ID: 1034860484

View in Genome Browser
Species Human (GRCh38)
Location 7:154590950-154590972
Sequence CTGGACCACAGTGATGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034860474_1034860484 29 Left 1034860474 7:154590898-154590920 CCATAATGATGGCCTCGACAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
1034860478_1034860484 -4 Left 1034860478 7:154590931-154590953 CCACAGTCAGTGTCACCCACTGG 0: 1
1: 0
2: 4
3: 16
4: 186
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
1034860473_1034860484 30 Left 1034860473 7:154590897-154590919 CCCATAATGATGGCCTCGACAAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
1034860477_1034860484 17 Left 1034860477 7:154590910-154590932 CCTCGACAAGGAATGAGATGGCC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034860484 Original CRISPR CTGGACCACAGTGATGGGCG TGG Intronic
902285421 1:15405336-15405358 CTGGGCCACAGTGATGGCTGAGG + Intergenic
903641267 1:24862005-24862027 CAGGACCAAACTGATGGCCGCGG - Intergenic
903700963 1:25247795-25247817 CTGGACGTCAGTGCCGGGCGGGG + Intronic
903813041 1:26045567-26045589 CTGGGGCAAAGTGCTGGGCGGGG + Intronic
904369325 1:30038523-30038545 CTGGACCAAAGTGATGCATGGGG - Intergenic
908019647 1:59886656-59886678 CTGGACCAGAGAGAAGGGCTGGG + Intergenic
908800335 1:67873477-67873499 CAGGACCAGAGAGATGGGCCTGG + Intergenic
908843101 1:68298158-68298180 CTAGACCATAGTGAGGGGCTTGG + Intergenic
911161299 1:94685298-94685320 CTGGAGCAAACTGATGGGCCTGG - Intergenic
911659719 1:100487757-100487779 CTGGACTTCAGTGCTGGGCTGGG + Intronic
913250039 1:116905845-116905867 CTGGAATACAGTGAAGGACGGGG - Intergenic
917993364 1:180407468-180407490 ATGGACAACAGTGATAGGGGTGG - Intronic
918162635 1:181915493-181915515 CTGGGCCACAGAGCTGGGGGTGG - Intergenic
922249240 1:223832555-223832577 CTGTATCACAGTGTTGGGAGAGG - Intronic
922984125 1:229852735-229852757 CTGGAACACAGAGAAGGGCTTGG + Intergenic
923326774 1:232886955-232886977 CTAGACCACAGCGAGGGGAGTGG - Intergenic
1063062753 10:2574964-2574986 CTGCACCACAGTGAAGAGCCAGG - Intergenic
1063161354 10:3421102-3421124 CTGGACCTCAGTGCTGTGCCTGG + Intergenic
1063166450 10:3467601-3467623 CTACACCACAGGGTTGGGCGGGG + Intergenic
1063188960 10:3676039-3676061 TTGGGCCACCGTGATGGGTGAGG - Intergenic
1068561037 10:58513848-58513870 CTTGACCACAGGGGTGGGGGCGG - Intronic
1071436048 10:85648933-85648955 CTGGACCACAGTGTTGGTTGTGG - Intronic
1074451067 10:113560047-113560069 CCAGACCACAGTGATGAGCCAGG - Intronic
1076731420 10:132440878-132440900 CTGCACCACAGTGGTGGCTGGGG - Intergenic
1076761942 10:132610343-132610365 GTGGAGCCCAGTGATGGGGGTGG + Intronic
1076776657 10:132701618-132701640 CTGGAGGACAGTGTTGGGTGTGG + Intronic
1091498215 12:990978-991000 CCGAAACAGAGTGATGGGCGCGG - Intronic
1091694966 12:2622288-2622310 CAGGACCACAGTGAGGAGTGTGG + Intronic
1095669933 12:44847133-44847155 AAGGACCACAGTAATGGGCAAGG + Intronic
1097021939 12:56026900-56026922 CTGGGCTACTGTGATGGGAGTGG + Exonic
1098145923 12:67497846-67497868 CTGGACCAGAGTGATAGTGGTGG - Intergenic
1098864465 12:75746090-75746112 CTGGGCCACAGTGCTTGGCCAGG - Intergenic
1102156367 12:110732459-110732481 CTGGAAAACACTGATGGGGGAGG - Intronic
1103949282 12:124542425-124542447 AGGGCCCACAGAGATGGGCGAGG + Intronic
1104521032 12:129475305-129475327 CTGGACCACAGTGAGAGCAGTGG + Intronic
1106121482 13:26863261-26863283 CTGGACCACAGTGGAGGAAGTGG - Intergenic
1106717960 13:32410398-32410420 CTGGCCCACATTGAAGGGCGAGG + Intronic
1107439368 13:40410968-40410990 CTGGATCACAGCTATGGGAGAGG - Intergenic
1107972744 13:45659864-45659886 ATGGCCCACAGTGGTGGGGGAGG + Intergenic
1108992875 13:56685267-56685289 CTAGAACACAGTGTTGGGGGTGG + Intergenic
1110048441 13:70860762-70860784 CTGGACCCGTGTGATGGGAGGGG + Intergenic
1111334310 13:86800999-86801021 CTGGGCCACAGTGATGCAAGAGG - Intergenic
1113506044 13:110816624-110816646 CTGGACAACACTGATGGCAGTGG + Intergenic
1115903137 14:38176643-38176665 TTGGACCACAGTGGTAGGAGGGG - Intergenic
1116066069 14:39984750-39984772 CTGGACTACAGTGGTGGCCATGG + Intergenic
1119386647 14:74261503-74261525 CTGGACTCCACTGATGGGTGGGG - Exonic
1121237651 14:92404462-92404484 CTGGAGCACTGTGATGGATGGGG - Intronic
1121452243 14:94016442-94016464 CTGGCCCCCAGTGAAGGGGGTGG - Intergenic
1122221067 14:100239352-100239374 CGAGACCACAGTGGTGGGCGAGG + Exonic
1122303248 14:100744036-100744058 CTGGACCACAGTGATGCTTTAGG - Intergenic
1202884097 14_KI270722v1_random:87927-87949 CTCAACCACAGTGAGGGGAGTGG + Intergenic
1124681111 15:31731746-31731768 CTGGACCACTCTGGTGGGGGAGG + Intronic
1124902650 15:33838610-33838632 CTGGAGCACAGTGTTTGGAGGGG + Exonic
1125233493 15:37484342-37484364 CTGGGCCTCTGTGATGGGAGGGG + Intergenic
1129346171 15:74921115-74921137 ATGAACCACAGGGCTGGGCGCGG + Intronic
1129756665 15:78103083-78103105 CAGGCCCACAGAGATGGGAGAGG - Intronic
1131399803 15:92115270-92115292 CTTGACCACAGAGATGGCCCAGG + Intronic
1132166741 15:99600170-99600192 CTGAACCTCAGTGATGGCTGTGG + Intronic
1132578905 16:676267-676289 CTGGACCAAAGGGCTGGGCCAGG - Intronic
1133175729 16:4012830-4012852 TTGGAAAAGAGTGATGGGCGAGG + Intronic
1134783993 16:16924351-16924373 GTGGACCACAGTGATGTTTGGGG + Intergenic
1135733979 16:24916215-24916237 CTGGACCATTGTGATGGCCCTGG - Intergenic
1140541033 16:75756564-75756586 CTGCACCACAGTGTTGAGCAGGG - Intronic
1141444458 16:84049131-84049153 CTGGCCCACAGCGATGGTCCTGG - Intergenic
1143901587 17:10178505-10178527 CTGGAGCCCTGTGGTGGGCGTGG - Intronic
1144470451 17:15535518-15535540 ATGGAGCACAGTGATGGCTGGGG - Intronic
1144925890 17:18808154-18808176 ATGGAGCACAGTGATGGCTGGGG + Intergenic
1152590282 17:81208379-81208401 CTAGCCCAGAGTGGTGGGCGAGG - Intronic
1153616597 18:6940698-6940720 CTGGCCCACCGTGTTGGGTGAGG - Intergenic
1155070017 18:22306871-22306893 CTGAAACAGAGTGATGGGCTGGG + Intergenic
1156275178 18:35577270-35577292 ATGAACCACAGTGATGGGCTTGG - Intergenic
1159010932 18:63058004-63058026 CTGGACCACAGTAAGGGGCAGGG + Intergenic
1159028618 18:63208966-63208988 CTGGACCACAGTGATGTTTGGGG + Intronic
1160657228 19:279831-279853 CAGGACCACAGTGAGGGATGAGG - Intergenic
1160951953 19:1672051-1672073 CCGGACCACAGGGAGGGGAGGGG - Intergenic
1161356860 19:3823886-3823908 CTGGACCACCGTGCTGTGCGTGG - Intronic
1161625654 19:5325074-5325096 CTGGGCCCCAGTGATTGTCGGGG - Intronic
1162994556 19:14325910-14325932 CTGGACAACCTTGATGGGCAGGG - Intergenic
1163108113 19:15139242-15139264 ATGGACCACACTGATGGGCTTGG - Intergenic
1165266223 19:34665252-34665274 CTGGACCACAGTGATGACAAGGG + Intronic
1166140862 19:40804436-40804458 ATGGAGCAGAGTGATGGGAGAGG + Intronic
1167334481 19:48875947-48875969 CTGGACCTCAGTGGGAGGCGTGG + Exonic
1167423828 19:49419271-49419293 CTTGGCCACAGGGATGGGCATGG - Intergenic
1167528991 19:50003144-50003166 CTGGAGCTCAGTGGTGGGCTGGG - Intronic
1168575076 19:57502628-57502650 CTGGACCAGAGTGGTGGCTGTGG + Intronic
1168642745 19:58040713-58040735 CTGGGGCTCAGTGCTGGGCGAGG + Intronic
1168665238 19:58200153-58200175 CTGGATCACAGTGATGAGTGGGG + Intronic
925262623 2:2541683-2541705 CTGGGCCACAGTGCTGTGAGGGG + Intergenic
926783331 2:16495871-16495893 CTTTACCACAGTGATGGCCAAGG + Intergenic
931193110 2:60024568-60024590 CAGGACAGCAGTGATGGGGGTGG + Intergenic
933220244 2:79679573-79679595 CAGGACCACAGAGATGGGAAAGG - Intronic
933235176 2:79856822-79856844 CTGGACCAAGGAGATGGGAGAGG - Intronic
933918322 2:87018986-87019008 CTTGACCACTTTGAGGGGCGTGG + Intronic
934004674 2:87750927-87750949 CTTGACCACTTTGAGGGGCGTGG - Intronic
934169259 2:89325764-89325786 CTGGAACACAGGGAGGGGCCTGG + Intergenic
934198034 2:89856820-89856842 CTGGAACACAGGGAGGGGCCTGG - Intergenic
934790447 2:97055470-97055492 CTGGAACACAGGGAGGGGCCTGG - Intergenic
934816020 2:97327062-97327084 CTGGAACACAGGGAGGGGCCTGG + Intergenic
934821676 2:97381422-97381444 CTGGAACACAGGGAGGGGCCTGG - Intergenic
935008910 2:99112702-99112724 CTGGAGCACAGTGAGGGAAGGGG + Intronic
935767631 2:106384960-106384982 CTTGACCACTTTGAGGGGCGTGG - Intergenic
938645199 2:133323579-133323601 CTGGAACACACTGAAGGGCAGGG - Intronic
940446853 2:153786380-153786402 CTGGTCCACAGTCATGAGCCAGG - Intergenic
942547424 2:177079532-177079554 CTGGACCACAGTGGTGCCTGGGG + Intergenic
1168846695 20:949979-950001 CTGGACCTCACTGTCGGGCGGGG - Intergenic
1168875780 20:1171340-1171362 CTGGGCCACAGGAATGGGCTCGG + Intronic
1168970761 20:1929310-1929332 CTGGACCAAAGTGGTGGGATGGG + Intronic
1169206315 20:3742169-3742191 CTGGACCACAGTCAGTGGAGGGG + Intronic
1170750561 20:19141023-19141045 CTGCACCACAGTGTTGGGATGGG + Intergenic
1172917526 20:38454102-38454124 CTGGACCAAGGTGATGGGTTAGG - Intergenic
1174307203 20:49621608-49621630 CTGAAGCACAGTGAAGGGAGAGG - Intergenic
1174653804 20:52152755-52152777 GTGTCCCACAGTGAGGGGCGTGG + Exonic
1174773853 20:53325536-53325558 CGGGACTTCAGTGATGGGCCAGG + Intronic
1175489713 20:59371650-59371672 CTGGCCCACAGCCAGGGGCGTGG + Intergenic
1175691874 20:61071368-61071390 CTGGACAACAGGGAAGGGAGCGG + Intergenic
1178232855 21:30807032-30807054 CTGGGCCACAGTGATGCCTGTGG - Intergenic
1178640756 21:34343243-34343265 CTGGAGCACAGTGATGCACATGG + Intergenic
1178853273 21:36230835-36230857 CTGAGGCACAGTGATGGGCTTGG - Exonic
1179294514 21:40049294-40049316 CTGGAGCACAGTGAAAGGCAGGG - Intronic
1179641589 21:42751246-42751268 CAGGGCCACAGGGCTGGGCGTGG - Intronic
1179938439 21:44621443-44621465 CTGGAGCAGACTGATCGGCGGGG - Intronic
1179970662 21:44835505-44835527 CTGAGCCACAGCGATGGTCGTGG + Intergenic
1180068520 21:45424653-45424675 CTGGACCAGAGCGCTGGGCCAGG + Intronic
1180141114 21:45893764-45893786 CTGGAACACAGTGTGGGGAGGGG + Intronic
1181370335 22:22410204-22410226 CTGGAGCCCAGTGATGGCCAGGG - Intergenic
1181392675 22:22594978-22595000 CTGGGCCCCAGTGATGGTCAGGG - Intergenic
1182548628 22:31089628-31089650 CTGGCCCTCAGTGGTGGGGGTGG + Intronic
1184472068 22:44701906-44701928 CGCGACCGCAGTGCTGGGCGGGG + Intronic
1185204985 22:49532677-49532699 CAGGCCCAGAGTCATGGGCGTGG - Intronic
950112134 3:10426016-10426038 CTGGAGCACAATGATGGGAAGGG - Intronic
950850758 3:16060167-16060189 CTTCAGCACAGTGATGGGTGGGG + Intergenic
950967653 3:17157000-17157022 CTGGACCACAGTGCTGGGGCTGG + Intergenic
952998170 3:38905254-38905276 CTGGACCACTTTGATGAGCATGG - Exonic
954568923 3:51624279-51624301 CTGGAGTACAGTGAGTGGCGTGG + Intronic
955071874 3:55578364-55578386 CTGGAGCACAGTGAAGTGTGTGG - Intronic
960466376 3:118000909-118000931 CTGAACTAAAGTGAAGGGCGTGG - Intergenic
960939386 3:122923477-122923499 GTGGACCCCAGAGATGGGCATGG + Intronic
964110589 3:153083243-153083265 CTGGACCACATTGTGGGGGGTGG + Intergenic
966884999 3:184372618-184372640 CTGGACCACAGGGGTGGGCAAGG + Exonic
968702895 4:2065146-2065168 CTGGCCCAGTGTGATGGGGGTGG + Exonic
970082147 4:12299603-12299625 CTGGACCACAGTTATGTGAATGG + Intergenic
970410164 4:15798260-15798282 CAGCAGCACAGTGATGGCCGAGG + Intronic
974588264 4:63910096-63910118 TTGGACCACAGTGATGTTCTTGG + Intergenic
974652583 4:64774592-64774614 ATGGACTACAGTGTTGGGAGTGG + Intergenic
978154517 4:105473929-105473951 CTGTACCACACTGAGGAGCGCGG - Exonic
978383663 4:108158006-108158028 CTGTACCAAAGTGAAGAGCGGGG - Intronic
978797199 4:112719948-112719970 CTGGAGCACAGTTTTGGGGGAGG + Intergenic
979473248 4:121125592-121125614 GTGGACCACAGTTGTGGGCCAGG + Intergenic
980869370 4:138593583-138593605 CTGGACCAGAGTGATGGTGCTGG - Intergenic
988469565 5:31526211-31526233 CGAGATCACAGTCATGGGCGAGG - Exonic
989378796 5:40793816-40793838 CTGAACCACCGTGCTGGGCTGGG - Intronic
990562857 5:57000945-57000967 CTGAACCTCACTGATGGGGGTGG - Intergenic
995176755 5:109186858-109186880 CTGGTCCCCAGTGAGGGGCATGG + Intronic
997254405 5:132417325-132417347 TTGCACCACAGTGGTGGCCGTGG - Intronic
998411526 5:141914942-141914964 CTGGAACCCAGTGATGGAAGGGG - Intergenic
1001053911 5:168434039-168434061 CTGGAGCCCAGAGATGGGGGTGG + Intronic
1002987290 6:2202804-2202826 CTGGACCACAGTGGAGAGAGGGG + Intronic
1003567929 6:7236251-7236273 TTGTCCCACAGTGATGGGCTTGG + Intronic
1005212864 6:23488709-23488731 CTGGAGCACAGTGCTGGCCAGGG + Intergenic
1007517271 6:42422732-42422754 CTGGACGGCAGTGATGGAAGGGG - Intronic
1010088021 6:71944383-71944405 CTGGGGCACAGTGTTGGGAGTGG + Intronic
1015347557 6:132178062-132178084 ATGAACCACAGTGATGGCCCAGG + Intergenic
1015694201 6:135962036-135962058 ATGGACCACTCTGATGGGGGAGG + Intronic
1015994501 6:138984401-138984423 CTGGACTATAGTGGTGGGAGTGG - Intronic
1018128466 6:160705088-160705110 CTTGACCACTTTGAGGGGCGTGG - Intronic
1018746627 6:166767372-166767394 CTGGAGCACATTGATCCGCGCGG - Intronic
1019670929 7:2277892-2277914 CTGGGCCAGAGTGAGGTGCGGGG + Intronic
1023868351 7:44249565-44249587 ATGGACCACAGGGATGGGCTGGG - Intronic
1024604455 7:51012695-51012717 CTGGACTACAGAGAAGGGGGTGG + Intergenic
1026464797 7:70644828-70644850 CTGGACTACAGAGTTGGGCCAGG - Intronic
1028145573 7:87316607-87316629 CTGGACCACAGTGAGTAGCAAGG + Intergenic
1028483035 7:91328743-91328765 GTAGAACACAGTTATGGGCGTGG - Intergenic
1030673909 7:112365233-112365255 CTGGACAACAGTGTTGGCTGAGG + Intergenic
1032145471 7:129375831-129375853 CTGGACCACAGAGGTGGCAGTGG + Intronic
1032679483 7:134167390-134167412 CTGTATCACAGTGATGGACTTGG + Intronic
1034860484 7:154590950-154590972 CTGGACCACAGTGATGGGCGTGG + Intronic
1035319264 7:158017954-158017976 CCAGCCCACAGTGATGGGCTCGG - Intronic
1052334897 9:27309149-27309171 CTGGAAGACAGTGATGCGGGAGG - Intergenic
1052835712 9:33248506-33248528 CTGGAGAACAGTGGTGGGCATGG + Exonic
1056823658 9:89861608-89861630 CAGGTGCACAGTGAGGGGCGTGG + Intergenic
1056828109 9:89890802-89890824 CTTGACCACAGTGTTGTGCTAGG + Intergenic
1057529022 9:95827493-95827515 CTGGGGCAGAGTGATGGGAGTGG + Intergenic
1059331180 9:113536707-113536729 CTGGAGCCCAGGGATGGGCTTGG + Intronic
1060964289 9:127703929-127703951 CTGCAACACAGGGATGGGCAGGG + Intronic
1061194927 9:129102409-129102431 GTGTACCACGGTGATGTGCGTGG + Exonic
1189213775 X:39306063-39306085 GTGGACCACAGGGATGTGGGAGG + Intergenic
1189472270 X:41323177-41323199 ATGCACCACAGTGGTGGGCGTGG + Intergenic
1190741574 X:53292223-53292245 GTGGATCACAGTGAGGAGCGTGG + Intronic
1190795412 X:53736692-53736714 TTGGACTACAGTGATGGCAGTGG - Intergenic
1191129824 X:56995628-56995650 CTGTACCACAGCCCTGGGCGTGG + Intergenic
1195477580 X:105304064-105304086 CTGGGCCACAGAAATGGGTGAGG + Intronic
1197637992 X:128937981-128938003 GTAGACCACAGTGATGGCAGAGG + Intergenic
1199496559 X:148458782-148458804 CTGGACCACATTGTAGGGGGTGG - Intergenic