ID: 1034885135

View in Genome Browser
Species Human (GRCh38)
Location 7:154793521-154793543
Sequence CTCTAGCTAATTAGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885135_1034885143 8 Left 1034885135 7:154793521-154793543 CCAATTTCCCTAATTAGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1034885143 7:154793552-154793574 TGGGTATTTTATCTTTAAGGAGG No data
1034885135_1034885145 24 Left 1034885135 7:154793521-154793543 CCAATTTCCCTAATTAGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1034885145 7:154793568-154793590 AAGGAGGAGGAATTAGAGAATGG 0: 1
1: 0
2: 10
3: 137
4: 1226
1034885135_1034885141 5 Left 1034885135 7:154793521-154793543 CCAATTTCCCTAATTAGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1034885141 7:154793549-154793571 CCCTGGGTATTTTATCTTTAAGG 0: 1
1: 0
2: 1
3: 26
4: 209
1034885135_1034885144 11 Left 1034885135 7:154793521-154793543 CCAATTTCCCTAATTAGCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1034885144 7:154793555-154793577 GTATTTTATCTTTAAGGAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885135 Original CRISPR CTCTAGCTAATTAGGGAAAT TGG (reversed) Intronic
902139794 1:14343346-14343368 CTCAAGCAATTTAGGAAAATTGG + Intergenic
906664060 1:47605541-47605563 CAATAGTTAATTAGGGAAGTTGG + Intergenic
909060329 1:70871710-70871732 CTCTAGCTCATTAGGTAATAAGG - Intronic
909550936 1:76897736-76897758 CTCTGCCTAATAAGGGAACTGGG + Intronic
910867124 1:91798851-91798873 CTGTAGGGAATAAGGGAAATAGG + Intronic
912144732 1:106779452-106779474 CTCTAGTTCACTAAGGAAATGGG - Intergenic
912813651 1:112812187-112812209 CTCAACCTAATAAGGGAACTGGG - Intergenic
913245215 1:116864841-116864863 CTCGACCTAATAAGGGAACTGGG - Intergenic
913648634 1:120887718-120887740 GTCTAGATAATTAGGGACTTGGG + Intergenic
914078062 1:144375644-144375666 GTCTAGATAATTAGGGACTTGGG - Intergenic
914101117 1:144590857-144590879 GTCTAGATAATTAGGGACTTGGG + Intergenic
914172971 1:145244178-145244200 GTCTAGATAATTAGGGACTTGGG - Intergenic
914527621 1:148485315-148485337 GTCTAGATAATTAGGGACTTGGG - Intergenic
914755714 1:150560692-150560714 CCCTAGCTAATTAGGGAGGCAGG - Exonic
918327484 1:183424076-183424098 GTCTAGGTAAATAGGGAAATAGG - Intergenic
920797070 1:209149378-209149400 CTCTAGCTTATCAGAAAAATAGG - Intergenic
921632395 1:217451525-217451547 CATTAGCTAATGAGGGAACTGGG - Intronic
1064487712 10:15813060-15813082 CTCTAGCTAATTGTGGAGAATGG - Intronic
1066103300 10:32136627-32136649 CTCCACCTAATAAGGGAACTGGG + Intergenic
1067718576 10:48709084-48709106 CTCTAGGTAAGTAAGGAAACTGG - Intronic
1069360032 10:67631960-67631982 TGCTAGCGAATTGGGGAAATGGG + Intronic
1074740874 10:116483394-116483416 CTCTGCCTAATAAGGGAACTGGG - Intergenic
1077509986 11:2954087-2954109 TTCTATCTAATTAGGTAAAAAGG - Intronic
1077612279 11:3650683-3650705 CTCTGCCTAATAAGGGAACTGGG - Intronic
1077979326 11:7284354-7284376 CTCCAACTAATTAAGGAAAAAGG - Intronic
1081341142 11:41929167-41929189 ATATAGCTAAATATGGAAATGGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086280734 11:85184575-85184597 CTGTACCAAATGAGGGAAATGGG - Intronic
1092919028 12:13214433-13214455 CTATTGCTAATGAGGGAAATAGG + Intronic
1095642018 12:44496064-44496086 ATCTAGCTCATTAGGGATCTAGG - Intergenic
1095705386 12:45231304-45231326 CTCTATCTAATTTGCAAAATAGG + Intronic
1098070420 12:66668573-66668595 CTCTAGTTAAATAGGAAATTGGG + Intronic
1098653739 12:73004936-73004958 CTGTAGCTAATAAGGGAACTGGG + Intergenic
1100765346 12:97858396-97858418 CTGTAGTTCATTAGGGATATTGG - Intergenic
1102442579 12:112974958-112974980 CTCCAGCTACTTTGGGATATAGG - Intergenic
1102778603 12:115543212-115543234 CTTTAGGTAATTAGGCCAATTGG - Intergenic
1104257704 12:127154540-127154562 CTCGACCTAATAAGGGAACTGGG - Intergenic
1106536197 13:30645312-30645334 CTCTACCTAATTAGTAAATTTGG - Intronic
1109982717 13:69929979-69930001 CTCCAGCTGATTTGGGAAGTTGG + Intronic
1112889236 13:104211027-104211049 CTATGGCTAATAAGGGAACTGGG + Intergenic
1114877126 14:26733829-26733851 CTCTAGCTAATGAAGCACATGGG - Intergenic
1116334344 14:43638651-43638673 CTCTAGCTACTTAGAGCAAGTGG - Intergenic
1116441979 14:44963799-44963821 CTCAAGCTAATGAAGGAAGTAGG + Exonic
1117174245 14:53131136-53131158 CTCGACCTAATAAGGGAACTGGG - Intronic
1117516214 14:56504286-56504308 CTCTAGTTAATTATTGAAATTGG - Intronic
1118371745 14:65143494-65143516 CATTAGCTTATTAAGGAAATTGG - Intergenic
1118494147 14:66291510-66291532 CTCTGGCTATTAAGGGAAAGGGG + Intergenic
1121289516 14:92762614-92762636 CTCTGCCTAATAAGGGAACTGGG - Intergenic
1122570535 14:102696188-102696210 CTCAAGCTACTGTGGGAAATCGG + Intronic
1129262440 15:74376176-74376198 ATCTAGCTAATTAAGGACCTTGG + Intergenic
1133734852 16:8607272-8607294 ATGTAGCTCATTAGGGAAAGGGG + Intergenic
1154163984 18:12000540-12000562 CTCAAGCAGAGTAGGGAAATAGG - Intronic
1156534384 18:37848696-37848718 CTCTGGGTAATGAGGGTAATAGG + Intergenic
1156943030 18:42794045-42794067 CTCTAGTTAAATAGTGAACTTGG - Intronic
1157595285 18:48860415-48860437 CAGTAGCCAATTAGGGTAATTGG + Exonic
1158188853 18:54802599-54802621 CTCTAGCAGTTTAGGAAAATAGG - Intronic
1158858759 18:61571289-61571311 CTCTAGCTAATAATAGCAATAGG - Intergenic
1159585501 18:70279956-70279978 CTCAACCTAACTAGGGAACTGGG - Intergenic
1159929301 18:74295172-74295194 CTCGACCTAATAAGGGAACTGGG - Intergenic
1160188302 18:76693477-76693499 CTTTAGATACTTAGTGAAATGGG - Intergenic
1161368119 19:3892946-3892968 CATTAGCTAAATAGGGACATGGG - Intronic
1165835448 19:38752359-38752381 CTCGGCCTAATTAGGGAACTGGG - Intronic
925820241 2:7792985-7793007 CTCTAGCCAATTTGAGAACTTGG - Intergenic
926869719 2:17400770-17400792 CTCTAGCAAACTAAGCAAATTGG + Intergenic
930098988 2:47588630-47588652 CTCAACCTAATAAGGGAACTGGG + Intergenic
931474356 2:62572179-62572201 CACTAGCAGATTAGGAAAATGGG + Intergenic
933520084 2:83360735-83360757 TTCTTGCTAATGAGAGAAATAGG - Intergenic
934523692 2:95035486-95035508 CTCTAGCTCATGAGGGAGGTGGG + Intronic
935155887 2:100483058-100483080 GTCTATCTAATTAGGGCATTAGG - Intronic
935486129 2:103656537-103656559 CGATAGCTAATTAGGTAAATAGG - Intergenic
936599224 2:113879480-113879502 GTCTAGCAAATGAGGGAACTAGG - Intergenic
936754653 2:115692845-115692867 CTTAAGCTTATTAGTGAAATAGG + Intronic
936899294 2:117466141-117466163 CTGTAGCTCCTTTGGGAAATGGG + Intergenic
937818703 2:126283501-126283523 CTTTAGCTGATTAGGGAAAAAGG + Intergenic
940183035 2:150955789-150955811 CTCGATCTAATAAGGGAACTGGG - Intergenic
945301401 2:208219201-208219223 CTCGACCTAATAAGGGAACTAGG + Intergenic
945554778 2:211264213-211264235 CTCGACCTAATAAGGGAACTGGG - Intergenic
945858211 2:215092333-215092355 CTCGATCTAATAAGGGAACTGGG - Intronic
946871672 2:224090812-224090834 CTCAACCTAATAAGGGAACTGGG + Intergenic
1173145527 20:40520997-40521019 CTAATGCCAATTAGGGAAATGGG + Intergenic
1174683131 20:52427437-52427459 CTCTTGCAAATTAGAAAAATGGG - Intergenic
1178001284 21:28163958-28163980 CTCCACCTAATAAGGGAACTGGG - Intergenic
1178819782 21:35964484-35964506 CACTAGTTACTTGGGGAAATGGG + Intronic
1179828004 21:43978995-43979017 CTCAAGAAAATAAGGGAAATCGG + Intronic
1181742616 22:24933445-24933467 CTCTAACTGGTTACGGAAATAGG - Intergenic
949309083 3:2675467-2675489 CGCTATCAAAATAGGGAAATTGG - Intronic
953599347 3:44347992-44348014 CTCAACCTAATAAGGGAACTGGG + Intronic
956233414 3:67041646-67041668 CTCAACCTAATAAGGGAACTGGG + Intergenic
957675168 3:83356126-83356148 CTCTACCTAATAAGGGAACTGGG + Intergenic
960835430 3:121901746-121901768 CTCTAGCAAATGAAGAAAATAGG - Intronic
961125716 3:124415947-124415969 CTGTACCTTATTAGGGAAGTAGG + Intronic
966066919 3:175830450-175830472 CTCGGGCTAATAAGGGAACTGGG - Intergenic
969367379 4:6705089-6705111 CTCTAGCTAATTTGTGAAGGAGG + Intergenic
972590923 4:40486297-40486319 CTCTGGCATATTAAGGAAATTGG - Intronic
976577424 4:86690194-86690216 CTCTAGTTAAAGAGGGAAAATGG - Intronic
977141599 4:93379917-93379939 CACTATCTATTTGGGGAAATGGG - Intronic
978732650 4:112048210-112048232 CTCTGGCTAATAAGGTAAAGTGG + Intergenic
980714500 4:136613023-136613045 CTCGACCTAATAAGGGAACTGGG - Intergenic
981321984 4:143402638-143402660 CTCTAATTAAATAGGGGAATAGG + Intronic
982318899 4:154059019-154059041 CTCAACCTAATAAGGGAACTGGG - Intergenic
985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG + Intronic
988199189 5:28048385-28048407 CTCAACCTAATAAGGGAACTGGG - Intergenic
989979895 5:50631103-50631125 GTCTAGGTAATTAGGGACTTGGG + Intergenic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
994504990 5:100631131-100631153 CAGTAGCTAATAAGAGAAATAGG - Intergenic
997000608 5:129754991-129755013 CTTAAGCTAATTAAGGGAATGGG - Intronic
997426333 5:133805166-133805188 CTCAAGCTCAATGGGGAAATGGG - Intergenic
1000107017 5:158069467-158069489 TTCTAGCTCACCAGGGAAATGGG - Intergenic
1003008544 6:2404715-2404737 CTCTGGCTAATAAGGAAAACGGG - Intergenic
1008850121 6:56013784-56013806 CTCAGCCTAATAAGGGAAATGGG + Intergenic
1010841216 6:80650734-80650756 CTCCACCTAATAAGGGAACTGGG + Intergenic
1012000648 6:93650491-93650513 CTCTTTCTAATTTGGGGAATAGG + Intergenic
1012396785 6:98807220-98807242 CTATAGTTAATTAGCGAAACTGG - Intergenic
1013201959 6:107906564-107906586 TTCTAGCTAATCAGAGAAATTGG - Exonic
1016538811 6:145139723-145139745 CTCTAGCTAAATTTGAAAATGGG + Intergenic
1016633023 6:146254073-146254095 CTTTGGCTAATTAGGAAAATAGG + Intronic
1017005091 6:150023951-150023973 CTCTAGGTCATTAGGAAGATAGG + Intronic
1019332715 7:468594-468616 ATCTCACTAATTAAGGAAATAGG - Intergenic
1022447486 7:30481962-30481984 CTCGACCTAATAAGGGAACTGGG - Intergenic
1022984728 7:35640552-35640574 TTCTAACTTATTAGGGAAAAAGG - Intronic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1028931385 7:96416259-96416281 CTCAACCTAATGAGGGAGATAGG - Intergenic
1030193571 7:106832386-106832408 CTCTGCCTAATAAGGGAATTGGG - Intergenic
1030567885 7:111183402-111183424 CTCTGACTAATTATGGAAATTGG + Intronic
1031777425 7:125920350-125920372 CTGTAGCTAATAAGGGAACTGGG - Intergenic
1032896537 7:136257080-136257102 TTCTACCTAATTGGGGAAAGGGG + Intergenic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1037121342 8:15290798-15290820 TTCTTGCTAATTAAGAAAATGGG - Intergenic
1039498915 8:38001646-38001668 CTCAACCTAATAGGGGAAATGGG + Intergenic
1040749291 8:50686363-50686385 ATTTATCTAATGAGGGAAATAGG - Intronic
1042571366 8:70168867-70168889 CTCTAGTAAATTAAGAAAATGGG - Intronic
1043541761 8:81271131-81271153 ATCAAACAAATTAGGGAAATTGG - Intergenic
1044838777 8:96320232-96320254 CTCTGTCTAATTAGGGTCATTGG + Exonic
1045618387 8:103944924-103944946 CTTTGGCTAATTAGGCTAATAGG + Intronic
1046676601 8:117115633-117115655 ATCAAGCAAATTAGTGAAATAGG + Intronic
1047701219 8:127451347-127451369 AGCCAGATAATTAGGGAAATAGG - Intergenic
1048099859 8:131339260-131339282 ATCTTGCTAATTAAGGAAACTGG - Intergenic
1048140537 8:131790058-131790080 CTGTGGCTGATTGGGGAAATGGG + Intergenic
1049933026 9:474363-474385 CTCTTACTAATTAGTGATATTGG + Intronic
1051702600 9:19840440-19840462 GTATAGCTGAATAGGGAAATTGG - Intergenic
1056265707 9:84894829-84894851 CTGTAGCTAATTAGAGGAAAAGG - Intronic
1056406340 9:86279427-86279449 TTCTAGATATGTAGGGAAATAGG + Intronic
1057234939 9:93350351-93350373 CTCAGCCTAATAAGGGAAATGGG - Intergenic
1057533678 9:95876975-95876997 CTCTTGGTATTTAGGGAAATTGG + Intronic
1057637694 9:96786126-96786148 CTCTACATAAATAGAGAAATGGG - Intergenic
1189724193 X:43952223-43952245 CTCTCTCTCATTAGAGAAATGGG - Intronic
1190339283 X:49283894-49283916 TTCTAGCTAATAAAGGAAGTGGG - Intronic
1190465780 X:50723896-50723918 CTCGACCTAATAAGGGAACTAGG - Intronic
1191014104 X:55791277-55791299 CTCTACCTAATAAGGGAGCTGGG + Intergenic
1191825637 X:65362446-65362468 CTCGACCTAATAAGGGAACTGGG - Intergenic
1192309209 X:69996052-69996074 CTCCAGCAAATTAGGCAAGTGGG + Intronic
1192454725 X:71267227-71267249 CTCGACCTAATAAGGGAACTGGG - Intergenic
1193148098 X:78098060-78098082 CTCTGGCTAAATAGTGAATTGGG - Intronic
1194484320 X:94468966-94468988 CAATAGCTAATTATGCAAATAGG + Intergenic
1198441257 X:136665458-136665480 GACTAGCTAATGAGGGAAATGGG + Intergenic
1198825816 X:140696746-140696768 CTCTTCCTAGATAGGGAAATGGG + Intergenic
1201234177 Y:11894104-11894126 CTCAACCTAATAAGGGAACTGGG + Intergenic