ID: 1034879512

View in Genome Browser
Species Human (GRCh38)
Location 7:154752676-154752698
Sequence AGAGCTACAGCCTCCTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034879512_1034879514 -8 Left 1034879512 7:154752676-154752698 CCACCGCAGGAGGCTGTAGCTCT 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1034879514 7:154752691-154752713 GTAGCTCTGACGTGCCCAAGAGG 0: 1
1: 0
2: 1
3: 5
4: 43
1034879512_1034879517 12 Left 1034879512 7:154752676-154752698 CCACCGCAGGAGGCTGTAGCTCT 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1034879517 7:154752711-154752733 AGGAAAGCCCTGACCTACAGTGG 0: 1
1: 0
2: 2
3: 10
4: 162
1034879512_1034879518 15 Left 1034879512 7:154752676-154752698 CCACCGCAGGAGGCTGTAGCTCT 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1034879518 7:154752714-154752736 AAAGCCCTGACCTACAGTGGCGG No data
1034879512_1034879522 30 Left 1034879512 7:154752676-154752698 CCACCGCAGGAGGCTGTAGCTCT 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1034879522 7:154752729-154752751 AGTGGCGGCCGCTCTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034879512 Original CRISPR AGAGCTACAGCCTCCTGCGG TGG (reversed) Intronic
901780820 1:11593452-11593474 AAAGCAACAGCCACCTGCAGAGG + Intergenic
903324512 1:22562488-22562510 AGACCTGCAGCCTCCTGAGAGGG - Intergenic
905272523 1:36796259-36796281 AGATCTGCAGCCTCCTGGGGAGG + Exonic
905675017 1:39818883-39818905 AGAGGTCCAGCCTCCTGAGGTGG - Intergenic
905895399 1:41542634-41542656 AGAGCCACAGTATCCTGCAGAGG + Intronic
912737400 1:112162052-112162074 AGAGCCACTGACTCCTGCAGTGG - Intergenic
916696639 1:167244279-167244301 AGAGCTACAGCCTCATCTGAAGG + Intronic
923153868 1:231258672-231258694 AGAGCCACTGCCTCCAGCCGGGG - Intronic
1066681599 10:37940694-37940716 TGAATTACAGCCACCTGCGGAGG - Intergenic
1073032237 10:100536004-100536026 AGGGCTCCAGCCTCCTCCCGGGG - Exonic
1074138740 10:110651865-110651887 AGTGCTGCATCCTCCTGCGCTGG + Intronic
1078432156 11:11296425-11296447 AGAGCTACAGTGTCCTAAGGAGG - Intronic
1088823850 11:113477330-113477352 AGAGCTACAGTGTCCTTGGGTGG - Intergenic
1090417368 11:126549791-126549813 AAAACTGCAGCCTCCTGGGGTGG + Intronic
1091015810 11:132049944-132049966 AGATCTGCAGCCTCCTGAGCAGG + Intronic
1096967500 12:55639887-55639909 AGAAATAAAGCCTCCTGCTGGGG - Intergenic
1098251699 12:68576973-68576995 AGAGCAACAGCATCTTGAGGAGG - Intergenic
1105898766 13:24739894-24739916 AGAGCTTCAGCATCCTGTTGGGG - Intergenic
1106788938 13:33135129-33135151 AGAACCACAACCTCCTGGGGTGG + Intronic
1109795413 13:67305724-67305746 AGAGCTGCAGCCTCATGTGAAGG - Intergenic
1110534499 13:76635557-76635579 AGAGCTAAAGGCACCTGCGCAGG - Intergenic
1117870730 14:60197956-60197978 AGAGCTAGAGCCTACAGTGGAGG - Intergenic
1118116884 14:62788237-62788259 AGAGCTACAGACTTCAGTGGAGG + Intronic
1122420756 14:101575643-101575665 AGTCCTACAGCCTCCTGCCTGGG - Intergenic
1125095095 15:35841498-35841520 AGAGCTTCAGCCTCCAGGTGAGG + Intergenic
1128239959 15:66095143-66095165 AATGCTGCAGCCTCCTGAGGTGG + Intronic
1128243637 15:66118337-66118359 AGATCTACAGGCTCCTGCTCCGG + Intronic
1128551724 15:68601923-68601945 AGAGCTGCATCCTCCAGAGGGGG + Intronic
1128763894 15:70239117-70239139 AGAGCTCCAGCCTCATGGGGAGG - Intergenic
1130898342 15:88188154-88188176 AGAGCTGCAGGTTCCTGTGGGGG - Intronic
1131535256 15:93232094-93232116 AGGACTCCAGCCTCCTGCAGTGG - Intergenic
1142709795 17:1716756-1716778 AGAGCTATAGCGTCCCGCAGAGG - Intronic
1142994859 17:3754627-3754649 AGTACTACAGCCTCCTGGGTAGG - Intronic
1143697555 17:8631174-8631196 AGAGCGCCAGCCTCCTGCCGCGG - Intergenic
1145271206 17:21405786-21405808 AGAGCTCCCGCCACCTGCAGGGG - Intronic
1145309410 17:21693173-21693195 AGAGCTCCCGCCACCTGCAGGGG - Intronic
1146650361 17:34602624-34602646 GGAGCTGCAGCCTCCTGCAGGGG - Intronic
1146676073 17:34774692-34774714 AGAGCTCCAGCCACCTGGAGAGG + Intergenic
1147548038 17:41418458-41418480 ACAGCTACAGGCTGCTGGGGTGG - Intergenic
1148139336 17:45317118-45317140 AAAGTTACAGCCTCCGGGGGAGG - Intergenic
1148594984 17:48846645-48846667 AGAGCCACTGCAGCCTGCGGTGG - Intronic
1150816875 17:68399282-68399304 ACAGCTACAGCCTCCAAAGGGGG - Intronic
1152149901 17:78592535-78592557 GGAGCACCAGACTCCTGCGGTGG + Intergenic
1156864098 18:41869318-41869340 AGAGCTGAAGCCTCCTTCAGGGG + Intergenic
1158898324 18:61936771-61936793 AGAGGAACAGCCTCCAGAGGTGG - Intergenic
1160779511 19:871688-871710 AGAGCCACTGCCACCTGCAGGGG + Intronic
1161403382 19:4078637-4078659 AGAGCTCCAGCCTCCGCTGGGGG - Intergenic
1163493822 19:17633052-17633074 AGAGGTACAGCCACCTGGTGTGG + Intronic
1165015214 19:32875592-32875614 AGAGGCTCAGCCTCCTGCTGTGG + Intergenic
1165742500 19:38212120-38212142 ACAGCTCCAGCTCCCTGCGGGGG + Exonic
1166935330 19:46329198-46329220 AGAGCATCAGCATCCTGCGGAGG - Exonic
1166966649 19:46533244-46533266 AGAGCCCAGGCCTCCTGCGGTGG + Intronic
1168336994 19:55602567-55602589 AGCGCTCCAGCCACCTGCGGCGG + Exonic
925225426 2:2179945-2179967 AGAGGAACAGCCTCCTCCTGAGG - Intronic
926192323 2:10738246-10738268 AGAGCTACTGCCACCTGTGAGGG - Intronic
931944451 2:67289488-67289510 AAATCTCCAGCCTCCTGGGGAGG - Intergenic
932317822 2:70797827-70797849 AGACCTACAGCCTCGTGAAGAGG + Intergenic
932429456 2:71665405-71665427 AGACCCACAGCCTGCTGCTGTGG - Intronic
935602246 2:104934428-104934450 AAAGCTACAGTCCCCTTCGGTGG - Intergenic
937841252 2:126526751-126526773 TGAGCAGCAGCCTCCTGAGGTGG + Intergenic
938449082 2:131400387-131400409 AGAGCTCCAGCCTCCAGCCTTGG - Intergenic
942305407 2:174602291-174602313 AGAATCACAGCCTCCTGCCGTGG + Intronic
946406700 2:219495796-219495818 AGAGATCCAGCTTCCTGCTGGGG - Intronic
1169901125 20:10552539-10552561 AGAGGGAGAGCCCCCTGCGGGGG + Intronic
1170532172 20:17304951-17304973 GGAGCTGCAGCCTGCTGAGGTGG - Intronic
1171124585 20:22590558-22590580 AGAGGTACAGCTTCACGCGGTGG + Intergenic
1173966719 20:47118015-47118037 AGAGCTACAGGCTCCTGCAAGGG - Intronic
1174868613 20:54162722-54162744 AGAGCTCCAGCTGGCTGCGGTGG - Exonic
1178677376 21:34642695-34642717 AAACCTACAGCCTCCTGGGTTGG + Intergenic
1181119653 22:20657459-20657481 AGAGCTCCAGCCTCCAGCTTGGG - Intergenic
1182117058 22:27762643-27762665 AGAGGTACAGCATCCTGCCCAGG - Intronic
1183332925 22:37231007-37231029 ATAGCTCCTGCCTCCTGGGGTGG - Intronic
1184336050 22:43853860-43853882 AGAGCTTCTGCCCCCTGGGGCGG - Intronic
1185338686 22:50282197-50282219 AGGGATTCAGCCTCCCGCGGCGG + Exonic
968926303 4:3550197-3550219 AGAGGTTCAGCCACCTGCGAAGG - Intergenic
970692985 4:18641508-18641530 AGGACTGCAGCCTCCTGGGGTGG + Intergenic
976790153 4:88869400-88869422 TGGGCTTCAGCCTCCTGCAGTGG + Intronic
977468437 4:97411523-97411545 AGAGCTCCTGCCTTCTGCGTTGG - Intronic
982941798 4:161568471-161568493 AGACCCAAAGCCACCTGCGGAGG - Intronic
987319477 5:16754767-16754789 AGGGACACAGCCTCCTGGGGTGG - Intronic
989710385 5:44389676-44389698 AGAGCTAGAGGCGCCGGCGGAGG - Intronic
997613580 5:135231532-135231554 TGAGCCACACCCTCCTGCAGTGG - Intronic
999693966 5:154171909-154171931 AGAGATACAGCCTCCTGCTGAGG - Intronic
1002927080 6:1610933-1610955 AGAACGGCAGCTTCCTGCGGCGG + Exonic
1003172736 6:3733007-3733029 AGAGCCTCAGCCTCCTGCAGGGG - Intronic
1004864293 6:19837963-19837985 ACTGCTATAGCCGCCTGCGGAGG + Exonic
1007759881 6:44127568-44127590 CGAGCTCCGGGCTCCTGCGGCGG - Intronic
1019018364 6:168896822-168896844 AGAGCTTCAGGCTCCTGGGGAGG - Intergenic
1020118322 7:5488631-5488653 AGAGCTGCCACCTCCTGCGTGGG - Intronic
1023424864 7:40024949-40024971 AGAGCTACAGCTGGGTGCGGTGG - Intronic
1028511840 7:91633965-91633987 AGAGCTCCAGGCTCCTAAGGAGG + Intergenic
1032067613 7:128783376-128783398 AGAACTACAGACTGCTGCTGTGG + Intergenic
1032395777 7:131588628-131588650 AGAGTTCCAGCCCCGTGCGGGGG - Intergenic
1034879512 7:154752676-154752698 AGAGCTACAGCCTCCTGCGGTGG - Intronic
1038450095 8:27634148-27634170 ACAGCTCCAGCCGCCTGCAGCGG + Intronic
1038455073 8:27667624-27667646 GGAGCAACAGCCTCCTGCCTGGG + Intronic
1039006011 8:33037815-33037837 GGAGCCACTGCCTCCTGAGGTGG - Intergenic
1039907639 8:41798203-41798225 AGAGCTCCAGCCTCCCCGGGGGG - Intronic
1041843877 8:62304771-62304793 AGAGTGACAGCATCCTGCTGTGG + Intronic
1047836255 8:128696576-128696598 TGAGCCACAGCCTCCTGGGAGGG - Intergenic
1049461743 8:142732847-142732869 AGGGCTACATTCTCCTGCGGGGG - Intronic
1053801231 9:41765603-41765625 AGAGGTTCAGCCACCTGCGAAGG - Intergenic
1054143970 9:61549234-61549256 AGAGGTTCAGCCACCTGCGAAGG + Intergenic
1054189660 9:61977753-61977775 AGAGGTTCAGCCACCTGCGAAGG - Intergenic
1054648855 9:67610856-67610878 AGAGGTTCAGCCACCTGCGAAGG + Intergenic
1054810832 9:69432656-69432678 AGATCTGCAGCCTCATGCGAGGG - Exonic
1055044500 9:71910786-71910808 AGGGCTACAGCCCCCGGCGCCGG + Exonic
1060236920 9:121870808-121870830 AGATTTACAGCCTCCTCGGGAGG + Intronic
1060884119 9:127138626-127138648 AGAGCCACAGAATCCTGTGGAGG + Intronic
1061433079 9:130543456-130543478 AGAGCTGCAGCCTCCAGCCCTGG + Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062065221 9:134523115-134523137 GGAGCTGCAGCCTCCAGCCGAGG - Intergenic
1062200484 9:135300279-135300301 AAAGCTCCAGCCTCCTGGGCTGG + Intergenic
1185531122 X:819956-819978 TGAGCTGCAGCCTCCAGCGTTGG - Intergenic
1186320667 X:8421004-8421026 AGAGCTCCAGCCTCCTGAATGGG + Intergenic
1187223148 X:17348830-17348852 AGAGCTACGGCCAGGTGCGGTGG + Intergenic
1190153335 X:47966823-47966845 TGAGGAACAGCCTCCTGAGGTGG - Intronic
1190774139 X:53539060-53539082 AGTGCTACAGCCTGCTGTCGAGG - Exonic
1195669960 X:107461320-107461342 AGAGATACAGCCTGCTGAAGAGG - Intergenic
1199038252 X:143078922-143078944 AGAGGAACAGCCTCCTGGAGTGG + Intergenic
1199972150 X:152869085-152869107 AGAGCTTTCGCCACCTGCGGAGG + Exonic