ID: 1034860481

View in Genome Browser
Species Human (GRCh38)
Location 7:154590945-154590967
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860478_1034860481 -9 Left 1034860478 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG 0: 1
1: 0
2: 4
3: 16
4: 186
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data
1034860477_1034860481 12 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC No data
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data
1034860474_1034860481 24 Left 1034860474 7:154590898-154590920 CCATAATGATGGCCTCGACAAGG No data
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data
1034860473_1034860481 25 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860481 7:154590945-154590967 ACCCACTGGACCACAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type