ID: 1034874708

View in Genome Browser
Species Human (GRCh38)
Location 7:154714973-154714995
Sequence AAAGTGTGAGGGCCTCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034874708_1034874714 3 Left 1034874708 7:154714973-154714995 CCAAGCAGAGGCCCTCACACTTT 0: 1
1: 0
2: 2
3: 28
4: 229
Right 1034874714 7:154714999-154715021 CTGGTAGGCTCAGAAGAAGAAGG 0: 1
1: 0
2: 5
3: 85
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034874708 Original CRISPR AAAGTGTGAGGGCCTCTGCT TGG (reversed) Intronic
901118943 1:6874508-6874530 AAGGTGTGAGTCCCCCTGCTGGG - Intronic
902741429 1:18441220-18441242 AGAGTCTGAGGGGCTGTGCTAGG - Intergenic
903025941 1:20430090-20430112 AATGTGCTAGGGGCTCTGCTAGG - Intergenic
904054874 1:27663369-27663391 AAATTGTGAGAGCCCCTGCCGGG + Intergenic
906244686 1:44264648-44264670 AAAGTGTGAAGGCCACTTCAAGG + Intronic
907501490 1:54884851-54884873 AAACTGTTGGGGCCTCTGCAGGG + Intronic
908029342 1:59983303-59983325 AAAGTGTCAGGGCCTCAAGTAGG - Intergenic
908107409 1:60859407-60859429 AAAGTGTGAAGGTCTCTGGTGGG - Intergenic
908611713 1:65868577-65868599 TATGTGAGAGGGACTCTGCTAGG + Intronic
911775094 1:101799339-101799361 AAAGAGTGACTGCCTTTGCTAGG - Intergenic
912318514 1:108688723-108688745 CAAGTGTGAGCCCCTGTGCTGGG - Intergenic
913113264 1:115674794-115674816 AAAGTGTGAGGGCATCAGCCTGG + Intronic
915041623 1:152972426-152972448 AAAGTGTCTGGGCTTCTTCTGGG + Exonic
915491428 1:156252015-156252037 AGAGTGTGAGGGCCTCATCCAGG - Intronic
915655174 1:157353339-157353361 AAAGTGTAAAGCCATCTGCTTGG - Intergenic
916099389 1:161381140-161381162 AAAGTGTGAGGGACTCTTAGTGG + Intergenic
920530622 1:206699453-206699475 GAAGTGTGAGGGACTCCACTGGG + Intronic
920694592 1:208172549-208172571 TAAGTGTCAGGGCATGTGCTCGG - Intronic
1064351968 10:14584811-14584833 AAACTGAAAGGACCTCTGCTTGG + Intronic
1064947400 10:20806249-20806271 GAATTCGGAGGGCCTCTGCTTGG - Intronic
1065973655 10:30824247-30824269 CAAGGCTGAGGGCCTGTGCTTGG + Intronic
1069602046 10:69714259-69714281 AAAGTGTGGGGGAACCTGCTTGG + Intergenic
1070563673 10:77587561-77587583 AGAGTGTGAGGGATTCTGCTTGG + Intronic
1070581058 10:77719843-77719865 GAAGTCTCAGAGCCTCTGCTTGG - Intergenic
1072305022 10:94098996-94099018 AAAGTGGAAGTGCCTTTGCTTGG + Intronic
1073070662 10:100791212-100791234 CAAGTGTGTGGGCATCTCCTGGG + Intronic
1073413724 10:103364195-103364217 AAAGTGTGAGGGGTTATGCCGGG + Intergenic
1074866298 10:117546115-117546137 AGAGTGTGAAGACCCCTGCTGGG + Intronic
1074983645 10:118639336-118639358 GAAGGATGAGGGACTCTGCTGGG - Intergenic
1076083251 10:127602716-127602738 AAAGTGTGCTGGACTCAGCTAGG + Intergenic
1076510114 10:131007344-131007366 GAGGTGTGAGGGCCTCGCCTAGG + Intergenic
1080284268 11:30590434-30590456 AAAGTGTGAGGACAACTGCCTGG + Intergenic
1080784691 11:35463795-35463817 AAGGTGTGAGAGCCTCCGATGGG - Intronic
1081691870 11:45083756-45083778 GAAGTATGTGGGTCTCTGCTGGG + Intergenic
1081738901 11:45424505-45424527 AAAGTCTGAGGGGCTGTCCTGGG + Intergenic
1081935786 11:46903101-46903123 AAAGTCAGAGGGTATCTGCTGGG - Intronic
1084058524 11:66653854-66653876 AAAGTGTGAGTCCCTATCCTGGG - Intronic
1084858378 11:72003105-72003127 CAAGAGTGAGGGCCCCTGCTGGG + Exonic
1084915795 11:72428146-72428168 AGAGTGAGTGGGCCTCTGCTGGG - Intronic
1085607470 11:77915249-77915271 GAACTGTGAAGGCCTGTGCTAGG + Intronic
1085845330 11:80058599-80058621 AAAGTGTCAGGAACTCTGCTTGG + Intergenic
1086089739 11:82993430-82993452 AATCTGTCAGTGCCTCTGCTGGG - Intronic
1089885312 11:121816013-121816035 AAAGTGTGATGCCATCTCCTGGG - Intergenic
1090440726 11:126723246-126723268 AAAGTGTGTCTGTCTCTGCTAGG - Intronic
1091517997 12:1205271-1205293 AAAGTGTGAGGATTTCTGATAGG + Intronic
1092165081 12:6337384-6337406 AAAGTGTGACTTCCTGTGCTGGG + Intronic
1092778858 12:11966904-11966926 ACTGTGTCAGGTCCTCTGCTAGG + Intergenic
1093532902 12:20188214-20188236 AATGAGTAAGGGCATCTGCTTGG - Intergenic
1095514885 12:42994760-42994782 AAGGTGTAAGGGACTCTGCATGG + Intergenic
1096238272 12:49944227-49944249 AAAGGGCCAGGGCCTGTGCTAGG + Intergenic
1101099502 12:101377924-101377946 AAAATGTTAGGGTCTCAGCTGGG + Intronic
1101743982 12:107523883-107523905 ATGGTGTGAGGGCCTCTTCTGGG - Intronic
1101797749 12:107991554-107991576 CACGTTTGAGGGCCTCAGCTGGG + Intergenic
1103762959 12:123264745-123264767 GAAGTGTGTGGGTCTGTGCTAGG - Intronic
1103965188 12:124634286-124634308 AAAGTGATATGGCCTCTCCTTGG - Intergenic
1104293460 12:127490354-127490376 AAGGTGTGATGGCCTCTGGTAGG + Intergenic
1104716175 12:131017850-131017872 TAAGTGTGTGTGCCTGTGCTGGG - Intronic
1105250584 13:18695843-18695865 CAAGTTTGAGAGACTCTGCTTGG - Intergenic
1105465590 13:20636695-20636717 AAGCTGTGAGGGCCTGTGTTGGG - Intronic
1107451379 13:40513074-40513096 AAACTGTGAAGATCTCTGCTGGG + Intergenic
1108603034 13:52011441-52011463 AGAGTGTGAGGGCATCGGCGCGG + Exonic
1112046538 13:95603450-95603472 AAAGTCTGTGGGCACCTGCTAGG - Intronic
1113224052 13:108139964-108139986 ACATTGTGAGGGCCTCTGACAGG - Intergenic
1113657731 13:112079292-112079314 GAACTGTGAGGGACCCTGCTGGG + Intergenic
1114493575 14:23118188-23118210 AAAGTGTGAGAGCATTGGCTGGG - Intronic
1114743459 14:25121641-25121663 AAAGTTTGAGAACCACTGCTGGG + Intergenic
1116476705 14:45348531-45348553 AAAGTGTGAGGGCAGCTGTTTGG + Intergenic
1116623633 14:47238349-47238371 TAAGTGTGAGGCACTGTGCTGGG - Intronic
1118391549 14:65300013-65300035 ACAGTGCCAGGGCCTGTGCTAGG + Intergenic
1124369084 15:29093241-29093263 AAAGTGTGCGGGCATCCGCGAGG - Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1125737126 15:41934588-41934610 CAAGTGTGAGCCCCTCTGCCTGG + Intronic
1125957977 15:43803856-43803878 AAACTGTGACGGCCCCAGCTAGG + Intergenic
1126098319 15:45104653-45104675 AAAGTGAGAGAGCCTATACTGGG + Intronic
1127242291 15:57129712-57129734 TAAGTGTTAGGCCCTGTGCTGGG - Intronic
1128338283 15:66802525-66802547 GGAATGGGAGGGCCTCTGCTAGG - Intergenic
1128376665 15:67081383-67081405 AAGGACTGAGGGCCTCAGCTGGG - Intronic
1129386466 15:75198860-75198882 AAAGTGAAAGTGCCTCTGATTGG - Intronic
1129777659 15:78247255-78247277 AAAGTTTGGGGGCTTGTGCTAGG + Intergenic
1131248796 15:90817787-90817809 GTAGTGTGAGGGCCTCAGCAGGG - Intergenic
1131922791 15:97348442-97348464 AAAATGGGAGGTCTTCTGCTTGG - Intergenic
1132415304 15:101615000-101615022 TCAGTGTGGGGGCCTCAGCTGGG - Intergenic
1135909395 16:26545501-26545523 AATGTGTCAGGGTCTATGCTAGG + Intergenic
1137829253 16:51527959-51527981 AAAGTGTGAGGGCAATTGCTCGG - Intergenic
1139534187 16:67561861-67561883 AGAGTGGGAGGGCCTCCTCTTGG - Intergenic
1143206657 17:5145796-5145818 AAAGTGTGAGTGGCTTTGCAGGG - Intronic
1144633063 17:16885206-16885228 ATAGTGTGAGGGTCTCTCATAGG + Intergenic
1145167730 17:20628895-20628917 ATAGTGTGAGGGTCTCTCATAGG + Intergenic
1145229420 17:21161764-21161786 AAAGTGATAGGGCACCTGCTAGG + Intronic
1145961300 17:28887952-28887974 GGAGTCTGAGGGCATCTGCTAGG - Intronic
1147588041 17:41664206-41664228 ATAGGGTGAGGGGCTGTGCTGGG - Intergenic
1147588053 17:41664249-41664271 CCTGTGTGAGGGCCTCTGCCAGG - Intergenic
1149128558 17:53266537-53266559 AAAATGTCAGGGTCTCTGCTAGG - Intergenic
1149296807 17:55268223-55268245 AAAGTGGGAGAGCCTCTGCCAGG - Intronic
1152560117 17:81073795-81073817 GAAGTGTGAGGGGCTCTTCTAGG + Intronic
1152794151 17:82298692-82298714 AAGGTGTGGGAGCCTCTGCGGGG - Intergenic
1152855418 17:82662761-82662783 AAAGTGTGAGGGTGACTGTTCGG + Intronic
1152862065 17:82702292-82702314 GAGATGTGAGGGCGTCTGCTGGG + Intergenic
1152994376 18:392688-392710 AAAATGTGAGGGCCTTTTATGGG + Intronic
1154438264 18:14363083-14363105 CAAGTTTGAGAGACTCTGCTTGG + Intergenic
1160427520 18:78788232-78788254 AACACGTGAGGGCCTCTGCAGGG - Intergenic
1160528875 18:79552281-79552303 GGAGTGTGAGGGCCCCTGCCCGG + Intergenic
1160778474 19:867334-867356 AAAGTGGGAGTGCCTCAGCCAGG + Intergenic
1160805658 19:991349-991371 AAGGTGGGCGCGCCTCTGCTCGG + Exonic
1161332549 19:3695234-3695256 AAAGTGTGAGTTCCACTCCTGGG - Intronic
1162857739 19:13481991-13482013 TGAGTGTGGGGTCCTCTGCTTGG - Intronic
1163437128 19:17302617-17302639 AGAGTGTCTGGGCCTCAGCTTGG - Intronic
1164322135 19:24158665-24158687 AAACTGTGAGGGACTCTTCATGG - Intergenic
1164640512 19:29821878-29821900 GAAGTGTGAGTGCCTCTGGGAGG + Intronic
1165219772 19:34305983-34306005 GAAGTCTGCGGGCCTATGCTTGG - Intronic
1165977004 19:39684944-39684966 CAAGTGTGAGCCCCTGTGCTTGG + Intergenic
1167124273 19:47538651-47538673 ACAGAGTCAGGGGCTCTGCTGGG - Intronic
1167837170 19:52083302-52083324 AAAGAGTGATTGCCTCTTCTAGG + Intronic
1167846053 19:52165238-52165260 AAAGAGTGAGTGCCTCTTTTAGG - Intronic
1168284083 19:55321811-55321833 CAAGAGTGAGGGCCTCAGGTCGG + Intronic
925091251 2:1157473-1157495 TAAGTGTGAAGGCCTCTTCGTGG - Intronic
925630097 2:5883258-5883280 CAAGTGTGAGCCACTCTGCTTGG - Intergenic
926613412 2:14970707-14970729 CAGGTGTGAAGACCTCTGCTAGG + Intergenic
927927158 2:27021865-27021887 AGGGTGTGAGCGCATCTGCTGGG - Intronic
928031657 2:27784811-27784833 AATGTGTTAGGCCCTATGCTAGG + Intronic
929901904 2:46012187-46012209 CAAGTGTGAGGCCCTGTGATAGG - Intronic
930502367 2:52237567-52237589 AAGGTGTGATAACCTCTGCTTGG - Intergenic
932883143 2:75522985-75523007 AAAGTGTCAAGGCCTCTGCTAGG + Intronic
934477286 2:94602130-94602152 GAAGTGTGAGGGACTCTGAGGGG + Intronic
935937548 2:108202782-108202804 AAAGTGTCAGCTCCTCTGATGGG + Intergenic
939417404 2:141917258-141917280 AATATGTGATGGCCTCTGATAGG - Intronic
945633043 2:212307834-212307856 AAAGTGTGGTGGCCTGTTCTGGG - Intronic
946274947 2:218624291-218624313 AATGTGTCAGGACCTATGCTAGG + Intronic
946308383 2:218869081-218869103 AAAGGGTGGGGGCCAGTGCTGGG + Intronic
946512832 2:220378329-220378351 AAAATGTGAGGGACTCGGCCTGG + Intergenic
948755190 2:240155337-240155359 AGCCTTTGAGGGCCTCTGCTGGG + Intergenic
948866544 2:240777878-240777900 AAAGTGCGAGGGACCCTGCGAGG - Intronic
949042704 2:241856834-241856856 AAAGTGTCAGGGGCTGGGCTGGG + Intronic
1169054270 20:2607519-2607541 ACACTGTGAGGAACTCTGCTCGG - Intronic
1170182549 20:13548509-13548531 AATGTGTCAGGTCCTCTGCTGGG + Intronic
1171400587 20:24870978-24871000 ACAGTGTTGGGGCCTCAGCTGGG - Intergenic
1172630656 20:36376157-36376179 AAAGAGACAGGGTCTCTGCTGGG - Intronic
1173261595 20:41441249-41441271 ACAGTGTCAGGCCCTTTGCTAGG - Intronic
1173562324 20:44014850-44014872 ATAGTGGGAGGGCCCCAGCTGGG + Intronic
1176457414 21:6926389-6926411 CAAGTTTGAGAGACTCTGCTTGG - Intergenic
1176835587 21:13791473-13791495 CAAGTTTGAGAGACTCTGCTTGG - Intergenic
1178907254 21:36646929-36646951 TAAGTGTCAGGGCTTGTGCTAGG + Intergenic
1179564483 21:42238257-42238279 AAGCAGTGAGGGCCTTTGCTTGG + Intronic
1182064202 22:27418793-27418815 AAAGGTTCAGGGCCTCAGCTAGG + Intergenic
1182272497 22:29164108-29164130 AAAATGTAAGGTCCTCAGCTGGG - Intronic
1182639222 22:31753528-31753550 TTAGGGTGATGGCCTCTGCTGGG - Intergenic
1182709293 22:32310578-32310600 AAAGTGGGAGAACCTGTGCTGGG - Intergenic
1183704874 22:39470180-39470202 AAAGTGGGATCGCCTCTGCAGGG + Intronic
1184396879 22:44247500-44247522 AAAGTGGGAGAACCTCTGCTTGG - Exonic
1184613519 22:45622116-45622138 ATGGGGTGAGGGCCTCTCCTGGG - Intergenic
1184656180 22:45943373-45943395 GGCGTGTGAGGGCCTCCGCTGGG - Intronic
949339688 3:3015872-3015894 AATGTGTGATTGCATCTGCTGGG - Intronic
949728252 3:7076080-7076102 CATGTGTGAGGCCCTCTGCTGGG + Intronic
951843475 3:27060449-27060471 AAAGAGAGAGGGCCTATGATTGG + Intergenic
954314557 3:49794101-49794123 AAAGAGTGAGAGGGTCTGCTGGG + Intronic
955473268 3:59309173-59309195 AAAAGATGAGAGCCTCTGCTAGG - Intergenic
956411823 3:68987309-68987331 AAAGTTTGATGGCCTATGCCCGG - Intronic
956532199 3:70232891-70232913 AAAGTTTGAAGCCCTATGCTAGG + Intergenic
956925571 3:73984224-73984246 CAATTATGAGGGCCTCTGGTAGG + Intergenic
960247363 3:115414280-115414302 AATGTTTGAGAGCCACTGCTTGG + Intergenic
960270292 3:115666557-115666579 AAAGTGTCAGGGACTGTGCTGGG + Intronic
962107411 3:132405933-132405955 AAAGTCTGACTGCCTCTGCTTGG - Intergenic
962899460 3:139746475-139746497 AAAGTGTGAGGGCCCCTCTATGG - Intergenic
962971698 3:140407430-140407452 GGAGTCTGAGGGCCTCTGGTAGG - Intronic
965691714 3:171364228-171364250 AAAGTTTGAGGACCTCTGCCAGG + Intronic
966763192 3:183435139-183435161 AAACTGTGATGGCCTCCCCTGGG + Intergenic
968009473 3:195264358-195264380 CAAGTGTGTGGGCCTCAGGTTGG - Intronic
968891173 4:3369186-3369208 AAAGTGTGGGGGAGTCTGCAGGG - Intronic
969278897 4:6155923-6155945 AATGTGTGAGAACCGCTGCTGGG + Intronic
971163725 4:24160739-24160761 TAAGTGTCAGGGCCTGTTCTAGG - Intergenic
972374247 4:38456092-38456114 AAAATGTGAGGGCCTGGACTGGG + Intergenic
972414629 4:38826147-38826169 CAAGTGTGAGGGACTCAGCATGG - Exonic
973713275 4:53650335-53650357 AAAGTGTCAGGGCCTAAGCAGGG + Intronic
974270548 4:59646142-59646164 AGAGTGTTGGGGCTTCTGCTTGG - Intergenic
975241663 4:72066838-72066860 AATCTGTGAGGGCAGCTGCTTGG - Intronic
976093518 4:81482306-81482328 AAAGTGAGAAGGCCTAGGCTGGG - Intronic
976155601 4:82140919-82140941 CAAGTGTGAGCCCCTGTGCTCGG - Intergenic
982246482 4:153357226-153357248 AAAGTGTGAGGGACTCTCAGTGG - Intronic
983352699 4:166613431-166613453 AAAGTTTGAAGGCCTATGTTTGG - Intergenic
986415647 5:7525616-7525638 AATGTGTGTGGGCCTCACCTTGG - Intronic
988218852 5:28315338-28315360 ACATGGTGAGGGCCTCTTCTGGG + Intergenic
989393628 5:40929146-40929168 AATGTGTCAGGGGCTGTGCTAGG + Intronic
989468299 5:41784003-41784025 CATGTGTGAGGGCCTAGGCTGGG + Intronic
992432452 5:76722444-76722466 AAAGTGTGTGGGCTCTTGCTTGG - Intronic
993910453 5:93676835-93676857 AAAATGTGAGGCCCTCTGTGAGG - Intronic
996343716 5:122467291-122467313 AAAGAATGAGGCCCTGTGCTAGG + Intergenic
996974072 5:129409268-129409290 AAAGTGTGGGGCCCTCTGATGGG - Intergenic
997351387 5:133233806-133233828 AAATTGAGAGGGCGTGTGCTGGG - Intronic
999988369 5:157025995-157026017 AAACTGTGAGGGACTCTTCGTGG - Intergenic
1000342927 5:160291410-160291432 AATGTTTCAGGGCCTCTACTGGG - Intronic
1001006838 5:168059532-168059554 AGAGTGTGTGGGCCTCTGATAGG - Intronic
1001238521 5:170050070-170050092 AAGTAGTGATGGCCTCTGCTAGG + Intronic
1001488090 5:172134274-172134296 AAAGAGTGAGGGGCTTTGGTAGG + Intronic
1001996169 5:176161002-176161024 CTACTGTGGGGGCCTCTGCTTGG - Intergenic
1002612513 5:180430727-180430749 AATGTCTGAGGCCCTCTGCTGGG + Intergenic
1002968644 6:1992109-1992131 ACAGTGTGTGGGCCTTTGTTAGG + Intronic
1006141121 6:31930551-31930573 GAATGGTGAGGGGCTCTGCTTGG + Intronic
1007086907 6:39154664-39154686 GAAATGTGAAGGCCTCTCCTTGG - Intergenic
1007528384 6:42517491-42517513 AAAGTGTCAGGCCCCATGCTGGG - Intergenic
1010568639 6:77450538-77450560 AAAGTATGAGGCACTCTGCCAGG + Intergenic
1011925109 6:92632953-92632975 AAAGTGGGAGGGGGTCTCCTTGG - Intergenic
1012629066 6:101441137-101441159 AAAGTCTGAAGGCCTGGGCTGGG - Intronic
1018386605 6:163310171-163310193 AACGTGTGACGGCCACTGCGAGG - Intronic
1018498797 6:164380073-164380095 AAAATGTGAGGGACTCTGGAAGG + Intergenic
1019647687 7:2139742-2139764 CCAGTGTGAGGGGCTCTGCGTGG + Intronic
1019898689 7:4002832-4002854 AAATTGAAAGAGCCTCTGCTGGG + Intronic
1022312932 7:29214282-29214304 AAAATGTGAGGGATGCTGCTGGG - Intronic
1023998695 7:45177437-45177459 ATCGTGTGAGTGCCACTGCTGGG + Exonic
1025845482 7:65192680-65192702 GAACTGTGAAGGCCTGTGCTCGG - Intergenic
1025895759 7:65698712-65698734 GAACTGTGAAGGCCTGTGCTCGG - Intergenic
1026454753 7:70561348-70561370 CAAGTGTGAGTCCCTGTGCTTGG - Intronic
1026481810 7:70785908-70785930 AAATGGTCAGGGGCTCTGCTGGG - Intronic
1027251218 7:76400016-76400038 AAAGGGAGAGGGGCTCTGCTGGG + Intronic
1027520197 7:79197417-79197439 AAAGTGTGAGGTTCTATACTAGG - Intronic
1029102252 7:98141468-98141490 AAAGTGTGAAGACCTCTGCTGGG - Exonic
1029604577 7:101590830-101590852 GAGGTGGGTGGGCCTCTGCTGGG + Intergenic
1031989977 7:128191239-128191261 CAGCTGTGAGGGCCTGTGCTGGG - Intergenic
1032504880 7:132427376-132427398 AGAGTGTGAGGGGCTCTGATGGG - Intronic
1034267411 7:149787877-149787899 TGACTGTGAGTGCCTCTGCTCGG + Intergenic
1034760136 7:153664665-153664687 AAAGTGTGAGGGGCTCAGATAGG + Intergenic
1034874708 7:154714973-154714995 AAAGTGTGAGGGCCTCTGCTTGG - Intronic
1034902897 7:154918488-154918510 AAAGTGTGAGGGCAGCTGTCCGG + Intergenic
1035291644 7:157843174-157843196 AATGTGTGAGAACCCCTGCTAGG + Intronic
1035692941 8:1571834-1571856 AAACTGTGGGGGCGTCTGCTGGG + Intronic
1035692959 8:1571916-1571938 AAACTGTGGGGGCGTCTGCTGGG + Intronic
1035887447 8:3307313-3307335 TAGGTGTGAGGGCCTCAGCTGGG - Intronic
1037561990 8:20083586-20083608 CAAGTGTCTGGGCCTCAGCTGGG - Intergenic
1043606313 8:82004668-82004690 TAAGTGTGAGAGTCTCTGCCTGG + Intergenic
1045111678 8:98942599-98942621 AAGGTGTGAAGCCCGCTGCTGGG + Intronic
1046589283 8:116186664-116186686 AACGTGGCAGGCCCTCTGCTAGG + Intergenic
1051294939 9:15585559-15585581 AAACAGTGATGGCCTCTGCAGGG + Intronic
1051317586 9:15858345-15858367 AAAGTGTGAGGCCTCCAGCTTGG + Intronic
1051711528 9:19935314-19935336 AAAGTTTAAGAGCCTCTGGTAGG + Intergenic
1051942485 9:22524862-22524884 CAAATGTGAGGTCCTCTACTTGG + Intergenic
1052966422 9:34343918-34343940 AAAGTCTCAGGGCCCCTGGTGGG - Intergenic
1052999164 9:34568056-34568078 AGAGGGTGAGGGCCTCTCCAGGG - Intronic
1053680783 9:40483983-40484005 GAAGTGTGAGGGACTCTGAGGGG - Intergenic
1053930769 9:43112295-43112317 GAAGTGTGAGGGACTCTGAGGGG - Intergenic
1054282930 9:63140952-63140974 GAAGTGTGAGGGACTCTGAGGGG + Intergenic
1054293865 9:63319498-63319520 GAAGTGTGAGGGACTCTGAGGGG - Intergenic
1054391890 9:64623987-64624009 GAAGTGTGAGGGACTCTGAGGGG - Intergenic
1054503839 9:65892341-65892363 GAAGTGTGAGGGACTCTGAGGGG + Intronic
1055017187 9:71631467-71631489 TATGTGTCAGGGCCTGTGCTCGG - Intergenic
1056401071 9:86227731-86227753 ACACTGTGACAGCCTCTGCTGGG + Intronic
1057961569 9:99462488-99462510 AAAGTGTGAGGGCCAGAGCAAGG - Intergenic
1060984845 9:127813983-127814005 GAAGGGAGAGGGCCTCTGCCTGG + Exonic
1061485428 9:130918237-130918259 AAGGAGTGAGTCCCTCTGCTGGG + Intronic
1062046304 9:134426031-134426053 AAACGCTCAGGGCCTCTGCTGGG - Intronic
1187784252 X:22866606-22866628 AAGGTGTGAGGGACTGTGCCGGG + Intergenic
1189315967 X:40056717-40056739 ACAGGGTGAGGGCCACGGCTGGG + Intronic
1190713757 X:53087639-53087661 AACTTGTCAGCGCCTCTGCTTGG - Intronic
1192162885 X:68801889-68801911 GAAGTGTGAGGTCCCCTGCCAGG + Intergenic
1192225863 X:69227426-69227448 TATGTGTCAGGCCCTCTGCTAGG + Intergenic
1192798092 X:74441352-74441374 AAAGTGTGTAGGTCTCTGCCTGG - Intronic
1195314748 X:103666466-103666488 AGAGTGTGAGCCCCTCTGGTGGG + Intergenic
1197882201 X:131178516-131178538 TGAGTGTCAGGCCCTCTGCTAGG - Intergenic
1197925828 X:131646479-131646501 AAAATATGAGGGCCTCAGATAGG - Intergenic
1198343851 X:135740830-135740852 AAAGCGTGAGGGCTTCACCTCGG + Intergenic
1198644731 X:138793627-138793649 TACGTGTGAGGGCTTCAGCTAGG + Intronic
1199741285 X:150738883-150738905 AAATTGTGAGGTCATCTGATGGG + Intronic