ID: 1034864030

View in Genome Browser
Species Human (GRCh38)
Location 7:154625266-154625288
Sequence ATAGCTGCTTAGTTTATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034864030_1034864032 30 Left 1034864030 7:154625266-154625288 CCAAGAATAAACTAAGCAGCTAT 0: 1
1: 0
2: 1
3: 12
4: 206
Right 1034864032 7:154625319-154625341 TTTTTTTTTTTTAAGATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034864030 Original CRISPR ATAGCTGCTTAGTTTATTCT TGG (reversed) Intronic
902993843 1:20208621-20208643 CTAGCTGTTAACTTTATTCTAGG - Intergenic
905567317 1:38975991-38976013 ATACTTTCCTAGTTTATTCTAGG + Intergenic
906955974 1:50374235-50374257 ATTTCTTCTTAGTTTAATCTAGG - Intergenic
908317244 1:62944964-62944986 AAAGCAGCTTATTTTTTTCTAGG - Intergenic
908681073 1:66661545-66661567 GTAGCTGCCTATTTTATTTTTGG - Intronic
909787649 1:79635899-79635921 ATAGTAGCTGAGTCTATTCTAGG - Intergenic
911282474 1:95947816-95947838 TTAACTCCTTTGTTTATTCTGGG - Intergenic
911507386 1:98770097-98770119 CTACCTGCTTAGATCATTCTGGG + Intergenic
912528235 1:110300870-110300892 GTAGCTGCTTAGCATATTCTAGG + Intergenic
912885507 1:113468113-113468135 ATAGGTGCTAAGTTTCTTATAGG + Intronic
913442422 1:118912171-118912193 GTATTTGCTTATTTTATTCTTGG - Intronic
915180893 1:154058738-154058760 ATAGTTGCTTTGATTATGCTTGG - Intronic
917834755 1:178932576-178932598 AGAACTGCTTCTTTTATTCTTGG + Intergenic
918057233 1:181032510-181032532 TTGGCTTCTTATTTTATTCTGGG + Intergenic
918553916 1:185776697-185776719 ACAGATGCTTCATTTATTCTGGG + Intronic
1063756489 10:9016205-9016227 ATAGAAGCTAAGTTTATTTTGGG + Intergenic
1064551488 10:16505734-16505756 ATAGCTACCTAGTTTGGTCTTGG + Intronic
1068238720 10:54274528-54274550 TTGGCTGCTTATTTTATTCCAGG - Intronic
1069099254 10:64297591-64297613 ATAGCTGCTTATTTTATTTGAGG - Intergenic
1070246038 10:74731938-74731960 AAAGCTGTTTTGGTTATTCTAGG - Intergenic
1070966248 10:80533149-80533171 ATTGCTTCTTAGCTTTTTCTTGG - Intergenic
1072147506 10:92655466-92655488 GTACCTGCATAGTTTATTTTGGG - Intergenic
1073847382 10:107572891-107572913 ATAGCTTCTTATTTTATATTTGG - Intergenic
1078849075 11:15147750-15147772 CTAGCACCCTAGTTTATTCTGGG + Intronic
1082120552 11:48375155-48375177 ATATCTTCTTGGTTTAATCTGGG + Intergenic
1082635901 11:55593463-55593485 ATATCTGCAAATTTTATTCTTGG + Intergenic
1083809262 11:65094260-65094282 ATGGCTGCTTAGTTGAGGCTAGG - Intronic
1087509161 11:99068201-99068223 GTAGATGCCTACTTTATTCTAGG + Intronic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1097512518 12:60561724-60561746 ATATCTTCCTAGTTTAATCTTGG + Intergenic
1098000173 12:65933021-65933043 ATATATGCTAAGTTTATTCTTGG + Intronic
1098315590 12:69189472-69189494 ATAACTGGTCATTTTATTCTAGG - Intergenic
1098378274 12:69841052-69841074 ATAACTGATTAGATTCTTCTTGG + Intronic
1099301839 12:80905876-80905898 ATAGCAGCTTATTATTTTCTTGG + Intronic
1099994970 12:89768662-89768684 ATAGCAACTTAATTTCTTCTTGG + Intergenic
1100500886 12:95173041-95173063 AAAGCTTCTTAGTTTATTCTAGG - Intronic
1100683404 12:96956424-96956446 AAAGTTGCTTTGGTTATTCTAGG - Intergenic
1102457251 12:113078257-113078279 AAAGGTGCTTAGTTGATGCTTGG - Intronic
1103109508 12:118263022-118263044 AAAGTTGCTTTGGTTATTCTGGG - Intronic
1105503842 13:20993328-20993350 ATAAGTGCTTAATTTGTTCTAGG - Intronic
1107086851 13:36434186-36434208 ATAGCTGCTTAGTCAGTACTGGG - Intronic
1107781384 13:43906868-43906890 ATATCTCCTTAGATTCTTCTTGG + Intergenic
1108792426 13:53987587-53987609 ATAGCTTTTTATTTTGTTCTAGG - Intergenic
1108831924 13:54490031-54490053 ATATCTTCCTAGTTTAATCTAGG - Intergenic
1109392292 13:61708769-61708791 ATAGATGCTTTTTTTGTTCTGGG - Intergenic
1109530732 13:63642991-63643013 ATAGATGATTTGTTTATTGTAGG + Intergenic
1109872853 13:68358337-68358359 ATGACTGCTTATTTTATTTTAGG + Intergenic
1110104914 13:71660472-71660494 ACATTTGCTTACTTTATTCTTGG - Intronic
1111226591 13:85281158-85281180 ATAGTAGCTCATTTTATTCTTGG + Intergenic
1112419216 13:99232558-99232580 TTAGCTGCTTGCTTTATCCTAGG - Intronic
1112994704 13:105559365-105559387 ATAGCTGTTTATTTTATTCGAGG - Intergenic
1114137468 14:19868233-19868255 ATGGCTGCTTAGTTTCCTCATGG + Intergenic
1115144561 14:30211404-30211426 AGAGCTGCATGGCTTATTCTAGG - Intergenic
1123851969 15:24366894-24366916 TTAGTTGCTTAGTATATTGTGGG - Intergenic
1127433487 15:58934220-58934242 ATGGCAGCTTAGGTTATTCTAGG + Intronic
1127694401 15:61430475-61430497 ATATCTTCTTAGTTTAATATAGG + Intergenic
1128198576 15:65783763-65783785 ATAGATGGTTATTTTATACTTGG - Intronic
1129984645 15:79907205-79907227 ATAGCTGTTTAGGTTATTTCAGG - Intronic
1129994427 15:79992240-79992262 ATTGCTACTTAGTCTAGTCTGGG - Intergenic
1130539708 15:84813398-84813420 ATAGGTACCCAGTTTATTCTGGG + Intergenic
1132876578 16:2141912-2141934 ATAGTTGCTAAGATTTTTCTAGG + Intronic
1133173937 16:3999528-3999550 ATAGCTGCTCAGGTCACTCTAGG - Intronic
1137768950 16:50999736-50999758 ATAGCTGTTTATTTTCTTTTAGG - Intergenic
1139840913 16:69879166-69879188 ATAAGTTCTTAGTATATTCTAGG + Intronic
1140716918 16:77735071-77735093 ATGGCTGCTTATTATGTTCTGGG - Intronic
1142386663 16:89769529-89769551 AGAGCTGCTTTGTTTTGTCTTGG - Intronic
1142452699 16:90190487-90190509 ATAGCTTCTGAGTTGATTGTAGG + Intergenic
1142910512 17:3086220-3086242 ATATCTTCCTAGTTTAATCTAGG + Intergenic
1146431725 17:32803064-32803086 ACAGCTGCTTACTTTATACAGGG - Intronic
1150381254 17:64721819-64721841 ATAGATGCTCAGTTTCTTTTAGG + Intergenic
1150775247 17:68076284-68076306 ATAGATGCTCAGTTTCTTTTAGG - Intergenic
1153405884 18:4738866-4738888 ATAACTTTTTATTTTATTCTAGG + Intergenic
1153445361 18:5166111-5166133 ATAGATGCTTATATTATTTTTGG - Intronic
1159336067 18:67068199-67068221 ATGCCTTCTTAGTATATTCTAGG + Intergenic
1159908864 18:74124290-74124312 ATATTTGCTTTATTTATTCTGGG - Intronic
1160644787 19:178275-178297 ATAGCTTCTGAGTTGATTGTAGG - Intergenic
1163256724 19:16160547-16160569 GTAGCTGCTTAATTTATTAGCGG + Intergenic
925113054 2:1352603-1352625 AAAGCTTATGAGTTTATTCTTGG + Intronic
926430138 2:12777345-12777367 ATAGATACTAAGTTTATTTTAGG + Intergenic
926617758 2:15015067-15015089 ATTTCTTCTTAGTTTAATCTTGG - Intergenic
929650096 2:43670637-43670659 TAAGCTGCTTAGGCTATTCTAGG + Intronic
930071102 2:47367101-47367123 ATAACCAGTTAGTTTATTCTTGG + Intronic
930811287 2:55544499-55544521 GTAGCTGCTAAGTCTTTTCTAGG + Intronic
930996304 2:57722444-57722466 ATAGATTCTTAGGTCATTCTAGG + Intergenic
931100101 2:58989135-58989157 ATGGCTGTTTAGTTTATTGAAGG - Intergenic
932319463 2:70810681-70810703 ATAGCTTCTTTGTTTAGTATAGG - Intronic
932503243 2:72203668-72203690 ATAATTGCTTAGTGAATTCTTGG - Intronic
935634688 2:105241426-105241448 ATAGCTGATTAGGTTTTTCTGGG + Intergenic
938753406 2:134357046-134357068 TTAGCTGCTTTGTTTATTGCTGG + Intronic
939600559 2:144184450-144184472 ATAGCTCCTTATTTTTTTGTTGG - Intronic
939760175 2:146165798-146165820 ATGGCAGTTCAGTTTATTCTTGG + Intergenic
939984864 2:148820030-148820052 ATAGCTGCTTTATTTATTACAGG + Intergenic
940326873 2:152434710-152434732 ATAGCTGATTTGTTTGTTATTGG + Intronic
942740853 2:179175925-179175947 ACAGCTGGTAAGTTTCTTCTGGG + Intronic
942841364 2:180365526-180365548 ATAACTGCTTAGTTAATATTAGG - Intergenic
943155467 2:184169506-184169528 ATGGCTGCTTTGTTTTTGCTGGG - Intergenic
943682688 2:190784892-190784914 ATAGCTGCTTGCTTTCTTCCTGG - Intergenic
944247881 2:197550736-197550758 ATAGCTTCTTTGTTTAGTATAGG + Exonic
946450785 2:219777259-219777281 ATATTTGATTAGATTATTCTGGG - Intergenic
947324301 2:228957810-228957832 AGATCTGCTTATTTTAATCTGGG + Intronic
1170534480 20:17326363-17326385 ATAGTTCCTTAGGTTCTTCTTGG - Intronic
1173431392 20:42989990-42990012 ATAGGTGCTTTGTTTCTTATAGG + Intronic
1174495253 20:50936763-50936785 AGAGCAACTTAGTTTATCCTGGG - Intronic
1175580883 20:60098337-60098359 ATAATTGCTTTGTTTATTTTTGG + Intergenic
1177254523 21:18643983-18644005 ATACTTGCTTATTTTATTCATGG + Intergenic
1177394902 21:20521273-20521295 AGAGGGGCTTATTTTATTCTAGG + Intergenic
1177684823 21:24422250-24422272 ATAGCTGCTTCCATTTTTCTTGG + Intergenic
1177825583 21:26079418-26079440 ATAGCTGCGTAATTCAGTCTTGG - Intronic
1177935070 21:27334995-27335017 ATTTCTTCTTAGTTTAATCTAGG - Intergenic
1179056574 21:37941600-37941622 AAAGTTGCTTTGATTATTCTAGG + Intergenic
1179489184 21:41729170-41729192 ATTGCTGTTTAATTTATTCAGGG + Intergenic
1181869503 22:25886653-25886675 ATGGCTGCCTGGTTTGTTCTAGG + Intronic
950820014 3:15746903-15746925 ATACCTTCCTAGTTTAATCTAGG + Intronic
951146426 3:19233415-19233437 TTTGCTGCTTTGTTTATTATAGG + Intronic
952307844 3:32161185-32161207 ATGGCTGATTAATTTGTTCTGGG - Intronic
952689052 3:36182167-36182189 ATAGCTCCTTAGATTCCTCTTGG + Intergenic
954997004 3:54890940-54890962 AAAGCTACCAAGTTTATTCTTGG - Intronic
955896953 3:63710537-63710559 CTTGTTGCTTAGATTATTCTAGG - Intergenic
957031630 3:75249083-75249105 ATAGCTGCTTATTTACTACTTGG - Intergenic
957362305 3:79175122-79175144 TTAGCTGGATAGTTTATTTTAGG + Intronic
957720924 3:83998702-83998724 CTAGCTGTTTAGTTTCTTTTGGG + Intergenic
959150748 3:102604500-102604522 ATAGCTGCTTATTCTCTTCCAGG + Intergenic
959160456 3:102717524-102717546 ATTGCACCTTAGTTTATTGTGGG + Intergenic
962190353 3:133303887-133303909 GTAGCTTCTGATTTTATTCTTGG + Intronic
963236323 3:142960922-142960944 AAAACTGCCTTGTTTATTCTTGG + Intronic
965451182 3:168840602-168840624 ACAGCTGCCCAGTTTATTCAAGG - Intergenic
965472346 3:169110221-169110243 AAAGATGCTTATTGTATTCTTGG - Intronic
966153009 3:176885754-176885776 ATTTCTTCTTAGTTTAATCTTGG - Intergenic
966496562 3:180588026-180588048 ATTGCTGCTGAGATTTTTCTTGG - Intergenic
970720090 4:18976608-18976630 ATAGCTACTAATTATATTCTAGG + Intergenic
970846798 4:20549200-20549222 GTAACTGCTTTGTTGATTCTTGG + Intronic
972899541 4:43666230-43666252 ATTTCTTCTTAGTTTAATCTAGG + Intergenic
975266802 4:72379033-72379055 ATGGCTGCTTACTCTCTTCTAGG + Intronic
975818985 4:78250369-78250391 ATAGTTCCTTAGTGTACTCTTGG + Intronic
976864937 4:89713491-89713513 ATAGCTTCTTAACCTATTCTGGG + Intergenic
978103951 4:104878267-104878289 AGAGTTGCTTAGTTAATGCTAGG - Intergenic
980644837 4:135630070-135630092 ATATCTTCCTAGTTTAATCTAGG + Intergenic
982057382 4:151565807-151565829 ATAGTTTCTTACTTGATTCTAGG + Intronic
983225177 4:165079388-165079410 TTAACTGCTTGGTTTATCCTAGG - Exonic
984735582 4:183104787-183104809 ATAGTTGCTTAGTATATTGGAGG + Intronic
984819804 4:183871842-183871864 ATAGCTGCATATTTTTTTTTTGG - Intronic
986421177 5:7585133-7585155 ATAGCTGCTTTTTTTCTTTTGGG + Intronic
988366170 5:30302953-30302975 ATAGATTCTTATTTTATTCATGG + Intergenic
989414397 5:41156555-41156577 ACAACTGCTTAGTCAATTCTTGG - Intronic
990498826 5:56374498-56374520 AAAGTTGCTTTGCTTATTCTAGG + Intergenic
991132791 5:63144519-63144541 ATATATGCTTTCTTTATTCTTGG + Intergenic
991436164 5:66598181-66598203 TTAGCTGCTTAGCTGGTTCTTGG + Intronic
991575396 5:68098119-68098141 ATAGATGCTTAGTAAATACTTGG - Intergenic
994293765 5:98064213-98064235 AAAGCTGCCTAGTTGTTTCTAGG + Intergenic
994640702 5:102406092-102406114 CTAGCTGCTTATTTTATTATTGG - Intronic
994924960 5:106103463-106103485 GTAGCTGATGAGTTTATACTAGG - Intergenic
996743210 5:126821202-126821224 ATAGCTCCTTAGTTTTTGTTTGG + Intronic
997230912 5:132242408-132242430 ATATCTTCCTAGTTTAATCTAGG - Intronic
997483808 5:134211321-134211343 ATAGCTGATTATTTTATAGTGGG - Intronic
998215778 5:140237843-140237865 ATAGCTGCTTGGTTTTGTCCAGG + Intronic
999638697 5:153649341-153649363 AATGCTGCTTTGTTTCTTCTTGG - Intronic
1001156016 5:169273020-169273042 GTCGGTGCTGAGTTTATTCTTGG - Intronic
1005785536 6:29241685-29241707 ATTTCTTCTTAGTTTAGTCTTGG + Intergenic
1006549113 6:34805783-34805805 ATAATTGCTTACTTTATTCCAGG - Intronic
1006732833 6:36249046-36249068 AGTGCTGCTTAGTTTTTGCTAGG + Intronic
1006930957 6:37688213-37688235 AGAGCTGTTTAGATGATTCTTGG - Intronic
1009896927 6:69763387-69763409 ATGGCTGATTAGGTTCTTCTTGG - Intronic
1010845090 6:80696781-80696803 ATTTCTGCTTAGTTTCTGCTTGG - Intergenic
1012334862 6:98042929-98042951 ATAAATACTTAGTTTATTTTTGG - Intergenic
1012472372 6:99586880-99586902 ATACCTGCTTTGTTCCTTCTTGG - Intergenic
1012957488 6:105587059-105587081 TTTGCTGCTTAGTTTAATCCTGG - Intergenic
1015520273 6:134123205-134123227 ATTGCTACTTAATTTATTCTTGG + Intergenic
1016337860 6:143027207-143027229 ATAGCTCCTAAGTTTAATTTGGG + Intergenic
1017053206 6:150413673-150413695 ATACCTCATTAGTTTCTTCTTGG + Intergenic
1018881026 6:167880925-167880947 AAAATTGCTTTGTTTATTCTAGG + Intronic
1020995716 7:15261437-15261459 ATATCTTCCTGGTTTATTCTAGG - Intronic
1021174385 7:17434310-17434332 ATAGCTGCACAGTTTTGTCTTGG + Intergenic
1021316086 7:19149003-19149025 ATTACTGCTTAAGTTATTCTTGG - Intergenic
1023007104 7:35883364-35883386 ATAGCTGCTTAGGTATTTCTGGG + Intronic
1023778081 7:43629266-43629288 CAAACTGCTTTGTTTATTCTAGG + Intronic
1024362684 7:48485242-48485264 ATAGCTGCTTAGTTACTTTTTGG + Intronic
1026149746 7:67777805-67777827 AAAGCTGCTTAGTTGCTCCTGGG + Intergenic
1028094382 7:86742183-86742205 ATGGTTGCTTAGTTTCTTCAAGG + Intronic
1031927041 7:127648864-127648886 ACAGCTTCTCAGTTTATCCTAGG - Intergenic
1033300982 7:140185366-140185388 ATGGCTCCTTAGGTTCTTCTTGG - Intergenic
1034327003 7:150245613-150245635 ATAGCTGCTTGTTTCCTTCTTGG - Intronic
1034766206 7:153723838-153723860 ATAGCTGCTTGTTTCCTTCTTGG + Intergenic
1034864030 7:154625266-154625288 ATAGCTGCTTAGTTTATTCTTGG - Intronic
1035511382 8:187788-187810 ATAGCTTCTGAGTTGATTGTAGG - Intergenic
1036796519 8:11760091-11760113 ACAGCTGCTTACTTTATTTTTGG + Intergenic
1036909188 8:12739188-12739210 ATAGCAGCTTAGTTTATATCAGG + Intronic
1038574704 8:28695036-28695058 ATAACTACTTAGTTTCTTCCAGG + Intronic
1040958484 8:53005139-53005161 ATCCCTGATCAGTTTATTCTGGG - Intergenic
1041793681 8:61723701-61723723 ATGCCTGCCTAGTTTATACTGGG - Intergenic
1042160846 8:65893374-65893396 ATATCTTCTTGGTTTAATCTAGG - Intergenic
1042274317 8:66987086-66987108 ATAGCTTGTTAGTATATTTTTGG + Intronic
1042344624 8:67714920-67714942 TTAGTTGCTTGGTTTAGTCTGGG - Intronic
1042363086 8:67904646-67904668 ATAGCATATGAGTTTATTCTTGG + Intergenic
1042433649 8:68738720-68738742 ATTTCTTCTTGGTTTATTCTTGG - Intronic
1043168209 8:76931375-76931397 ATATGTGCTTAGTTTATTGCAGG - Intergenic
1043181946 8:77096137-77096159 ATAGCTGCTTTTTTTTTTTTTGG + Intergenic
1046093384 8:109529620-109529642 ATAGCTCCTGAGTTTTTTCCAGG + Intronic
1048393637 8:133991720-133991742 ATAGCTGCTTTTTTTCTTTTAGG - Intergenic
1050876155 9:10639467-10639489 AAAGCTGCTTATTATGTTCTCGG - Intergenic
1052674448 9:31601683-31601705 ATAAGTGGTTATTTTATTCTGGG - Intergenic
1057748137 9:97768590-97768612 ATAGCTGCTTATTATTTTTTTGG + Intergenic
1058276678 9:103050240-103050262 ATAGCTGATTATTTCATTGTTGG - Intergenic
1058410881 9:104730040-104730062 ATAAATGCTTATTTTGTTCTGGG - Intergenic
1058812337 9:108652976-108652998 ATACCTGGTTAGTTTAATATGGG - Intergenic
1061468390 9:130801882-130801904 CAAGCTGCTTTGTTTCTTCTTGG + Intronic
1062756539 9:138298831-138298853 ATAGCTTCTGAGTTGATTGTAGG + Intergenic
1186393038 X:9180395-9180417 TCAGCTGATTAGTTTATCCTAGG + Intergenic
1186943481 X:14538946-14538968 ATTGCTCCTTGGTTGATTCTGGG + Intronic
1191804885 X:65124691-65124713 ATACCTTCTTAGTTTAATCTAGG + Intergenic
1192381146 X:70617967-70617989 AGAGCTGCTTAATTTATGCATGG + Intronic
1192866987 X:75144609-75144631 ATAGCTGCTTTTTTTTTTTTTGG + Intronic
1193242758 X:79191633-79191655 ATTTCTTCATAGTTTATTCTTGG + Intergenic
1193265165 X:79459852-79459874 ATAACTGGTCATTTTATTCTAGG - Intergenic
1197346873 X:125334669-125334691 ATAACTGCTTATTTTATTTCAGG - Intergenic
1197552546 X:127910844-127910866 ATGTCTTCTTAATTTATTCTTGG - Intergenic
1197634089 X:128894918-128894940 ATAGCTGCTTTTTTTCTTTTGGG + Intergenic
1197982780 X:132235633-132235655 ATACCTCCTTAGGTTGTTCTTGG + Intergenic
1198796858 X:140406513-140406535 ATATCTTCTTGGTTTAATCTAGG + Intergenic
1200015253 X:153157006-153157028 TTAGCAGTTTAATTTATTCTGGG - Intergenic
1200971201 Y:9154271-9154293 ATAGCTTCTTAATTTTTTTTTGG + Intergenic