ID: 1034865269

View in Genome Browser
Species Human (GRCh38)
Location 7:154636350-154636372
Sequence CTGGCTCCTGTGTCCTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034865269_1034865273 4 Left 1034865269 7:154636350-154636372 CCTGCTCAGGACACAGGAGCCAG 0: 1
1: 0
2: 2
3: 39
4: 340
Right 1034865273 7:154636377-154636399 AGGCCCTTCCTTCCTTCTCCTGG 0: 1
1: 0
2: 6
3: 42
4: 451
1034865269_1034865280 27 Left 1034865269 7:154636350-154636372 CCTGCTCAGGACACAGGAGCCAG 0: 1
1: 0
2: 2
3: 39
4: 340
Right 1034865280 7:154636400-154636422 GCAAGCAGCACCACTCATCCCGG 0: 1
1: 0
2: 1
3: 10
4: 132
1034865269_1034865274 5 Left 1034865269 7:154636350-154636372 CCTGCTCAGGACACAGGAGCCAG 0: 1
1: 0
2: 2
3: 39
4: 340
Right 1034865274 7:154636378-154636400 GGCCCTTCCTTCCTTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034865269 Original CRISPR CTGGCTCCTGTGTCCTGAGC AGG (reversed) Intronic
900018741 1:172143-172165 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
900048999 1:530738-530760 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
900071230 1:772562-772584 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
900195164 1:1372199-1372221 CGGGCTCCTGGGTCCAGGGCTGG - Intergenic
900422986 1:2563618-2563640 CTGACTCTTGTGGCCTCAGCAGG + Exonic
900492968 1:2961867-2961889 CTGGCCTCTGTCTCCTGAGCCGG + Intergenic
900824277 1:4913631-4913653 CTGAATGCAGTGTCCTGAGCAGG - Intergenic
901023514 1:6267170-6267192 CTGGCTCCTGTGGGCTGGGTGGG - Intronic
901248087 1:7749427-7749449 CTGGCTTCTGTTTGGTGAGCAGG + Intronic
901463194 1:9404048-9404070 CAGACTCCTGTGGGCTGAGCAGG + Intergenic
901515162 1:9740393-9740415 CTGGCTCCTGATTCATCAGCTGG + Intronic
901553606 1:10014496-10014518 CTGTCTCAAGTGTCCTGAGTAGG + Intronic
901955156 1:12778730-12778752 CCAGCCCCTGTGTCCTCAGCAGG - Intergenic
902611141 1:17597755-17597777 CTGGCTCTGGTGTACTGGGCTGG - Intronic
902877581 1:19350052-19350074 CTGGCCCGTGTGTCCCCAGCAGG + Intronic
903070106 1:20722851-20722873 CTTCCTGCTGTGGCCTGAGCTGG - Exonic
903218542 1:21856019-21856041 CTGGCTCCTGTGTGCACAGATGG - Intronic
903381558 1:22900563-22900585 CTGGCTCCATTCTGCTGAGCTGG + Intronic
903445366 1:23419164-23419186 CTGGGGCCTGGGTCCTGACCAGG + Intronic
903776716 1:25798695-25798717 CTGGCCCCAGTGTCCTTAGAGGG - Intergenic
903897966 1:26621074-26621096 CGGGCTCCTGTCTCCTCGGCCGG - Intergenic
904253161 1:29238524-29238546 CTGGCTCCGGTGTCTCGGGCCGG + Intronic
904392636 1:30196023-30196045 CTGGCACCCGGGTCCTGAGTGGG - Intergenic
904497834 1:30897187-30897209 CTGTCTCCTGACTCCTGGGCAGG - Intronic
904919465 1:33995595-33995617 CTGTCTCCTGAGAGCTGAGCAGG - Intronic
905653398 1:39671427-39671449 CTGGGTCCTGGGCCCTGGGCTGG - Intronic
905773480 1:40653444-40653466 CTCCCTCCTGCATCCTGAGCTGG - Intronic
905946254 1:41903857-41903879 CTGGCTCCAGTGTGCTGGGCAGG - Intronic
906144825 1:43553749-43553771 CAGGCTCCTGTGTCCTGAGTAGG + Intronic
907130184 1:52090502-52090524 CTGGCTCCTGTGTAATGGGCTGG - Exonic
910984580 1:92993086-92993108 CTGGATCATGTGACCTGAGTAGG + Intergenic
912343743 1:108944346-108944368 CTGGCTCCTGCCTACTCAGCAGG + Intronic
914876845 1:151518643-151518665 CTGGCTCTTGCATCCTTAGCTGG - Exonic
915228383 1:154428065-154428087 CTGGCCTCTGTTTCCTTAGCTGG + Intronic
915732950 1:158067069-158067091 CTGGCGCAGGTGCCCTGAGCTGG + Intronic
915826653 1:159085263-159085285 CTGACTCCTGTCTTCTGAGTTGG + Intronic
917067304 1:171110817-171110839 GTGGCTCCTGGGTGATGAGCCGG + Exonic
917905050 1:179580262-179580284 CTGGCTCCAGCATCCTGTGCTGG + Intergenic
920260349 1:204684619-204684641 CTGTCTCCTGGGTCCTGCGGTGG + Intronic
920701662 1:208222537-208222559 CTGCCTCCTGAATCCTGATCGGG - Intronic
920870296 1:209788644-209788666 CTGTGTTCTGTGTCCTGAACAGG - Exonic
922106590 1:222518011-222518033 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
922339003 1:224640693-224640715 CTGGCTGCTGTGTTGTGAACTGG + Intronic
922769925 1:228176186-228176208 CTGGCTCCTGAGCCCTGCGCTGG - Exonic
922996293 1:229964383-229964405 CTGCCACCTCTGTCCAGAGCAGG - Intergenic
923091647 1:230745582-230745604 CTGGTTCCTGTGTCCTCACATGG + Intergenic
923199159 1:231694742-231694764 CTGGCTCCCATTTCCTGAGCAGG - Exonic
923478346 1:234358561-234358583 CTGGTTCCTGTGTCCTCAGAAGG - Intergenic
923608964 1:235472376-235472398 CTGGCTCCTTAGTCCTGCTCAGG + Intronic
924348775 1:243095577-243095599 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
924432682 1:244010145-244010167 ATGGTGCCTGGGTCCTGAGCAGG - Intergenic
1062952699 10:1516548-1516570 CGGGCTGCTGTGTGCTGTGCGGG + Intronic
1067773557 10:49144866-49144888 CTGGGGCAGGTGTCCTGAGCTGG - Intergenic
1068526294 10:58134093-58134115 CTGGCTCCTCTCTCCTCTGCAGG - Intergenic
1069682284 10:70293835-70293857 TTCGCTCCTGTTTCCTGGGCTGG + Intergenic
1070413631 10:76168424-76168446 ATGGCTTCTGTTTCCAGAGCTGG + Intronic
1070610453 10:77928619-77928641 CCGGCACCTGTGTTCTTAGCTGG + Intergenic
1070948955 10:80415486-80415508 CTGCCTCCTGTGTCCTACACCGG + Intronic
1071261174 10:83920468-83920490 TTGGCTCCTTTGTCCTGTGGGGG + Intergenic
1072686563 10:97540924-97540946 CTGGGCCTTGTGTCCTGGGCTGG + Intronic
1073075264 10:100821318-100821340 CTGGCTCAGGGGTCCTGAACAGG + Intronic
1073758162 10:106603302-106603324 AAGGCTCTTGTGCCCTGAGCTGG - Intronic
1073882974 10:108005409-108005431 CTGGCTCCTCTGTCTGGACCAGG - Intergenic
1074276560 10:112007918-112007940 CTGGCCCCAATGTCCTGAGTTGG + Intergenic
1076721729 10:132396186-132396208 CGGGCCCCTGCGTTCTGAGCCGG + Intergenic
1076833518 10:133008594-133008616 CAGGCTGCTGTGTCCAGACCAGG - Intergenic
1076839702 10:133039993-133040015 CCGGCTTCTGTGTCCTCAGCGGG + Intergenic
1076975343 11:167339-167361 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
1076990129 11:268361-268383 AGGCCTCCTGTGTCCTGAGTGGG + Intergenic
1077013970 11:391939-391961 AGGGCTCCTGTGTCAGGAGCTGG + Intergenic
1078043478 11:7891144-7891166 CTGCCTCTTGTTTCCTGAGGTGG + Intergenic
1079699718 11:23529669-23529691 CTGCCTTCTGTGTCCTCAGTTGG + Intergenic
1080034846 11:27700339-27700361 CTGGCTCCTCTGTCCGGCCCGGG + Intronic
1083150222 11:60787184-60787206 CTGGGTCCGTGGTCCTGAGCTGG + Intronic
1083156394 11:60825925-60825947 CGGGCTCCGGTCTCCTTAGCAGG + Intergenic
1083331873 11:61902523-61902545 CTAGCACATGTGCCCTGAGCGGG - Exonic
1083934211 11:65861989-65862011 CGGGCTCCTGAGTGCCGAGCTGG - Exonic
1083935912 11:65870081-65870103 CAGGCTCCTGGGTCCTGGGCAGG - Intronic
1085717447 11:78885426-78885448 TTGGCTGCTCTGGCCTGAGCTGG - Intronic
1087568111 11:99889270-99889292 CTGGTTCCTTTCTCCAGAGCAGG + Intronic
1087843855 11:102949130-102949152 CTGGCGCCTGCATCCTCAGCAGG - Exonic
1089192212 11:116661238-116661260 CTGGCTGCTGTGTGCAGAGTGGG - Intergenic
1089198128 11:116707256-116707278 CTGGCTCCAGGGCCTTGAGCCGG + Intergenic
1089365151 11:117917040-117917062 CCGGCTACTGTGTCCAGAGAGGG - Intronic
1089966055 11:122655857-122655879 CTGGCTCCTGTGGCCTCACCAGG + Exonic
1090387536 11:126365508-126365530 CTGGCTTCTGTGTGCAGAGGTGG + Intronic
1090390103 11:126382706-126382728 CTGGCTTCTGTGTGCAGAGGTGG + Intronic
1091206437 11:133824464-133824486 CTGGCTCCTGTGCCCGGGGGGGG - Intergenic
1092242797 12:6845816-6845838 CTGGCTGCTGCTTCCTCAGCTGG + Intronic
1092564199 12:9647942-9647964 CTGGCGCTTGTGACCCGAGCAGG - Intergenic
1095171437 12:39040711-39040733 CTGGCTCTTGGGTGCTGAGCTGG - Intergenic
1095197118 12:39333001-39333023 CTGGAACCTGTGTCCTGAGCAGG + Exonic
1096576552 12:52556437-52556459 CTGGGTCCTGGGTCCTGGGGAGG + Intergenic
1097280878 12:57845175-57845197 CTGGCTCCTGGGGCCGAAGCCGG - Intronic
1097942922 12:65331999-65332021 CTGTCTCCTGTGCCCTCAGCTGG + Intronic
1098348036 12:69526320-69526342 CTGGGTAATGTGTCCTGAGAAGG + Intronic
1101493841 12:105235772-105235794 CCGGGCCCTGAGTCCTGAGCCGG - Intronic
1102245948 12:111355824-111355846 CTGGCCCCTGTGTCAGGAGCAGG + Intergenic
1102388780 12:112533261-112533283 CTTCCTCCTGTGTCCAGTGCAGG - Intergenic
1102611711 12:114118009-114118031 CTGGCTTCTGAGCCCAGAGCAGG - Intergenic
1102621252 12:114196609-114196631 CTGGCTCCTGTGGGCTGTGTGGG - Intergenic
1103690843 12:122773448-122773470 CTGGCTCTTGTTGCCTGAGCTGG - Intergenic
1103943111 12:124511567-124511589 CTGGGTCCTGTCCCCTTAGCAGG + Intronic
1104672306 12:130689150-130689172 GGGGCTCCCGTGTCCTGGGCCGG + Intronic
1105847708 13:24307941-24307963 CAGGATCCTGATTCCTGAGCCGG + Intronic
1108747489 13:53409789-53409811 CTGGCTCCTCTGGCCTGGTCAGG + Intergenic
1112736819 13:102430346-102430368 TGTGCGCCTGTGTCCTGAGCTGG - Intergenic
1113579657 13:111420128-111420150 CTGGCACCTGTGTGCTGCTCTGG - Intergenic
1113945838 13:114043668-114043690 CTGGGGCCTGTTTCCTGTGCCGG - Intronic
1114080332 14:19198068-19198090 CTGGCTCCTGGGTTGTCAGCAGG + Intergenic
1114484352 14:23054254-23054276 CTGGGTCCTGGGCCCGGAGCCGG + Exonic
1119029457 14:71180397-71180419 CTGCCTCCTTTGCCATGAGCAGG - Intergenic
1119294569 14:73522561-73522583 CTGGCTTCTGCCTCCTGAGAAGG - Exonic
1119351531 14:73969672-73969694 CTCGCTCTTGTTTCCTGGGCTGG - Intronic
1119377188 14:74204219-74204241 CTGGCCCCTGTCACTTGAGCTGG + Intergenic
1119420454 14:74505065-74505087 CCTGCTCCAGTGTCCTGGGCCGG - Exonic
1119650847 14:76381740-76381762 CTGGCTCCTGGACTCTGAGCAGG + Intronic
1119726932 14:76927059-76927081 CTGGCTCCTGTGACCTGGCCAGG + Intergenic
1120215727 14:81679370-81679392 CTGGCTCATGGGTGCTGTGCTGG - Intergenic
1121525447 14:94616162-94616184 CTGGCTACTGTGTCCTGGAGGGG - Intronic
1124089181 15:26581653-26581675 AGGGCTCCTGGGTCCTGTGCAGG + Intronic
1125608985 15:40958284-40958306 CTGGCTCGTGTCTCCTGTCCGGG - Intergenic
1127643968 15:60941555-60941577 CTGGCTGCTGTGTCCAGACAGGG - Intronic
1128611414 15:69076594-69076616 CTGATTCCTGATTCCTGAGCAGG + Intergenic
1128677951 15:69625499-69625521 CTGTCTCCTGGGTCCTTAGGAGG + Intergenic
1128796577 15:70470726-70470748 CTGGCATCTGTGTCCTGGCCAGG - Intergenic
1129268854 15:74409152-74409174 CTGGCTCCTGGGCCCTAACCAGG + Intergenic
1130682450 15:86008523-86008545 CTGGCCCCCATGTCCTGAGCAGG - Intergenic
1131249861 15:90823180-90823202 CAGGATCCAGTGGCCTGAGCGGG + Intergenic
1132324935 15:100961137-100961159 CTGGCTGCAGAGTCCTGAGGTGG + Intronic
1132333364 15:101027544-101027566 CCGGCCCCTGTGGCCTGAGGGGG - Intronic
1132523344 16:401579-401601 CTGGCTCCTGGGTCCAGGCCAGG - Intronic
1132534742 16:472522-472544 GTGGCTCCTGTGCCCTGAGAAGG + Intronic
1132684264 16:1155722-1155744 CTGGCCCCGGTGTTCTGGGCTGG + Intronic
1132944651 16:2526261-2526283 CTGGCTCCTTTCTCTTGGGCTGG + Intronic
1132997102 16:2829108-2829130 CTGGCTCCAGGGTCCTGTGTTGG + Intergenic
1133708003 16:8373852-8373874 CAGGCTCCTGAGTCCTTTGCTGG + Intergenic
1137671729 16:50283287-50283309 CTGGCTCCTGTGACCCCAGGAGG + Intronic
1138151079 16:54657688-54657710 CTGGACTCTGTTTCCTGAGCCGG - Intergenic
1139481676 16:67234185-67234207 CTGCCCCCTGTGTCCTGCTCCGG - Exonic
1139532714 16:67550723-67550745 CAGGCTCCTGTGACAAGAGCAGG - Intergenic
1139949564 16:70662522-70662544 CTGTCTGCTGTGGTCTGAGCTGG - Exonic
1142119102 16:88377204-88377226 CCGGCTCCTGCCTTCTGAGCAGG - Intergenic
1142344333 16:89544556-89544578 CTCCCTCCTGTGTCCTGAAGGGG + Intronic
1142444917 16:90130320-90130342 CTGGCACCTTTGCCCAGAGCAGG - Intergenic
1142462594 17:105146-105168 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
1143341353 17:6213861-6213883 CTGGCACTTGTGTTATGAGCTGG - Intergenic
1143398610 17:6624796-6624818 CTTGCTCCTGTCTCCTGATACGG + Exonic
1144199585 17:12928072-12928094 CTGGCTGCTGTGTTATCAGCAGG - Intronic
1144808482 17:17983463-17983485 CTGTGTCCTGTGTCCTAAGGTGG + Intronic
1146631340 17:34472097-34472119 CTGTCTCCTCTTTCCTCAGCTGG + Intergenic
1147632406 17:41940509-41940531 CTGCCTCCACTGTGCTGAGCAGG + Intronic
1147675077 17:42199765-42199787 CTGGCTGCTCTGTCCTCAGCAGG + Exonic
1147891868 17:43723071-43723093 CTGGGGCCTGTGCCCTGGGCAGG - Intergenic
1148812880 17:50305664-50305686 CTTGCTCCTGTCTCCCAAGCTGG + Intergenic
1149355590 17:55835898-55835920 CTGGGTCATGTGTCCTGCCCTGG + Intronic
1149867990 17:60161294-60161316 CTGGCACCTGGGGCCTGACCTGG - Intronic
1150132613 17:62677431-62677453 CTGGCTCCTGTCCCCAGGGCTGG + Exonic
1150639444 17:66939614-66939636 AGGGCTCCTGGGTCCTGCGCAGG - Intergenic
1151686029 17:75647156-75647178 CTGGCTCCTGTATCTAGAGCGGG + Intronic
1152050982 17:77976897-77976919 CTTGCTCTTGTCGCCTGAGCTGG - Intergenic
1152242899 17:79169478-79169500 CTGGGTCCTGGGTCCTGGGTGGG - Intronic
1152269799 17:79317517-79317539 CTGGCAATTGAGTCCTGAGCAGG + Intronic
1152825916 17:82464670-82464692 CAGGCTCCTGTGGCTTAAGCGGG + Intronic
1153635401 18:7108923-7108945 CTTGCTGCTGTGTCCTGTGATGG - Intronic
1157475762 18:48022487-48022509 CTGGCTCCGCTGGCCTGAGAAGG - Intergenic
1157606084 18:48926730-48926752 GTGGCGCCTGGGTCCTGAGGAGG - Intronic
1158017470 18:52801088-52801110 CTGTCTCTTGAGTCCTGGGCTGG + Intronic
1158395914 18:57078258-57078280 CTGGTTCCTCTGTCCTCACCAGG + Intergenic
1158565287 18:58549849-58549871 CTAGTTCCTGTGTCCTGAAAGGG + Intronic
1160102865 18:75939332-75939354 CTGGCTGCTGTGTAGTGAGCAGG - Intergenic
1160652300 19:237522-237544 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
1160745772 19:710073-710095 CTGGCTCCCCTGTCCTGAAGTGG - Intronic
1160997144 19:1888049-1888071 CAGGCAGCTGAGTCCTGAGCAGG - Intergenic
1161155753 19:2731303-2731325 CTGGCACCTGGGAGCTGAGCTGG + Intronic
1161471090 19:4457196-4457218 CGGGATCATGAGTCCTGAGCCGG - Intronic
1161837853 19:6660001-6660023 CGGGCCCCTGCGTTCTGAGCCGG + Intergenic
1161950513 19:7465144-7465166 CTTGCCCCTGTGGCCAGAGCTGG + Intronic
1162100142 19:8334346-8334368 CAGGCTCTTGGGTCCGGAGCTGG + Exonic
1162146312 19:8614113-8614135 CTGACTTCTGTGTCTTGAGTGGG + Intergenic
1163023826 19:14497816-14497838 CTGGCTCCTGTTTCCTGATGAGG + Intergenic
1163510827 19:17734038-17734060 CCGTCTCCTGTGTGCTGAGAAGG + Intronic
1164553720 19:29233792-29233814 CTGCCTTCTCTGTGCTGAGCAGG - Intergenic
1166270333 19:41709599-41709621 TGGGGTCCTGGGTCCTGAGCAGG - Intronic
1166276281 19:41756519-41756541 CAGGGCCCTGGGTCCTGAGCAGG - Intronic
1166441345 19:42818090-42818112 CTGCTTCCTGTGTCCTCCGCTGG + Intronic
1167238741 19:48330689-48330711 CCGGCTCCTGTGTCCTCGGGAGG - Intergenic
1167358700 19:49018777-49018799 CTGGCTCCCATTCCCTGAGCCGG - Intergenic
1167420393 19:49399305-49399327 CTGTCTCCTTTGTCATGAGAAGG - Intronic
1167480607 19:49728432-49728454 CTGTCTCCTGTGTTATCAGCAGG - Intergenic
1167939477 19:52934902-52934924 CTTCCTCCTGTGTCCTGACATGG - Intronic
1167982858 19:53290489-53290511 ATGTCTCCTGTGTTCTGACCAGG + Exonic
925064145 2:916069-916091 CGGGATCCTGTGTCCTGTGCTGG - Intergenic
925578201 2:5381999-5382021 GTGGCTCCTGTGTGGTGGGCAGG - Intergenic
926018603 2:9475043-9475065 CTGGCGCCTCTGCCCGGAGCTGG - Intronic
928308604 2:30191747-30191769 CTGGCTCTTCTATCCTCAGCAGG - Intergenic
931666885 2:64616042-64616064 CTGGCTCCTTAGTGCAGAGCAGG + Intergenic
932606979 2:73172098-73172120 CTGTCTCCTGGGTCCTGGGCCGG - Intergenic
932892215 2:75607071-75607093 CAGGCTCCTGTTTGCAGAGCTGG - Intergenic
933472130 2:82739543-82739565 ATGGCACCAGTGTCCTGGGCTGG - Intergenic
933474379 2:82770742-82770764 CTGGGTGCTGAGACCTGAGCTGG - Intergenic
933684335 2:85131704-85131726 AAGGGTCCTGTGTCCTGAGGGGG + Intergenic
933776922 2:85776713-85776735 ATGGCTCCTGGGCCCTGTGCAGG - Intronic
933925449 2:87088313-87088335 CTGTCTACTGGGTCCTGGGCCGG + Intergenic
934695868 2:96399802-96399824 CTGGCTCCTCAGCCTTGAGCAGG - Intergenic
936042113 2:109158049-109158071 CTGGCTCCTGAGCCTGGAGCTGG + Intronic
936258003 2:110934018-110934040 CTGCCTCCTGTGTCCTCACCAGG - Intronic
936271668 2:111053920-111053942 CTAGCTCTTGTCTCCTGACCTGG - Intronic
936399970 2:112157444-112157466 GTGTCTCCTGTCTCCTGTGCAGG + Intronic
936958196 2:118044628-118044650 CTGGCTTCTGTGTCCTCCTCTGG + Intergenic
937203050 2:120218132-120218154 CTGGCTCCTTTGTCTCGAGGAGG - Intergenic
938169219 2:129059885-129059907 CTGCCTCCAGTCTCCTGTGCTGG + Intergenic
938603124 2:132863632-132863654 CCTGCTGCTGTGTGCTGAGCTGG - Intronic
938729091 2:134131947-134131969 CTGTGTGCTGTCTCCTGAGCAGG + Intronic
939984372 2:148815413-148815435 TCAGCTCCTGTTTCCTGAGCAGG + Intergenic
941922327 2:170863706-170863728 CTGCCTCCTGTGCAATGAGCTGG - Intergenic
945262776 2:207860118-207860140 CAGCCTCCAGTTTCCTGAGCAGG - Intronic
946091230 2:217225752-217225774 CTGGCCCCATTGTCCTTAGCAGG + Intergenic
947714652 2:232333508-232333530 CTGGCTCCCTGGTCCTCAGCAGG + Intronic
947746651 2:232511460-232511482 CTTGCTACTGTGACCTGGGCCGG - Intergenic
947839472 2:233198353-233198375 TTGACTCCTGTGTCCTGGGAGGG - Exonic
948224607 2:236299166-236299188 CTGGCACCTGGAACCTGAGCAGG + Intergenic
948831117 2:240598698-240598720 CGGGCTCCAGTCACCTGAGCTGG - Exonic
948907553 2:240986962-240986984 CTGGCCCCTGTTCCCTGGGCAGG - Intronic
949009448 2:241670252-241670274 CTGTCTCCTGGCTCCTCAGCAGG + Intronic
1168836539 20:881451-881473 CTGGAACCTGTGTAATGAGCAGG + Intronic
1168842790 20:920589-920611 CTGGATCCTGTGTCCAGGCCTGG + Intergenic
1169088259 20:2840550-2840572 CTGGCTCCTGCGCCCTGTGGCGG - Exonic
1171348080 20:24481305-24481327 ATGGCTCCTGGGGCCTCAGCTGG + Intronic
1171454268 20:25258594-25258616 GTGCCTCCTGGGCCCTGAGCGGG - Intronic
1172023607 20:31933347-31933369 CAGCCTACTGTGTCCTGAGATGG + Intronic
1172065986 20:32220892-32220914 ATGGCACCTGTGTTCTGAGAGGG + Intronic
1173014065 20:39209072-39209094 CTAGCTCCTGTGTCCAAAGCTGG + Intergenic
1175593544 20:60212834-60212856 CAGGCTCCTGTGTCCAGCCCAGG - Intergenic
1175672104 20:60912254-60912276 CTTGCTCCTGTCTCCCAAGCTGG - Intergenic
1176108018 20:63398718-63398740 CTGGCTCCTGGCTCCTGGGTGGG - Intergenic
1179484373 21:41700320-41700342 ATGCCTCCTGTCTGCTGAGCTGG - Intergenic
1179489318 21:41729948-41729970 CTGCCTCCTGTGACCTTAGTGGG - Intergenic
1179549270 21:42133435-42133457 CTGTCTCCTGGGGACTGAGCTGG + Intronic
1180005717 21:45019482-45019504 CTGGCTGCAGGGTCCTGAGGTGG + Intergenic
1180188434 21:46151608-46151630 CTTGCTCCTTTGTGCCGAGCAGG + Exonic
1180500442 22:15924616-15924638 CTGGCTCCTGGGTTGTCAGCAGG - Intergenic
1182070426 22:27459561-27459583 CTGGGTCCTGTGTCAGGTGCTGG - Intergenic
1183963687 22:41428452-41428474 CTGGCTCCTGAGCCCTGTGGAGG - Intergenic
1184751741 22:46490219-46490241 TTGGCTCCTGTCTCATGAGATGG - Intronic
1184836021 22:47021492-47021514 CTGTCACCTGTCACCTGAGCAGG + Intronic
1185080090 22:48704929-48704951 CTGCTTGCTGTGTCCTGAGATGG + Intronic
1185129352 22:49029022-49029044 GTGGCTCATGGCTCCTGAGCTGG + Intergenic
949109911 3:247229-247251 TTGGCTCCTGTACCCTGAGGAGG + Intronic
949536065 3:4997163-4997185 CTGTCTCCTGTGTGGTGAGCCGG + Intergenic
950574356 3:13822876-13822898 ATGGCTCCTGTGTCCTGGATGGG + Intronic
952279386 3:31908532-31908554 CTGGCACCATTGTCCTGGGCTGG - Intronic
953451401 3:43009484-43009506 CTGGCTCCTGTGTGCTGGGAAGG + Intronic
954225640 3:49179109-49179131 CTGGCTGCCGTGGTCTGAGCTGG - Intronic
954626335 3:52023917-52023939 CTCCCTCCTGAGGCCTGAGCTGG - Intergenic
955452646 3:59086503-59086525 CCTGCTACTGTGGCCTGAGCTGG - Intergenic
956653779 3:71529981-71530003 ATGGCACCTGTGTCCAAAGCAGG + Intronic
957236720 3:77602498-77602520 CAGGTTCTTGTGTCCTGAGGAGG + Intronic
960737816 3:120799730-120799752 CTGTCTGCTTTGTCATGAGCGGG - Intergenic
961167001 3:124770305-124770327 CTGGCTCTTGAGTCCTGACCCGG - Intronic
961558991 3:127715959-127715981 GGGGCTCCTCTCTCCTGAGCTGG - Intronic
961793566 3:129393737-129393759 CTGGCTGCTGAGTCTTGGGCTGG + Intergenic
961870224 3:129982110-129982132 CTGGCTCCTGTGTGGAGAGTAGG - Intergenic
962902001 3:139769547-139769569 CTGCCTCCTGTTTTCTGACCTGG - Intergenic
963040718 3:141067730-141067752 CTGGCTCCTGGCCCCTCAGCTGG - Intronic
963047931 3:141116997-141117019 TTAGATGCTGTGTCCTGAGCAGG + Intronic
964307215 3:155354905-155354927 TTGGCTTGTCTGTCCTGAGCTGG - Intergenic
966301001 3:178479921-178479943 CTGCCTCCTTTGTCAGGAGCAGG + Intronic
967726814 3:192869764-192869786 CTTGTTGCTGTGTCCTGTGCAGG - Intronic
968365534 3:198182450-198182472 CTGGCACCTTTGCCCAGAGCAGG - Intergenic
968450931 4:675617-675639 CTGGGCTCTGTTTCCTGAGCTGG + Intronic
968466487 4:754170-754192 ATGGCTCCTATACCCTGAGCAGG + Intronic
968466509 4:754238-754260 ATGGCTCTTGTGTCTGGAGCTGG + Intronic
968897915 4:3415578-3415600 CTGGCTGCTGTTTCCTCAGTTGG + Intronic
969175912 4:5399009-5399031 CTGGATCCTGTGTCCTGTGTTGG + Intronic
969214975 4:5714119-5714141 CTGGGTCCTGAGGGCTGAGCAGG - Intronic
977711926 4:100136097-100136119 CTGGGTCCTGTGAACTCAGCTGG - Intergenic
978360952 4:107931115-107931137 TTAGCACCTGTGCCCTGAGCTGG - Intergenic
979254572 4:118597617-118597639 CTGGCACCTTTGCCCAGAGCAGG - Intergenic
979334393 4:119448414-119448436 CTGGCACCTTTGCCCAGAGCAGG + Intergenic
984364963 4:178786455-178786477 CTGCCTCCTGTCACCTCAGCTGG - Intergenic
985063044 4:186097008-186097030 CTGGCTCATGTGTCATGGTCTGG + Intergenic
985986502 5:3520892-3520914 TGGGGTCCTGTGTCCTCAGCGGG - Intergenic
986361078 5:6978741-6978763 CTGGGTCTTTTGTCTTGAGCTGG + Intergenic
987281509 5:16418673-16418695 CTGGCTTCTGAGTGCTTAGCAGG - Intergenic
989631814 5:43491972-43491994 TTTGCTCCTGTGGCCTGGGCCGG - Intronic
990972570 5:61525111-61525133 CTGCCTCCTGACTCCTGGGCAGG - Intronic
995531225 5:113093791-113093813 GTGGCACCAGAGTCCTGAGCAGG + Intronic
997341732 5:133150426-133150448 CAGGCTCCCATGTCCTGAGCAGG - Intergenic
998037876 5:138932188-138932210 CAGGCTCCTGCTTGCTGAGCCGG + Intronic
1002426074 5:179176681-179176703 CTGGCTCCTGTGTGCAGAAGGGG - Intronic
1002456620 5:179348889-179348911 CTGGTGCCTGTGTGCAGAGCGGG + Intergenic
1002778969 6:352150-352172 CTGGCTGCTGCCTCCTGAGTGGG - Intergenic
1002807288 6:589659-589681 CTGGCTGCTGTGCCAGGAGCCGG - Intronic
1003973582 6:11322391-11322413 CTGGCACCTGAGGACTGAGCTGG + Intronic
1004251446 6:14026287-14026309 AAGGCTCCTTTGACCTGAGCAGG + Intergenic
1005083586 6:21981320-21981342 CTGCCTCCTCCTTCCTGAGCTGG + Intergenic
1006418253 6:33918056-33918078 CTGGCTCCTGTCTGCAGAGAGGG - Intergenic
1006444387 6:34070647-34070669 CTGGGTCCTGGGTCCTGGCCTGG - Intronic
1006985511 6:38173108-38173130 CTGGCTCCTTTGTCCCCATCTGG + Exonic
1007377150 6:41464644-41464666 CTGAATCATGTGTACTGAGCTGG - Intergenic
1008151039 6:47951315-47951337 GTGGCTCCTGTATCCTCAGTGGG + Intronic
1011253961 6:85402495-85402517 CTAGTTCCTCTGTCCTGAGAAGG + Intergenic
1012520571 6:100116348-100116370 CTAACTCCTGTTTTCTGAGCAGG + Intergenic
1013459007 6:110357970-110357992 CTGGCTGCTGTGCCCCGCGCGGG - Exonic
1013491923 6:110655841-110655863 CTGTGTCCAGTTTCCTGAGCTGG - Intronic
1015869709 6:137763703-137763725 ATGACTCCTGTGTCTTGTGCTGG + Intergenic
1016228556 6:141772529-141772551 CTAGCTCCTAAGTGCTGAGCTGG - Intergenic
1018212715 6:161497416-161497438 CTTGCTCCTCTGTCTTGAACTGG + Intronic
1018825445 6:167405114-167405136 CTGGCTCCTCTGTTCTCAACAGG + Intergenic
1018833249 6:167462554-167462576 CTTGCTCCTGTGTGCTGGGAAGG + Intergenic
1018834654 6:167473863-167473885 CTGTCTCCTGTATCCTGGGCAGG + Intergenic
1019155613 6:170037046-170037068 ATGACTCCTGTGGCCAGAGCGGG + Intergenic
1019346369 7:532834-532856 CTGGGTGCTGTGTCCAGATCTGG - Intergenic
1022516088 7:30975812-30975834 CTGGCTCCAGTTTCCTCACCAGG - Exonic
1023463051 7:40421409-40421431 CTGACTCCTGCGTCCTGGACAGG + Intronic
1024022960 7:45387752-45387774 CTGGCCTCTATGTCCCGAGCAGG + Intergenic
1024069663 7:45775283-45775305 CTGGCACCTTTGCCCAGAGCAGG - Intergenic
1024193292 7:47034431-47034453 CTCACTACTGTGTCCTGGGCTGG + Intergenic
1024234859 7:47390344-47390366 CTGGCTGCAGTGTGCAGAGCTGG - Intronic
1024978353 7:55134115-55134137 CTGAGTCCTGACTCCTGAGCAGG - Intronic
1028133125 7:87200316-87200338 CAGGCTCCTGTGTGCTGTGTAGG - Intronic
1029612421 7:101634138-101634160 GTGGCTGCTCTGGCCTGAGCCGG - Intergenic
1030059329 7:105610529-105610551 CTGTCGGCTGTGTCCTGGGCTGG + Exonic
1030923831 7:115426791-115426813 CTGGTTCCTGAGTCATGAGCTGG - Intergenic
1031008590 7:116500241-116500263 CTGCGTCCTGTCTCCTCAGCTGG + Exonic
1032047050 7:128619569-128619591 CTGGCACCTTTGCCCAGAGCAGG - Intergenic
1032530802 7:132618072-132618094 CTGGCCCATGAGACCTGAGCAGG - Intronic
1033067711 7:138172183-138172205 ATGACTCCTGTGTACAGAGCTGG + Intergenic
1034681907 7:152935184-152935206 CGGGTTGCTGTGTCCTGAGTTGG + Intergenic
1034835887 7:154351405-154351427 TTGGCTCCTGGGTTCTGAGCTGG - Intronic
1034865269 7:154636350-154636372 CTGGCTCCTGTGTCCTGAGCAGG - Intronic
1035916576 8:3631097-3631119 CTGATACCTGTGTGCTGAGCAGG - Intronic
1036133212 8:6135464-6135486 CTGGATCCTGATGCCTGAGCAGG - Intergenic
1036550342 8:9810101-9810123 CTGGTGTCTGTGTCCGGAGCAGG - Intergenic
1036661688 8:10713428-10713450 CTGGGTCCTGAGACCGGAGCAGG + Intergenic
1037674205 8:21040294-21040316 CTGGCTTTTGTGTCCTGTGGCGG + Intergenic
1037912671 8:22753267-22753289 CTCCCTCCTGACTCCTGAGCAGG - Intronic
1037976751 8:23219325-23219347 CTGGAACCTGTGACCTGAGGCGG - Intronic
1039582549 8:38678670-38678692 CGGGTTCCTGTATACTGAGCAGG - Intergenic
1040590649 8:48789360-48789382 CTGCCCCCTGGGTCCTTAGCTGG + Intergenic
1041760755 8:61363761-61363783 CTGGAGCCTGTGTTCTGACCAGG + Intronic
1044556311 8:93565948-93565970 CTGTCTTCTGTTTCCTCAGCTGG + Intergenic
1044646784 8:94452078-94452100 CTGTCTCCTGTGTCCTCACATGG + Intronic
1045321871 8:101087872-101087894 CTGTCTCCTTTTTCCTGAGACGG + Intergenic
1046196172 8:110865972-110865994 CTTACTCCTGTGGCCTGAGAAGG - Intergenic
1048174604 8:132140483-132140505 CTGGCTTCTGTGTCCTTTGCTGG - Intronic
1049367262 8:142246417-142246439 CTGGCTCCTGACTCCTCAGATGG - Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049599266 8:143499426-143499448 CTTGCCCCTCTGTCCTGAGTGGG + Intronic
1049760610 8:144330532-144330554 CGGGCTGATGTGTCCTGGGCTGG - Intergenic
1050828921 9:9986948-9986970 CTGGCCCCTATTTCCTGAACAGG + Intronic
1051813777 9:21080443-21080465 CTGTCTCCTCTTTCCTGAGAGGG - Intergenic
1053198934 9:36139653-36139675 CTGGCTCCTGTGCAGTGAGGAGG - Intronic
1053443771 9:38136177-38136199 CTGACTCCAGTGTCCTGTGGAGG - Intergenic
1054160935 9:61671754-61671776 CTGGATCCTGGGTCCTGTGTGGG + Intergenic
1055003047 9:71475066-71475088 TTGCCTCATGTGTCCTGAGCTGG - Intergenic
1056138264 9:83649688-83649710 CTGGGTCCTGATTCCAGAGCCGG - Intergenic
1057144666 9:92749751-92749773 CTGGCTTCTGTGTCTTGGGCGGG - Intronic
1057284550 9:93740565-93740587 CTTGCTCTTGTGTCCCAAGCTGG - Intergenic
1057901335 9:98951162-98951184 CTGGCCACTTTGTCCAGAGCTGG + Intronic
1058900183 9:109435313-109435335 CTGGCCACTGTGCTCTGAGCAGG + Intronic
1059807105 9:117814195-117814217 CTGGCTCCTGTGATATGTGCTGG - Intergenic
1060776122 9:126376301-126376323 CTGGGTTCTCTGTCCTGAGCCGG + Intronic
1061078757 9:128357498-128357520 CTGGCTGCTGTGTACGGAGTGGG + Intronic
1061184258 9:129042797-129042819 GTGGCTCCTGGGTCCAGAGAGGG + Intronic
1061517329 9:131097218-131097240 CCGGAGCCTGTGTTCTGAGCTGG - Intronic
1061766134 9:132882582-132882604 CTTTCTGCTGTGTCCAGAGCAGG - Intronic
1062093236 9:134689562-134689584 CTGGCAACTGTCTCCTGAGCAGG - Intronic
1062451793 9:136618851-136618873 CGTGCTCCTGCGTCCAGAGCCGG - Intergenic
1062568333 9:137173062-137173084 GTGTCCCATGTGTCCTGAGCTGG - Intergenic
1062717231 9:138017325-138017347 CGGGCTTCTGTGGCCTGAGCGGG + Intronic
1062749902 9:138245317-138245339 CTGGCACCTTTGCCCAGAGCAGG - Intergenic
1186468574 X:9803757-9803779 CTGACTTCTGTGTCCGGAGGTGG - Intronic
1187261860 X:17692326-17692348 CCGGCTCCGGTGTTCTGAGAAGG - Exonic
1188085701 X:25898881-25898903 ATGGCATCTGTGTCCAGAGCAGG - Intergenic
1189242097 X:39533169-39533191 ATGGCTCCTATCTCCTGAGCAGG - Intergenic
1195311261 X:103633880-103633902 CTGGCTCCCAAGTCGTGAGCTGG - Intergenic
1195314707 X:103666191-103666213 CTGGCTCCCAAGTCATGAGCTGG - Intergenic
1200044777 X:153395729-153395751 CTGGGACCTGTGTCCTGTGGTGG - Intergenic
1200162210 X:154015366-154015388 CCGGCTCCTGGGTTCTCAGCGGG + Intronic
1201014847 Y:9590417-9590439 CTGACTCCTGACCCCTGAGCAGG + Intergenic