ID: 1034870214

View in Genome Browser
Species Human (GRCh38)
Location 7:154676781-154676803
Sequence CCTTTTAAGCATTTTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034870205_1034870214 28 Left 1034870205 7:154676730-154676752 CCCAGTGGACATGTGTCCTAAAG 0: 1
1: 0
2: 3
3: 10
4: 131
Right 1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG No data
1034870209_1034870214 -1 Left 1034870209 7:154676759-154676781 CCCAGAACAAAGAAAACGAGTCC 0: 2
1: 3
2: 4
3: 13
4: 199
Right 1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG No data
1034870210_1034870214 -2 Left 1034870210 7:154676760-154676782 CCAGAACAAAGAAAACGAGTCCC 0: 2
1: 3
2: 3
3: 8
4: 104
Right 1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG No data
1034870206_1034870214 27 Left 1034870206 7:154676731-154676753 CCAGTGGACATGTGTCCTAAAGG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG No data
1034870208_1034870214 12 Left 1034870208 7:154676746-154676768 CCTAAAGGCTGAGCCCAGAACAA 0: 1
1: 6
2: 30
3: 102
4: 308
Right 1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034870214 Original CRISPR CCTTTTAAGCATTTTGAGGC AGG Intronic
No off target data available for this crispr