + Intergenic
1137443976 16:48520770-48520792 CCAGTGAGAAAGACTGACTGGGG + Intergenic
1138225302 16:55289750-55289772 TCAGTGGGTGACTCAGACAGAGG + Intergenic
1140660700 16:77189556-77189578 CCTCTTGGTGACAGTGACTGAGG + Intergenic
1140895867 16:79323685-79323707 CCAGGGAGTGGCACAGACTGTGG - Intergenic
1142002258 16:87670620-87670642 CCACTGGGTGCCACACACTGCGG + Intronic
1142066745 16:88067308-88067330 CACCTGGGTGACACTGGCTGGGG - Intronic
1146164634 17:30578217-30578239 CCAGTGGGTGACAAGCACAGAGG - Intergenic
1151444781 17:74156118-74156140 CCAGTGGGAGACACTGGTAGGGG + Intergenic
1152258581 17:79254510-79254532 CCTGTAGGTGACCCTGACTGAGG + Intronic
1153878128 18:9394973-9394995 ACAGCTGGTGACACTGAATGGGG - Intronic
1155169133 18:23254242-23254264 TCTGTGGGTCACACTGCCTGGGG - Intronic
1157805989 18:50657943-50657965 CCTGTAGCTGACACTGACTGTGG - Intronic
1158574556 18:58625242-58625264 GCTGGGGGTGACACTGAGTGTGG - Intronic
1160931809 19:1574372-1574394 CACGTGGGTGCCAGTGACTGGGG - Intronic
1161108423 19:2455799-2455821 CCAGGGGGAGACCCTGAGTGAGG - Intronic
1161508719 19:4658465-4658487 TCAGTGGGTGAACCTGTCTGAGG + Intronic
1161924883 19:7293320-7293342 CCGGTGGGTGACGCTGCCTGGGG - Intronic
1162110544 19:8397509-8397531 GCTGAGGCTGACACTGACTGTGG + Intronic
1165268277 19:34679717-34679739 CTAGTGAGTGACACACACTGTGG - Intronic
1165274479 19:34735964-34735986 CTAGTGAGTGACACACACTGTGG - Intronic
925388801 2:3482073-3482095 TCAGGGGGTGACACTGAATAGGG - Intronic
926616587 2:15002579-15002601 GCAGGGGGTGGCACTCACTGGGG + Intergenic
930555156 2:52886052-52886074 CCACTGGGTGCCACAGAGTGTGG - Intergenic
932002296 2:67895925-67895947 TCAGTGGAAGACAGTGACTGAGG - Intergenic
932885494 2:75545777-75545799 CCCCTAGGAGACACTGACTGAGG - Intronic
936163855 2:110103629-110103651 CCAGTGGGTCAGACTGCCCGGGG + Intronic
938188895 2:129256508-129256530 CCAGTGAGGGACACAGACAGTGG + Intergenic
940288942 2:152059182-152059204 CCAGTGGGGGACTCTGTGTGGGG - Intronic
944917527 2:204376380-204376402 GCAGAGGCTGACACTGACTGAGG - Intergenic
945039321 2:205730875-205730897 CCAGTGGGTGAGAAAGACTAAGG + Intronic
947397907 2:229704642-229704664 CCAGTGGCTGCCAGGGACTGGGG + Intronic
1169802007 20:9520269-9520291 CCAGTGAGTGATTCTGAATGAGG - Intronic
1170807039 20:19641258-19641280 TGGGTGGCTGACACTGACTGTGG - Intronic
1173972981 20:47166827-47166849 CCAGTGTGTGACCTTGAGTGAGG - Intronic
1174271877 20:49375434-49375456 CCAGTGGCTCACACTGGATGGGG + Intronic
1174292276 20:49517667-49517689 CCTCTGGGAGGCACTGACTGCGG + Intronic
1174938009 20:54893519-54893541 CCCCAGGGTTACACTGACTGTGG - Intergenic
1175370719 20:58488294-58488316 CCAGTGGGTGTCTCAGACTGTGG - Intronic
1175592951 20:60207785-60207807 CCTGTTGGTGAAAATGACTGGGG + Intergenic
1175959018 20:62625757-62625779 CCAGAGGGTGAGACTTCCTGGGG - Intergenic
1180119405 21:45736863-45736885 TCAGGGGGTGACAGTGGCTGTGG + Intronic
1180194410 21:46184286-46184308 CAAGTCGGTCGCACTGACTGAGG - Intronic
1181346653 22:22224220-22224242 ACAGTGGTGGACGCTGACTGGGG + Intergenic
1181439844 22:22930135-22930157 CCAGTTTGTGCCACTGACTCTGG + Intergenic
1181945215 22:26511724-26511746 CCAGAGTTTGACACTGCCTGTGG - Intronic
1184117216 22:42429161-42429183 CAGGTGGCTGACACTCACTGAGG + Intronic
1184451659 22:44586179-44586201 TGAGGGGGTGACAGTGACTGAGG - Intergenic
1184562413 22:45270827-45270849 CCACTGTGTGACACTGCCTCTGG - Intergenic
1184666241 22:45990585-45990607 CCAGCGAGTCACACTAACTGCGG + Intergenic
1185292794 22:50035502-50035524 CCAGGAGGTGCCACTGCCTGAGG - Intronic
950436699 3:12984507-12984529 CCACAGGGTGACAGTGACTCTGG + Intronic
952295502 3:32058788-32058810 CCAGTGGCTGCCTCTGTCTGTGG + Intronic
953114486 3:39978360-39978382 CCAGTGGGTGACGAGCACTGTGG + Intronic
953138166 3:40201726-40201748 CCACTGTGTGACACTGACCAAGG + Intronic
953588118 3:44223434-44223456 GCGGTGGGTGGCAGTGACTGGGG + Intergenic
955885525 3:63594213-63594235 CCAGTGAATGACACAGACTTTGG + Intronic
957034747 3:75283424-75283446 CCACTGGGTCACACTGTCTGGGG + Intergenic
959762202 3:109978469-109978491 CCAGTGGGTGACACTGAAAAGGG - Intergenic
961078619 3:124005012-124005034 CCACTGGGTCACACTGTCTGGGG + Intergenic
961304855 3:125951430-125951452 CCACTGAGTCACACTGTCTGGGG - Intergenic
961317455 3:126050304-126050326 CCTGTAGGTGACAAAGACTGTGG - Intronic
961353213 3:126316823-126316845 CCCGTGGCTGGCACTGCCTGGGG + Intergenic
961508513 3:127387498-127387520 TGAGTGGGTGACACTGGCTGGGG - Intergenic
961508520 3:127387531-127387553 TGGGTGGGTGACACTGGCTGGGG - Intergenic
961508545 3:127387632-127387654 CGAGGGGGTGACACTGGCAGGGG - Intergenic
961508605 3:127387864-127387886 CGGGTGGGTGACACTGTCGGGGG - Intergenic
969285222 4:6198878-6198900 CCAGCGGGTTACTCTGACTTAGG + Intronic
970082806 4:12307501-12307523 TCAGTGGTTGACATTGGCTGTGG - Intergenic
971082872 4:23235256-23235278 CCAAAGGCTGACAGTGACTGTGG + Intergenic
972381492 4:38524303-38524325 CAAGCGGGTGAAACTGACAGAGG - Intergenic
973073993 4:45900108-45900130 CGAATGGGTGCCACTGACTGGGG + Intergenic
978123278 4:105107355-105107377 ACAATGGTTGACACTGAATGTGG + Intergenic
979051783 4:115944281-115944303 CCAGTGGGTGACCTTAACAGTGG + Intergenic
979263349 4:118673191-118673213 CCAGGGGGCCACACTGACTGAGG - Intergenic
981278508 4:142930090-142930112 CCTATGTGTTACACTGACTGTGG - Intergenic
982745625 4:159102734-159102756 ACAGTGGGGGACACTGCGTGAGG + Intergenic
988184569 5:27844197-27844219 CCAGTGGGTGAAAATGACCAAGG + Intergenic
990023978 5:51162492-51162514 CCAATGGGTGTCATTGTCTGTGG - Intergenic
995589592 5:113685619-113685641 CCTATGGATGACACTGACTTTGG + Intergenic
999223371 5:150000236-150000258 CCAGTGGGAGAGACGGATTGAGG + Intronic
1000048402 5:157540834-157540856 CCTGTGGGTGCCAGTGACAGAGG - Intronic
1001184744 5:169558884-169558906 CCAGTGGGTGCCTGTGAATGGGG - Intergenic
1002534676 5:179869726-179869748 CAAGTGGGAGACCCTGGCTGGGG + Intronic
1003947325 6:11087534-11087556 GCAGTGGGTGGCGCTCACTGGGG - Intergenic
1004300567 6:14453754-14453776 CCACTGGCTGACACTAACTCTGG + Intergenic
1005947773 6:30606819-30606841 CCAGTCGCTGACAAGGACTGAGG + Exonic
1018952349 6:168387434-168387456 TCAGTGGGTGACGTTTACTGAGG + Intergenic
1019062129 6:169264007-169264029 CCAGTGATGGACACTGGCTGAGG + Intergenic
1020127993 7:5543824-5543846 CATGTGTATGACACTGACTGGGG + Intronic
1020459844 7:8417079-8417101 CCACTGCATGACACTGACTAAGG - Intergenic
1021628750 7:22622928-22622950 CCAGCAGGTCAGACTGACTGTGG - Intronic
1022289832 7:28990165-28990187 TCAGTGGCTGCCACTGGCTGTGG + Intergenic
1023186703 7:37540087-37540109 CCAGTGGCTGATATTCACTGAGG + Intergenic
1023764693 7:43499529-43499551 CCACTGGGAGAAACTGAGTGAGG + Intronic
1024008341 7:45243941-45243963 CCAGTATGTGACACACACTGAGG - Intergenic
1024252776 7:47519105-47519127 TCAGTGGGTCTCACTGACTCTGG - Intronic
1027001304 7:74656736-74656758 CCAGTGGGTGGTACTGGGTGGGG + Intergenic
1027048080 7:75004218-75004240 CCAGTGATTGCCACTTACTGTGG + Intronic
1027191772 7:76000733-76000755 CCCTTGGGTGACGCGGACTGGGG + Intronic
1029384919 7:100237397-100237419 CCAGTGATTGCCACTTACTGTGG - Intronic
1029435883 7:100563872-100563894 CCAGTGGGTGGCACTGCCTGGGG - Exonic
1030110387 7:106021714-106021736 CCAGTGGGTCACACTGGTTATGG - Intronic
1031243816 7:119281288-119281310 GCAGTGGGATACACTGCCTGGGG + Intergenic
1032094572 7:128931535-128931557 CCAGTGCCTGACACACACTGTGG - Intergenic
1034860478 7:154590931-154590953 CCAGTGGGTGACACTGACTGTGG - Intronic
1034929300 7:155148867-155148889 CCAGTGGGTGCCAGTGACTGTGG + Intergenic
1035054651 7:156026412-156026434 CCGGCGCGGGACACTGACTGGGG + Intergenic
1035487757 7:159240918-159240940 TCAGTGGCTGCCACTGAGTGAGG + Intergenic
1035958950 8:4115901-4115923 TCAGTGGTTGCCAGTGACTGGGG + Intronic
1037225767 8:16587719-16587741 TCAGTGGGGGACATTGATTGTGG - Intergenic
1037963761 8:23117922-23117944 CCAGTGAGGGTCACTCACTGTGG - Intergenic
1041452435 8:58020818-58020840 CCAGTGCATGCCACTGTCTGAGG + Intronic
1041786206 8:61637217-61637239 CCTGTGGGTGACTCTGCGTGGGG - Intronic
1042451123 8:68947681-68947703 TCAGTGAGTGACACTGGCTTGGG + Intergenic
1042535483 8:69854485-69854507 TCAGTGGTTGACACTGTCTTTGG - Intergenic
1043008794 8:74855933-74855955 ACAGTGGGTAAGACTGAATGGGG - Intergenic
1043292187 8:78616774-78616796 CCAGTGGGTTATACTTCCTGTGG - Intergenic
1044446417 8:92282302-92282324 CCAGTGGGAAACACTGAATAAGG - Intergenic
1045024894 8:98077219-98077241 ACAGTGGTTGACATTCACTGAGG - Intronic
1046651709 8:116842753-116842775 CCAGTGTGTGACTCTGAGTTAGG - Intronic
1049151712 8:141039213-141039235 ACAGTGGGTGCCAGGGACTGTGG - Intergenic
1049334831 8:142078413-142078435 CCACTGGCTTTCACTGACTGGGG + Intergenic
1049833918 8:144720768-144720790 CCAGTGGTTTCCACGGACTGGGG + Intergenic
1050564816 9:6870968-6870990 CCTGTTGGTGACAGTGACAGAGG + Intronic
1050932128 9:11342915-11342937 CCAGCAGATGACACTGACTATGG - Intergenic
1051098779 9:13497261-13497283 ACAGTGGGGGAAACTGACTAAGG + Intergenic
1051488460 9:17634520-17634542 CTAGTGGTTGACAATGAGTGAGG - Intronic
1052758629 9:32567154-32567176 CCAGCGGGTGCCACTGCCTGCGG - Exonic
1053285815 9:36848935-36848957 ATGGTGGGTGACACTGACTTAGG - Intronic
1055991160 9:82107168-82107190 CCAGTCTGTGACAGTGAATGGGG + Intergenic
1057793190 9:98137554-98137576 TCAGGGGCTGACACTCACTGTGG + Exonic
1060219622 9:121757430-121757452 CCAGTGGATGACAGTGAGTAGGG + Intronic
1061589900 9:131591527-131591549 GCAGAGGGTGACATTTACTGAGG + Intronic
1189703920 X:43741054-43741076 CAGGTAAGTGACACTGACTGGGG - Intronic
1201251180 Y:12059219-12059241 CCAGTCTGTGACTCTAACTGGGG - Intergenic