ID: 1034860479

View in Genome Browser
Species Human (GRCh38)
Location 7:154590931-154590953
Sequence CCACAGTCAGTGTCACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860477_1034860479 -2 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data
1034860474_1034860479 10 Left 1034860474 7:154590898-154590920 CCATAATGATGGCCTCGACAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data
1034860471_1034860479 25 Left 1034860471 7:154590883-154590905 CCACTGTATCTCAGCCCATAATG 0: 1
1: 0
2: 0
3: 19
4: 329
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data
1034860473_1034860479 11 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860479 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860479 Original CRISPR CCACAGTCAGTGTCACCCAC TGG Intronic
No off target data available for this crispr