ID: 1034877393

View in Genome Browser
Species Human (GRCh38)
Location 7:154737619-154737641
Sequence CTGTGGACAAACAACCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034877385_1034877393 30 Left 1034877385 7:154737566-154737588 CCAACTCTTTCCTTATCCTATTG 0: 1
1: 0
2: 4
3: 21
4: 285
Right 1034877393 7:154737619-154737641 CTGTGGACAAACAACCAGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 127
1034877388_1034877393 14 Left 1034877388 7:154737582-154737604 CCTATTGCACAGCTGTGGAAACT 0: 1
1: 4
2: 52
3: 572
4: 2992
Right 1034877393 7:154737619-154737641 CTGTGGACAAACAACCAGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 127
1034877386_1034877393 20 Left 1034877386 7:154737576-154737598 CCTTATCCTATTGCACAGCTGTG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1034877393 7:154737619-154737641 CTGTGGACAAACAACCAGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034877393 Original CRISPR CTGTGGACAAACAACCAGTA GGG Intronic
902975219 1:20083481-20083503 CTGTGGACAAACAAGGACTTTGG + Intronic
906535787 1:46550342-46550364 CTGAGGACAAGCACCCAGTCCGG - Intronic
908638278 1:66192457-66192479 ATATGGACAAGCAAACAGTAAGG - Intronic
909856319 1:80537170-80537192 CTTTAGTCAAACACCCAGTAAGG + Intergenic
910567109 1:88656644-88656666 CTGTGGACCAACAAGGAGGAAGG + Intergenic
911034914 1:93532098-93532120 CTGTTGATAAACAACTAGTATGG + Intronic
916168137 1:161981397-161981419 CTGTGGGCAAGCAGACAGTAGGG - Intergenic
917035406 1:170742798-170742820 CTGTGAAAAAGCAACCAGGAGGG - Intergenic
922907660 1:229186780-229186802 CTGTGGGCAAACATCTACTAGGG + Intergenic
924319434 1:242833010-242833032 ATGTGGACAAAATATCAGTAAGG + Intergenic
1064627175 10:17273296-17273318 CTTTGGATAGACAACCAGGAGGG + Intergenic
1064708302 10:18095566-18095588 ATGTGGACACACAAAGAGTAAGG - Intergenic
1065251393 10:23818647-23818669 CTGTGATCAAACAAGCACTAAGG - Intronic
1067658692 10:48217362-48217384 CTGTGAACAAAAACCCAGCAGGG + Intronic
1067983734 10:51117258-51117280 CTGTGCACAAAGAAGCATTATGG - Intronic
1069245220 10:66196421-66196443 CTATGGCCAAGCAACCAGTTGGG - Intronic
1070601560 10:77869790-77869812 TTGTGGACACACAACCACTGTGG + Intronic
1071360986 10:84845770-84845792 CTGTGTACAAATAACCACCAGGG + Intergenic
1071409407 10:85374056-85374078 CTAGGGACACTCAACCAGTATGG + Intergenic
1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG + Intronic
1076776731 10:132701855-132701877 CTTTGGAGAAAGAACCAGAACGG - Intronic
1077989859 11:7396042-7396064 CTGAGGACAAGCAATCACTAAGG - Intronic
1079806964 11:24943938-24943960 CTGTGGACAAAATATAAGTAAGG + Intronic
1087201964 11:95354668-95354690 CTTTGGATAAATAACAAGTATGG + Intergenic
1088502108 11:110492926-110492948 ATGTGGACACACAAAGAGTAAGG + Intergenic
1088804737 11:113341828-113341850 CTGTGGAAAAACACCTAGAATGG - Exonic
1105781867 13:23712683-23712705 CTAGGGACAAACAACCAAAAAGG + Intergenic
1106531926 13:30601406-30601428 CTGTGGTCAAACTACTAGTACGG + Intronic
1107912582 13:45119362-45119384 CTGAAGAGAAACAAACAGTAAGG - Intergenic
1108519566 13:51234277-51234299 CTGTGGACAAACAGGCAACAAGG - Intronic
1114141680 14:19918646-19918668 CTGTGGTCAGACATCTAGTAAGG - Intergenic
1114196926 14:20486325-20486347 ATGTGGACACACAAGAAGTAAGG - Intergenic
1115163131 14:30418157-30418179 CTGTGGTCAGAAGACCAGTATGG + Intergenic
1116694553 14:48156206-48156228 CTGAGGAAAAATAACCATTAAGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1126405672 15:48320250-48320272 CTGTGGACATAGAACCAGAGAGG + Intergenic
1127502891 15:59571117-59571139 CTCTGGAAAAACAACCTGAATGG - Intergenic
1128412526 15:67413858-67413880 CTGTGCACAAAGCCCCAGTAAGG - Intronic
1128767498 15:70260045-70260067 CTGGGGAAAAAAAACCAGTAGGG + Intergenic
1129767913 15:78182006-78182028 CTGTGGACAGGCATCCAGTGGGG - Exonic
1132754868 16:1478635-1478657 CTTTGGGCATACACCCAGTAAGG - Intergenic
1135842949 16:25893395-25893417 CTGTGGACAAAGTCCCAGGAAGG + Intronic
1136318934 16:29469984-29470006 CCGTGGGGAAACAGCCAGTATGG - Intergenic
1136433505 16:30209328-30209350 CCGTGGGGAAACAGCCAGTATGG - Intergenic
1140945136 16:79761044-79761066 CTGTGCTCAAAGAAACAGTAAGG + Intergenic
1144108277 17:12006767-12006789 CTGTGGCAAAAAAAACAGTATGG - Intergenic
1145949386 17:28804303-28804325 CTCCAGAGAAACAACCAGTAGGG - Intronic
1159017845 18:63116286-63116308 CTGTGGAAAAACAAAGAATACGG + Intergenic
1161125181 19:2551978-2552000 CTGTGAACACACAAGCAGTCAGG - Intronic
1166945699 19:46394759-46394781 CTGAGGACACACAACTAGGAAGG + Intergenic
925992699 2:9266470-9266492 CTGAGGACAAAACACAAGTAAGG - Intronic
927945520 2:27132924-27132946 CTGTAGCCAAACAACCACCATGG + Intronic
928670079 2:33594031-33594053 CTGAGGTCATACAACCTGTAGGG - Intronic
928799107 2:35065433-35065455 CTGTCGACAAAGTACCAGGAAGG + Intergenic
929394139 2:41502426-41502448 ATGTGGACACACAAAGAGTAAGG - Intergenic
930376383 2:50572218-50572240 CTGTGCCCAAACAACCAGCCAGG + Intronic
931086838 2:58841402-58841424 CTATGGCCAAACAGCCAGTGAGG - Intergenic
931988870 2:67769148-67769170 CTGTAGACATACAACCTGGAGGG - Intergenic
933270906 2:80231853-80231875 CTCTGGAAAAAAAACTAGTAAGG - Intronic
935031423 2:99326580-99326602 CTGTGCACAAAAAACCACAAAGG + Intronic
940194342 2:151076724-151076746 CTTTGGACATACACCCAGAAGGG - Intergenic
941986243 2:171514546-171514568 CTGGGGAGAAACGACCAGGATGG + Intergenic
942333615 2:174855702-174855724 TAGTTGTCAAACAACCAGTAAGG + Intronic
942517053 2:176765426-176765448 CTGTGGACAAATAGCCACTCTGG + Intergenic
942749860 2:179275481-179275503 CTGAGGAGAAACAGCCAGTGAGG + Intergenic
944570665 2:201041804-201041826 CTGAGGACATATAAACAGTATGG - Intronic
948411939 2:237770366-237770388 TTATGGACAAACAACCCATATGG - Intronic
1169402589 20:5295624-5295646 CTGTGGAGAAACAAAGAGGATGG - Intergenic
1169675969 20:8155369-8155391 CTCTGTACAAACATCCAGAATGG - Intronic
1169743780 20:8922412-8922434 CTGTGGGAAAACAAACTGTAAGG + Intronic
1171062160 20:21976030-21976052 CTGTGCACCAACAACCACCAAGG - Intergenic
1174089579 20:48036304-48036326 CTGAGGACACACAGCAAGTAAGG - Intergenic
1180233515 21:46442402-46442424 CTGTGACCAAACAAGCAGAATGG - Intronic
1180688752 22:17692379-17692401 TGGTAGACAAACAACCAGTAAGG + Intronic
1182882541 22:33745893-33745915 CTGTGGAGAACTAACCAGGAGGG + Intronic
1184329458 22:43817619-43817641 ATGTGGAGAAAGAAACAGTAGGG + Intergenic
950327502 3:12125443-12125465 CTGTTGACAAACTACCACTTAGG - Intronic
951035145 3:17924920-17924942 CTATGGAGAAACAAACAGTAGGG + Intronic
951746367 3:25981974-25981996 CAGGGTACAAACAACCAGAAAGG + Intergenic
954131670 3:48564221-48564243 CTGTGGACAAACCCCCATTGTGG - Exonic
954149887 3:48652049-48652071 CTGTGGACACACAGCCAGCAAGG + Intronic
956704109 3:71984513-71984535 CTGTGGACCAAAACCCAGAAAGG + Intergenic
958436157 3:94098357-94098379 CTGTGGAGAATCAAGCAGTATGG - Intronic
958594716 3:96206832-96206854 AAGTAGACAAACAACTAGTAAGG + Intergenic
961466562 3:127085321-127085343 CTGAGGACACACAGCCAGCAAGG - Intergenic
964429398 3:156589140-156589162 CTGCAGACCAAGAACCAGTAAGG - Intergenic
966700238 3:182841404-182841426 CTGTCGACAAATACACAGTAAGG - Intronic
970781770 4:19746147-19746169 TTGTGGAAAAAGAACCAGGAAGG - Intergenic
971824335 4:31601639-31601661 CTGTTGACAAACATCCAGGTAGG - Intergenic
974390917 4:61266519-61266541 CTGTCCACAAACATCCAGTAAGG - Intronic
978109262 4:104943045-104943067 CTGGGGACATGCAACCAGTCTGG + Intergenic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
979081728 4:116352626-116352648 CTCTGGGGAAACAACCAATAGGG + Intergenic
979927291 4:126583176-126583198 CAGTGGGCACACCACCAGTAGGG - Intergenic
980398210 4:132243696-132243718 ATGAGGAAAAACAACCTGTAGGG + Intergenic
983076985 4:163338205-163338227 CTGTGAAGAAGCAAACAGTATGG - Intronic
984319440 4:178172742-178172764 GTGTGCACAAGAAACCAGTAAGG - Intergenic
984446240 4:179840093-179840115 CTGTGGAGTAACAACCAATCTGG - Intergenic
985710748 5:1427938-1427960 AAGTGGACAGAAAACCAGTAAGG + Intronic
988367277 5:30316998-30317020 CTGTAGGTCAACAACCAGTATGG + Intergenic
989610183 5:43283383-43283405 CTGTGAAGTAACAACCATTATGG - Intergenic
990770001 5:59232660-59232682 CTTTAGATAAACACCCAGTAGGG - Intronic
993671347 5:90764801-90764823 CTATGGGTACACAACCAGTATGG + Intronic
996880124 5:128287659-128287681 CTCAGAGCAAACAACCAGTAGGG + Intronic
1001552873 5:172617235-172617257 CTGTGGAAAAATAGCCAGTGTGG - Intergenic
1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG + Intergenic
1002673983 5:180894573-180894595 CTGTTGAAAAACAAGCAGTGGGG + Intergenic
1003621657 6:7706064-7706086 CTGAGGAAAAATACCCAGTACGG - Intergenic
1009527997 6:64772262-64772284 CTTTTGAAAAACAACCAATATGG - Intronic
1010988928 6:82457942-82457964 TTCTGGACAAACAAGCACTAAGG - Intergenic
1013314241 6:108925626-108925648 CTATGGACAAAAAGCCAATATGG + Intronic
1015281473 6:131439446-131439468 CTTTGGATATACACCCAGTAAGG - Intergenic
1018995606 6:168707858-168707880 CTGGGGAAAAACAAACAGTAAGG - Intergenic
1022522447 7:31016886-31016908 CAGGGGACAAACCACCAGCATGG - Intergenic
1024232542 7:47373618-47373640 CTGTGGACAAAAACTCAGTGAGG - Intronic
1028045496 7:86112434-86112456 CTTTGGATATATAACCAGTAGGG + Intergenic
1030293456 7:107895037-107895059 CTGTGGCAAAGCATCCAGTATGG + Intronic
1030461307 7:109839748-109839770 CTTTGGACACAGAACCAGTTTGG + Intergenic
1031774685 7:125892775-125892797 CTGTGGAAAAAAAAGGAGTAGGG - Intergenic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1034877393 7:154737619-154737641 CTGTGGACAAACAACCAGTAGGG + Intronic
1038282563 8:26179461-26179483 GTGTGGCCAAGCAACCAATAAGG + Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1044880104 8:96715139-96715161 CTGTGGGTAAAAAACCAGTGTGG + Intronic
1048962006 8:139587896-139587918 CTCTGGAAAAACAACCAATATGG - Intergenic
1051498101 9:17747524-17747546 CTCTGGCCAATCATCCAGTAAGG - Intronic
1052293224 9:26867947-26867969 CTTTGGAGAAAGAACAAGTATGG + Intronic
1055552997 9:77448166-77448188 CTGTTGAGACAAAACCAGTATGG + Intronic
1055585471 9:77754798-77754820 CTATGGAGATATAACCAGTATGG + Intronic
1057529288 9:95830164-95830186 CTGTGGACATGAAACCACTAAGG + Intergenic
1061220134 9:129245637-129245659 CGGTGGAGGAACAACCAGCATGG - Intergenic
1203453608 Un_GL000219v1:144112-144134 CTGTGGACAGCCAAGCAGCAGGG - Intergenic
1189084515 X:38007188-38007210 ATATGGACAAATATCCAGTATGG + Intronic
1190237893 X:48631456-48631478 ATGTGGACAAACAACATGAAAGG - Intergenic
1199430771 X:147757250-147757272 CTTTGAAGAAAGAACCAGTATGG + Intergenic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic
1202246291 Y:22823627-22823649 CTGTGGACAAAAAACTAGGCAGG - Intergenic
1202399279 Y:24457375-24457397 CTGTGGACAAAAAACTAGGCAGG - Intergenic
1202471501 Y:25212711-25212733 CTGTGGACAAAAAACTAGGCAGG + Intergenic