ID: 1034879611

View in Genome Browser
Species Human (GRCh38)
Location 7:154753214-154753236
Sequence GGGAATAAACGGGTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034879604_1034879611 25 Left 1034879604 7:154753166-154753188 CCTAAACAGTTTCTTTGGTGCTA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1034879611 7:154753214-154753236 GGGAATAAACGGGTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034879611 Original CRISPR GGGAATAAACGGGTGGTGCA TGG Intronic
No off target data available for this crispr